ID: 1021586712

View in Genome Browser
Species Human (GRCh38)
Location 7:22216385-22216407
Sequence GGGAATGGAGAGGGGTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1833
Summary {0: 1, 1: 0, 2: 6, 3: 170, 4: 1656}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021586712_1021586725 17 Left 1021586712 7:22216385-22216407 CCAGCCCACCCCTCTCCATTCCC 0: 1
1: 0
2: 6
3: 170
4: 1656
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586712_1021586719 -9 Left 1021586712 7:22216385-22216407 CCAGCCCACCCCTCTCCATTCCC 0: 1
1: 0
2: 6
3: 170
4: 1656
Right 1021586719 7:22216399-22216421 TCCATTCCCTAGGAATCACCAGG 0: 1
1: 1
2: 0
3: 11
4: 127
1021586712_1021586724 16 Left 1021586712 7:22216385-22216407 CCAGCCCACCCCTCTCCATTCCC 0: 1
1: 0
2: 6
3: 170
4: 1656
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021586712 Original CRISPR GGGAATGGAGAGGGGTGGGC TGG (reversed) Intronic
900113618 1:1019816-1019838 GGGAGAGGAGAGTGGGGGGCGGG - Intergenic
900124149 1:1062140-1062162 GGGAAGGAAGAGGGGAGGGAAGG - Intergenic
900147579 1:1165193-1165215 GGGCAAGGAGTCGGGTGGGCAGG - Intergenic
900167028 1:1247915-1247937 GGGCAAAGGGAGGGGTGGGCAGG + Intergenic
900293932 1:1939276-1939298 GGGAAAGGTGAGGGGTGCCCAGG + Intronic
900364605 1:2305956-2305978 GGTCATGGTGAGGGGTGTGCTGG + Intronic
900432920 1:2611444-2611466 GGGCATAGACTGGGGTGGGCGGG + Intronic
900438153 1:2641123-2641145 GGGAAGGGGGAGGGCTGGGAAGG + Intronic
900438206 1:2641243-2641265 GGGTGTGGAGAGGGCAGGGCAGG + Intronic
900666261 1:3817518-3817540 GGGACAGGAGTGGGCTGGGCTGG - Intronic
900736613 1:4303237-4303259 TGGAATGGAGTGGGGTGGGGTGG - Intergenic
900737589 1:4308899-4308921 GGGAAGGGAGAGGGCAGGGCTGG - Intergenic
900938081 1:5779716-5779738 GGAAATGGAGAGAGCTGGTCTGG + Intergenic
901033348 1:6321425-6321447 GGGAGTGGAGTGGAGTGGGATGG - Intronic
901123267 1:6911998-6912020 GGGAAGGGAGAGGGAAGGGGAGG - Intronic
901791958 1:11658506-11658528 GGGCAGGCAGAGGGGTGGGAGGG - Intronic
901800463 1:11705253-11705275 TGCAATGGAGAGGGGTGCGTGGG + Intronic
901860290 1:12070012-12070034 GTGAGTGGAGAGGGGTGGTTAGG + Intronic
901870460 1:12135703-12135725 GGGAAGGGAGAGGGAGGGGACGG + Intronic
901895481 1:12308193-12308215 TGGAGTGGAGGCGGGTGGGCAGG + Intronic
901931625 1:12599580-12599602 GGGAGTGGAGAGAGATGGCCAGG - Intronic
902032100 1:13430550-13430572 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
902044353 1:13513785-13513807 AGGGATGGAGAGGGGAGGGGCGG + Exonic
902260689 1:15222717-15222739 GGGAAGGGAGAAGGGAGGGAAGG + Intergenic
902275504 1:15336819-15336841 GAGAATGAAGAGCGTTGGGCAGG - Intronic
902286834 1:15412594-15412616 GGGAAAGGAGAGACGGGGGCTGG - Intronic
902611982 1:17602934-17602956 GGGTCTAGAGAGAGGTGGGCAGG + Intronic
902726226 1:18337963-18337985 CTGAATGGTGAGGGGAGGGCCGG + Intronic
902746818 1:18480154-18480176 GGAAATGGTGAGGGGGGGTCTGG + Intergenic
902808759 1:18876459-18876481 GGCAAAGGACTGGGGTGGGCAGG + Exonic
903001476 1:20269290-20269312 GGGGGTGGTGGGGGGTGGGCAGG - Intergenic
903147419 1:21383545-21383567 GGGAGTGGGGAGGAGCGGGCTGG - Intergenic
903288328 1:22291025-22291047 GGGGATGGGGAGGGGAGGGGAGG - Intergenic
903475646 1:23617604-23617626 GGCAATGGGGTGGGGTGGGGGGG - Intronic
903499655 1:23794137-23794159 GTGAGGGGAGAGGGGTGGGGGGG + Intronic
903620631 1:24695642-24695664 AGGAAAGGAGGAGGGTGGGCCGG + Intergenic
903657224 1:24956807-24956829 TGGAGTGGAAAGGGGTGGGGAGG - Intronic
903664634 1:24998795-24998817 GGGAAGTTAGAGGGCTGGGCAGG - Intergenic
903792616 1:25905629-25905651 TGGGAAGGGGAGGGGTGGGCGGG + Intronic
903852331 1:26315596-26315618 GGAAGTGGAGAGGGAGGGGCGGG - Intronic
903867620 1:26410671-26410693 GGGAAAGGAGAGGGAGGGGAGGG + Intergenic
903888103 1:26552866-26552888 GGGAATAGAGGGGGCTGGGGTGG - Intronic
903931297 1:26863977-26863999 GGGACTGGAGGGGGCAGGGCGGG - Exonic
904004612 1:27357201-27357223 GGGAGGCGAGTGGGGTGGGCGGG + Intronic
904053782 1:27656905-27656927 GGCAATGGTTGGGGGTGGGCAGG + Intergenic
904296130 1:29520919-29520941 GGTCAGGGACAGGGGTGGGCAGG + Intergenic
904320793 1:29696838-29696860 TGGAAGGGAGAGAGCTGGGCCGG - Intergenic
904447616 1:30587637-30587659 TGGGAGGGAGAGGGGTGGGGAGG - Intergenic
904567382 1:31435767-31435789 GGGCACAGAGAGGGGTGGGGTGG + Intergenic
904990549 1:34589305-34589327 GGAGATGGAGAGGTCTGGGCTGG - Intergenic
905291004 1:36921911-36921933 GGGAAAGGAGAGAGGTGGGAGGG - Intronic
905400724 1:37701191-37701213 GGGAGTGGAGATGGTTGTGCAGG + Intronic
905544359 1:38785998-38786020 GGGAATGGAGAGGAAAGGGAAGG + Intergenic
905852377 1:41283597-41283619 GGAGAAGGAGAGGGCTGGGCTGG + Intergenic
906011945 1:42535561-42535583 TACAATGGAGAGGGGTCGGCCGG + Intronic
906500960 1:46341602-46341624 GGGAATCGGCTGGGGTGGGCAGG - Intronic
906550739 1:46664631-46664653 GGGAATGGATGGGGGTGGGTTGG + Intronic
906627846 1:47340047-47340069 GGGAAAGGGGAGGGGAGGGGAGG - Intronic
906666419 1:47625353-47625375 GAGATTGGCCAGGGGTGGGCAGG - Intergenic
906708127 1:47909771-47909793 GGGGATGGGGAGGGGAGGGGAGG - Intronic
906822157 1:48940970-48940992 GGGAAAGGAGGGGAGTGGGCAGG + Intronic
906876111 1:49541327-49541349 GTGGAGGGAGAGGCGTGGGCAGG + Intronic
907301155 1:53487017-53487039 GGCAATGGAGTGGGGTGGGTGGG + Intergenic
907371179 1:54004590-54004612 GTGTAGGGAGAGGCGTGGGCAGG - Intergenic
907420284 1:54342515-54342537 GGGAATGGGAGGGGGTGGGGAGG - Intronic
907427735 1:54391530-54391552 GGCAGTGGAGAGGGGGGAGCAGG - Intronic
907655942 1:56341976-56341998 GGGAGTGGTGAGGGGCGGGGAGG + Intergenic
907681829 1:56571453-56571475 GGGAAGGGAGAGAGGTGTGAGGG - Intronic
907767116 1:57423209-57423231 GAGAAGGAAGAGGGGCGGGCTGG + Intronic
908124298 1:61014719-61014741 GGGATGGGAGAGGAGAGGGCAGG + Intronic
908299892 1:62753425-62753447 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
908385037 1:63633280-63633302 GGGAAACGAGAGGCCTGGGCTGG + Intronic
908508220 1:64827317-64827339 GGGAGTGGAGATCAGTGGGCAGG + Intronic
908661790 1:66445108-66445130 GGGAAGGGAGAAGGGTGGGAGGG - Intergenic
908739723 1:67314825-67314847 GGGATGGGGGTGGGGTGGGCGGG - Intronic
909465316 1:75967291-75967313 GGTAATGGAGAGCAGTGGGTAGG - Intergenic
909622993 1:77687147-77687169 GGGGGTGGAGGGGGGAGGGCAGG - Intergenic
909738751 1:79001165-79001187 AGGAAGGGAGAGGGGGGGGAGGG + Intronic
910262713 1:85307636-85307658 GAGAGAGGAGAGGGGTGGGGAGG - Intergenic
910693828 1:89991632-89991654 GGGGATGAAGAGGAGGGGGCAGG + Intergenic
910772126 1:90841494-90841516 GAGAGGGGAGAGGAGTGGGCGGG + Intergenic
910791311 1:91054120-91054142 ACGAGTGGAGAGGGGTGGGAGGG - Intergenic
911173573 1:94796087-94796109 GGGGCTGGAGAGTGGTGGGGTGG - Intergenic
911653014 1:100411082-100411104 GGGAGTGGAGAAGGGTGGGCTGG - Intronic
911767919 1:101701653-101701675 GGGAGTGGGGAGGGGGGGGAGGG - Intergenic
911807988 1:102235141-102235163 GTGGAGGGAGAGGCGTGGGCAGG - Intergenic
911951549 1:104179347-104179369 GGGAGTGGAGTGGGGAGGGAGGG + Intergenic
912323736 1:108738542-108738564 CTGAATGGGGAGGGGTGGGGTGG - Intronic
912492301 1:110069234-110069256 GGGAATGTGTAGGGGAGGGCGGG - Intronic
912595443 1:110871290-110871312 GGGGTTGGAGAGAGGTGGTCTGG + Intergenic
912696190 1:111843874-111843896 GGGAATGGAGCTTGGTGGGTAGG + Intronic
912696944 1:111848978-111849000 AGGAAAGGAGAGGGAGGGGCAGG - Intronic
912777259 1:112513536-112513558 GGGAATGCAGGGGGGTGGTGGGG + Intronic
913122191 1:115752592-115752614 GGGAATGTGCAGGGGTGTGCAGG + Intronic
913129752 1:115828774-115828796 GGGACGGGCGCGGGGTGGGCGGG - Intergenic
914764852 1:150629098-150629120 GTGAATGGAAAGGGGATGGCTGG - Intronic
914915629 1:151817495-151817517 GGGAGTGTGGAGGGGTGGCCGGG + Intronic
914959592 1:152194659-152194681 GGGGATGGGGAGGGGTGAGGAGG - Intergenic
915218124 1:154353354-154353376 GGGAAAGGAAAGGGGAAGGCCGG - Intergenic
915364849 1:155309352-155309374 GGCAGTGGAGAGGGGTGCCCAGG - Intronic
915369615 1:155337568-155337590 GGGTATAGACAGGGGTGGGAAGG - Exonic
915440913 1:155944997-155945019 GAGGATGGAGAAGGGAGGGCTGG + Intergenic
915593133 1:156881762-156881784 GGGAAGGGACAGGTGGGGGCTGG + Intronic
915646888 1:157278964-157278986 GCGAATGGAGCGTGGTGGGCGGG + Intergenic
916006370 1:160664897-160664919 GGAAGTGGAGAGGGGTTGGGAGG - Intergenic
916563105 1:165949938-165949960 AGGAAAGGAGAGGGATGGGAAGG - Intergenic
916829587 1:168476886-168476908 CGGAAGGGATAGGGATGGGCTGG + Intergenic
916873345 1:168941005-168941027 GGGATTGGATAGTGGTGGGTGGG - Intergenic
917428334 1:174938800-174938822 GGAAATGAGGAGGGCTGGGCTGG + Intronic
918543546 1:185657627-185657649 AGGAGAGGAGAGGGGTGGGGAGG - Intergenic
918733099 1:188022947-188022969 AGGAAAGGAGAGGGGAGGGGAGG + Intergenic
918943012 1:191026361-191026383 GTGGAGGGAGAGGTGTGGGCGGG - Intergenic
919652996 1:200168705-200168727 GGGATTGGGGAGGGGAGGGCAGG - Intronic
919792527 1:201301187-201301209 AGGAATGGAGAGGGAAGGCCAGG + Intronic
919852245 1:201680813-201680835 GAGAAAGGAGAATGGTGGGCAGG + Intronic
919881450 1:201903763-201903785 AGGAAGGAAGAGGGGAGGGCAGG - Intronic
920013314 1:202886234-202886256 GGGAACGGGGAGGGGAGGGGAGG + Intronic
920047109 1:203140434-203140456 GGGGATGGGGAAGGGTGGGGAGG + Intronic
920100473 1:203514087-203514109 GGGGAAGGAGAGGGCCGGGCAGG - Intergenic
920382130 1:205541304-205541326 GGGAAGGGAGAGAGCTGGCCAGG - Intergenic
920748001 1:208647186-208647208 GGGAAGGGAGAGGGGAGGGAGGG - Intergenic
920854533 1:209652118-209652140 GAGAAGTGAGAAGGGTGGGCTGG - Intronic
920950132 1:210564805-210564827 TGGAATGGGGAGGGGAGGGGAGG + Intronic
921183949 1:212654339-212654361 GGGCATGGAGGTGGGTGGTCAGG + Intergenic
921338570 1:214111872-214111894 TGGCATGGGGAGGGCTGGGCAGG - Intergenic
921383811 1:214550891-214550913 GGGAATGGAGAGAGGGGACCAGG + Intronic
921954564 1:220968480-220968502 GTGAAGGAGGAGGGGTGGGCAGG + Intergenic
922020569 1:221700135-221700157 GGGAAGGGAGAGGGAAGGGAAGG + Intergenic
922020575 1:221700151-221700173 GGGAAGGGAGAGGGAAGGGAAGG + Intergenic
922272059 1:224043567-224043589 TGGAGGGGAGAGGGGTGTGCTGG - Intergenic
922347635 1:224709522-224709544 AGTATTGAAGAGGGGTGGGCTGG + Intronic
922702937 1:227772346-227772368 GGGAAGGCAGAGTGGTGGGCGGG - Intronic
922809069 1:228406088-228406110 GGGACTGGGGAGGCCTGGGCGGG - Intronic
923109453 1:230879580-230879602 GTGATTGGAGAGGGGGAGGCCGG - Intergenic
923228707 1:231963520-231963542 GGTGAGGGTGAGGGGTGGGCTGG - Intronic
923353146 1:233129117-233129139 GTGGAGGGAGAGGCGTGGGCGGG + Intronic
923493887 1:234508200-234508222 AGGAATGAAGAAGGGTGGGAGGG - Intergenic
923602046 1:235412097-235412119 GGGAAGGGAAAGGGATGGGAAGG - Intronic
923689332 1:236177246-236177268 GGGCATGGACCTGGGTGGGCTGG + Intronic
923810548 1:237309978-237310000 GTGGAGGGAGAGGTGTGGGCAGG - Intronic
924803939 1:247347909-247347931 GGGGATGGGGAGGTGGGGGCCGG - Intergenic
1063090076 10:2857082-2857104 GGGAAAGGAGAGAGGAGGGAAGG + Intergenic
1063164784 10:3451462-3451484 AGGAATGAAGAGTGGTGGGCAGG + Intergenic
1063207559 10:3849094-3849116 GGGAAGGGGGAGGGGAGGGGAGG - Intergenic
1063662317 10:8043268-8043290 GGGAAGGGAGAAGGAGGGGCGGG + Intergenic
1063796101 10:9515678-9515700 GGGAGGGGAGAGGGGAGGGAGGG + Intergenic
1064216686 10:13406395-13406417 GAGGATGGAGAGGGTGGGGCAGG - Intergenic
1064286078 10:13992444-13992466 GGACATGGAGGTGGGTGGGCAGG - Intronic
1064316133 10:14258991-14259013 GGGGATGGTGAGGGGTGTGAGGG + Intronic
1064694397 10:17950910-17950932 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
1065169117 10:23010223-23010245 GGGAAGGGAGAGAGGAGGGAAGG - Intronic
1065327611 10:24563068-24563090 GGGGATGGAGAAGGGTGGGGAGG - Intergenic
1065554868 10:26905539-26905561 GTGGAAGGAGAGGCGTGGGCAGG + Intergenic
1065641555 10:27787455-27787477 GGGAATGGAGTGGGGCGGGAGGG + Intergenic
1065664239 10:28040916-28040938 GGGAGAGAAGAGGGGTGGGAGGG - Intergenic
1065734986 10:28743483-28743505 GGGGGTGGAGAGGGATTGGCAGG + Intergenic
1065972775 10:30818399-30818421 GTGAGAGGAGAGGGGTTGGCTGG - Intergenic
1065995466 10:31055818-31055840 GTGGAGGGAGAGGTGTGGGCGGG + Intergenic
1066198968 10:33127962-33127984 GGGAAGGGAGGGGAGGGGGCGGG - Intergenic
1066278070 10:33888075-33888097 GGGAATGGAGAGGGAGTGGGTGG + Intergenic
1066294086 10:34039346-34039368 GGGAATGGACAGGGGAGGTAGGG - Intergenic
1066740474 10:38515010-38515032 GCGAATGGAATGGAGTGGGCTGG + Intergenic
1066767695 10:38817633-38817655 GGGAATGGACAGGAGTGGAATGG - Intergenic
1066778307 10:38911584-38911606 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1066778328 10:38911709-38911731 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1066778433 10:38912446-38912468 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1066778645 10:38918818-38918840 GGGAATGGAGTGGAGTGGAATGG + Intergenic
1066944971 10:41905078-41905100 GGGAATGGAGAGGAATGGAATGG + Intergenic
1067214790 10:44293075-44293097 GGGAAGCGAGAAGGGGGGGCGGG + Intronic
1067293871 10:44963213-44963235 GGGAGTGGAGAGGAGGGGTCTGG + Intronic
1067296006 10:44975475-44975497 GGGAATGGAGAGGGAAGTGGGGG - Intronic
1067429947 10:46236370-46236392 GGGCATGGAGGAGGGTGGACAGG - Intergenic
1067438058 10:46292635-46292657 GGGCTGGGAGAGGGCTGGGCAGG + Intronic
1067682167 10:48448175-48448197 GGGACTGGAGATGTGTGGGGAGG - Intronic
1067847573 10:49736164-49736186 GGGAATGGAGAGATCTGGGGAGG + Exonic
1067972629 10:50990871-50990893 GGGAAGGGGGTGGGGTGGGGGGG - Intergenic
1068310720 10:55271137-55271159 GGAAAGGGAGAGAGGTGGGCAGG + Intronic
1068688716 10:59894669-59894691 TGGGATGGGGAGGGGTGGGGGGG + Intronic
1068821002 10:61377237-61377259 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
1069090849 10:64197138-64197160 GGGGAGGGAGAGGCGCGGGCGGG - Intergenic
1069680691 10:70283587-70283609 GCGAAGGGAGAGGAGAGGGCCGG - Intronic
1069705953 10:70459089-70459111 GGGCTTGGAGTGGGGTGGGGTGG - Intergenic
1069773758 10:70915162-70915184 GGGAAGGGAGAGGGGCTGGGTGG + Intergenic
1069862696 10:71481392-71481414 GGGAAAGGAGAGGTGTGTGATGG + Intronic
1069867843 10:71514635-71514657 GTGAGGGGAGTGGGGTGGGCAGG - Intronic
1069954802 10:72043414-72043436 GGGAAGGGAGAGAGATAGGCTGG + Intergenic
1069973985 10:72198095-72198117 GGGGAGGGAGAGGGGAGGGGAGG + Intronic
1070183157 10:74033923-74033945 GTGAATGGAGATGAGAGGGCAGG - Intronic
1070402723 10:76067660-76067682 AAGAATTGGGAGGGGTGGGCTGG - Intronic
1070417358 10:76203657-76203679 TGGAATAGAGATGGGTGGACGGG - Intronic
1070417364 10:76203684-76203706 TGGAATAGAGATGGGTGGACGGG - Intronic
1070417374 10:76203735-76203757 TGGAATAGAGATGGGTGGACAGG - Intronic
1070417422 10:76203970-76203992 TGGAATAGAGATGGGTGGGATGG - Intronic
1070417433 10:76204024-76204046 TGGAATAGAGATGGGTGGACAGG - Intronic
1070417438 10:76204051-76204073 TGGAATAGAGACGGGTGGACAGG - Intronic
1070417451 10:76204129-76204151 TGGAATAGAGATGGGTGGACGGG - Intronic
1070417468 10:76204207-76204229 TGGAATAGAGATGGGTGGACAGG - Intronic
1070417473 10:76204234-76204256 TGGAATAGAGATGGGTGGACGGG - Intronic
1070417484 10:76204288-76204310 TGGAATAGAGATGGGTGGACAGG - Intronic
1070565827 10:77603295-77603317 GGGGGTGGAGATGGGTGGGGGGG - Intronic
1070813008 10:79307582-79307604 GGGAATGGAATGGGGTGAGGAGG - Intronic
1070972514 10:80579139-80579161 GGTGATGGAGAGAGATGGGCTGG + Intronic
1071450376 10:85787575-85787597 GGAAATGGAGCTGGCTGGGCAGG - Intronic
1071521866 10:86336558-86336580 GGGTATGGGGAGGTGTGGACCGG - Intronic
1071529028 10:86375070-86375092 GGGAATGGAGGGCAGAGGGCAGG - Intergenic
1071815173 10:89225059-89225081 GGGAGAGGAGAGGGATGGGAGGG + Intronic
1071901021 10:90120142-90120164 GTGGATGGAGAGGCGCGGGCGGG - Intergenic
1072044870 10:91644360-91644382 GGGTGGGGAGAGGGGTGGGGAGG - Intergenic
1072554215 10:96502459-96502481 GGGGATGGAGAGAAGTGGACGGG + Intronic
1072710597 10:97713634-97713656 GGGAAGGGAAAGGGGCGGGTGGG + Intronic
1073063703 10:100746345-100746367 GGGACTGGACAGGGTTGGGACGG - Intronic
1073136703 10:101224381-101224403 GGGAAGGGAGGGGAGGGGGCAGG + Intergenic
1073152661 10:101322520-101322542 GGAAATGGGGTGGGGTGGGGAGG - Intergenic
1073315876 10:102580497-102580519 GGGTATGGAGCCGGGTAGGCAGG + Intronic
1073366359 10:102945533-102945555 GGGGATGGAGTGGGGGGAGCAGG - Intronic
1073379066 10:103064049-103064071 AGGGATGTAGTGGGGTGGGCAGG + Intronic
1073532479 10:104245168-104245190 GTGGAGGGAGAGGCGTGGGCGGG + Intronic
1073538299 10:104297368-104297390 GGGAAGGGACAGAGGTGGCCAGG + Intronic
1073577977 10:104641193-104641215 GGGAGTGGGGAGGGGGCGGCCGG - Exonic
1073715900 10:106107110-106107132 GGGCATGGAGTTGGGGGGGCTGG - Intergenic
1073720042 10:106158008-106158030 GGGAAGTGGGAGAGGTGGGCAGG - Intergenic
1074189197 10:111121487-111121509 GGGAATGTAGAGGGGTGAAAGGG + Intergenic
1074409186 10:113210991-113211013 GGGAGGGGAGAGGGGAGGGGAGG - Intergenic
1074409195 10:113211008-113211030 GGGAGGGGAGAGGGGAGGGGAGG - Intergenic
1074409207 10:113211030-113211052 GGGATGGGAGAGGGGAGGGGAGG - Intergenic
1074664825 10:115709521-115709543 GGGAATGGAAAAGGCAGGGCAGG + Intronic
1074844844 10:117388736-117388758 GGGGATGGAGAGAAGTGGACTGG - Intergenic
1074927976 10:118093063-118093085 GGCCTTGGAGAGGGCTGGGCTGG + Intergenic
1075091500 10:119446463-119446485 GAGAAAGGCGAGGGGTGGGCTGG - Intronic
1075257953 10:120940022-120940044 GGGCCTGGAGTGGGGTGGGGTGG - Intergenic
1075307597 10:121382156-121382178 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
1075375075 10:121972431-121972453 GGGAAGGGAGTGGGGCAGGCAGG - Intronic
1075444551 10:122504530-122504552 GTTAATGGAGCGGGGTGGCCTGG - Intronic
1075626296 10:123966566-123966588 GGGAGTGGGGTGGGGTGGGGAGG + Intergenic
1075954866 10:126514772-126514794 GGGGGTGGAGAGGGGGGCGCAGG - Intronic
1076010067 10:126980656-126980678 GGGAAGGGCAGGGGGTGGGCAGG - Intronic
1076034079 10:127184452-127184474 GGGAATGGAGAGCTGAGGGCAGG - Intronic
1076291230 10:129347437-129347459 GGGAGAGGAGAGGGGAGGGGAGG + Intergenic
1076429021 10:130388768-130388790 GGGAATGGAGGAGGTGGGGCAGG - Intergenic
1076655726 10:132022224-132022246 TGGAAAGCAGAGTGGTGGGCAGG - Intergenic
1076676397 10:132149641-132149663 GGGGGTGGAGAGGGTGGGGCGGG - Intronic
1076708878 10:132320194-132320216 GGGGATGGTGGGGGGTGTGCAGG + Intronic
1076734015 10:132450792-132450814 GTGAAGGGAGAGTGGGGGGCAGG + Intergenic
1076917805 10:133433186-133433208 GGGACTGGGGCGGGGTGGACGGG - Intergenic
1076979110 11:195867-195889 GGGCCTGGTGAGGGGTGGTCTGG + Intronic
1077086237 11:752880-752902 GGGAATGGAGAATGGTTGGTTGG + Intronic
1077134499 11:991748-991770 GGGTGTGGAGAGGGGGCGGCAGG + Intronic
1077142445 11:1030541-1030563 GGGAAGGGAGAGGGAGGGGCAGG - Intronic
1077160563 11:1110666-1110688 GAGAATGGGGAGCGGAGGGCAGG - Intergenic
1077204482 11:1336088-1336110 GAGAAAGGAGTGGGGTGGGGAGG + Intergenic
1077287877 11:1775733-1775755 GGGGATGGAGAGGGGATGGAGGG + Intergenic
1077402928 11:2367902-2367924 GGGAATGGAGGGGTCAGGGCTGG + Intergenic
1077423913 11:2465647-2465669 GGAATTGGAGAGGGGAGGGGTGG + Intronic
1077426984 11:2485344-2485366 GGGGATGGAGTGGGGAGGGAAGG - Intronic
1077764556 11:5144408-5144430 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
1077787906 11:5404159-5404181 GGGGATGGGGCGGGGAGGGCGGG + Intronic
1078083990 11:8222957-8222979 GGGAATGGGCTGGGCTGGGCTGG - Intergenic
1078190491 11:9089913-9089935 AGGAGTGAAGCGGGGTGGGCTGG - Intronic
1078366969 11:10714909-10714931 GTGGATGTAGAGGGGTGGGGTGG + Intergenic
1078576017 11:12503409-12503431 GTGATTGGAGTGGAGTGGGCAGG + Intronic
1078826512 11:14935454-14935476 GGGAATGAAGAGGGGAGGGCAGG + Intronic
1079122481 11:17695809-17695831 GGGACTGGAGAGCGCTGGGCAGG + Intergenic
1080018544 11:27533681-27533703 GGGAATGGAGAGGAGGGGAAGGG + Intergenic
1080360929 11:31512807-31512829 GGGAATGGGGTTGGGTGGGCGGG - Intronic
1080719747 11:34837544-34837566 GAGAATGGAGAAAGGTGGGAAGG - Intergenic
1080815517 11:35752643-35752665 GGGGATGGAGAGAGGTAGGTGGG - Intronic
1081136187 11:39442429-39442451 GTGGAGGGAGAGGCGTGGGCAGG - Intergenic
1081655656 11:44855786-44855808 GGGCATGGTGGGGGGTGGGGTGG - Intronic
1081863791 11:46348523-46348545 GGGAAAGGGATGGGGTGGGCTGG + Intronic
1082009161 11:47438695-47438717 GGGGGTGGACAGGGGTGGGCAGG - Intronic
1082083897 11:48033276-48033298 GGGGGTGGAGTGGGGTGGGGTGG + Intronic
1082132330 11:48506142-48506164 GGGAGTGGGGAGGGGAGGGCAGG - Intergenic
1082132332 11:48506147-48506169 GGGAAGGGAGTGGGGAGGGGAGG - Intergenic
1082565795 11:54676762-54676784 GAGAGTGGGGAGGGGAGGGCAGG - Intergenic
1082734331 11:56839264-56839286 GGGCATGGGGAGGGGCGGGGCGG - Intergenic
1082775648 11:57242485-57242507 GGGAAAGGGGAAGGGAGGGCAGG + Intergenic
1082826707 11:57585120-57585142 GGGGATGGAGTGGGGAGAGCAGG - Intergenic
1083418838 11:62542425-62542447 GGTGATGGGGAGGGGAGGGCTGG - Intronic
1083990768 11:66244461-66244483 GGGGGTGCAGAGGGCTGGGCTGG - Exonic
1084005908 11:66323400-66323422 GGGGCTGGAGAGGGGTTGGTTGG + Intergenic
1084051260 11:66601565-66601587 CGGAAAGGAGAGGGGAGGGGAGG - Intronic
1084066191 11:66705645-66705667 GGCACTGGAGAGGGAGGGGCTGG - Intronic
1084149697 11:67282387-67282409 GGGAGTGGCAAGGGGTGGGGAGG - Intronic
1084269915 11:68023243-68023265 GGGAAGGGGGCGGGGTGGGTAGG - Intronic
1084665683 11:70574979-70575001 GGGGATGGGGATGGTTGGGCAGG - Intronic
1084741953 11:71145874-71145896 AGGAATGGGGAGAGGTGGGCTGG - Intronic
1085127471 11:74011388-74011410 GGTGCTGGGGAGGGGTGGGCTGG + Intergenic
1085400820 11:76234504-76234526 GGGGGTGGAAAGGGGTGGGGAGG + Intergenic
1085498799 11:76998012-76998034 AGGAAGGGAGAGGGTTGGACTGG + Intronic
1085592606 11:77778137-77778159 GGGAGTGGAGGGGGGAGGGAAGG + Intronic
1085957758 11:81421046-81421068 AGGACTGGAGAGGGGAGGGTAGG - Intergenic
1086148411 11:83580900-83580922 GGGAAAGGGGAGGGGAGGGGAGG - Intronic
1086472516 11:87130517-87130539 GGGAAAGAAGAGGGGATGGCAGG - Intronic
1086639388 11:89132913-89132935 GGGAATGGTGAGAGGCGGGGAGG + Intergenic
1086815048 11:91359801-91359823 GGGACTGTTGTGGGGTGGGCGGG - Intergenic
1087182424 11:95152977-95152999 AGGTCTGGAGAGGGCTGGGCTGG + Intergenic
1087404913 11:97718102-97718124 GTGGAGGGAGAGGTGTGGGCGGG - Intergenic
1087813212 11:102630947-102630969 GGGCCTGGAGAGGAGTGTGCTGG + Intergenic
1089118507 11:116114954-116114976 GGGGATGGGGAGGGGAGGGGGGG - Intergenic
1089461650 11:118657581-118657603 TGGAAGGGAGAGGGCTGGACTGG - Exonic
1089564485 11:119363722-119363744 GGGAAAGGAGGGGTGGGGGCTGG + Intronic
1089839088 11:121398771-121398793 GAGAATGGAGAGAGGTAGCCAGG - Intergenic
1090184143 11:124725313-124725335 GGGAATGGAGAGGAGTGGAATGG + Intergenic
1090242044 11:125190800-125190822 GAGAGTGCTGAGGGGTGGGCTGG - Intronic
1090782111 11:130016425-130016447 GGGAGTGAAGAGAGGTTGGCAGG + Intergenic
1090817744 11:130314353-130314375 GGTAACGGGGAGGGGAGGGCGGG - Exonic
1090975064 11:131673106-131673128 GGGGATGGAGAGGGCTAGGGAGG + Intronic
1091034355 11:132219809-132219831 GGGAGTGAAGAGGAGGGGGCTGG - Intronic
1091108563 11:132944203-132944225 GGGGAGGGAGAGGGGAGGGCGGG + Intronic
1091402359 12:188849-188871 GGGAACGGGGAGGGGGGTGCGGG - Intergenic
1091875768 12:3931703-3931725 AGGAAGGGTGAGGGGTGGGCTGG - Intergenic
1092192711 12:6532635-6532657 GGAGCTGGAGAGGGGTGCGCAGG - Intergenic
1092447966 12:8575203-8575225 GAAAATGGAGAAAGGTGGGCTGG + Intergenic
1092817353 12:12323144-12323166 GGGAAGGGAGGGGGATGGGAGGG + Intergenic
1094079391 12:26516162-26516184 GGGAGAGGAGAGGGGAGGGGAGG + Intronic
1095336501 12:41034440-41034462 GGAAATGGAGAAGGGAGGACAGG - Intronic
1095407808 12:41887349-41887371 GGGATGGGAGAGGGATGGACAGG - Intergenic
1095519081 12:43040453-43040475 GGGAGTGGTGAGGGAAGGGCAGG - Intergenic
1095985111 12:47994192-47994214 GGGTACGGGGAGGGGTGGTCTGG - Intronic
1096073801 12:48789587-48789609 GGGAATGGCTAGGTGGGGGCTGG - Intergenic
1096233839 12:49912616-49912638 GTCACTGGAAAGGGGTGGGCAGG + Intergenic
1096318926 12:50593777-50593799 GGGAAGGGAGAGGGGGGGGGAGG - Intronic
1096318942 12:50593804-50593826 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
1096318990 12:50593901-50593923 GGAAAAGGAGAGGGGAGGGGAGG - Intronic
1096319421 12:50598757-50598779 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
1096466245 12:51848828-51848850 GGGAAAGGGGAGGGGAGGGAGGG - Intergenic
1096534505 12:52262607-52262629 AGGAAGGGAGGTGGGTGGGCAGG + Intronic
1096668193 12:53180920-53180942 GGGAAGGGGGAGGGGAGGGGAGG + Intronic
1097013492 12:55969443-55969465 GGGAATAGGGAGGGGCGGGGTGG - Intronic
1097014406 12:55974796-55974818 GGGAATGCTGAAGGGTGGGCTGG + Intronic
1097136324 12:56859514-56859536 TGGAAGGGAGAGGGGTTGGGGGG - Intergenic
1097192538 12:57226322-57226344 TGGACTGGAGGGGGGCGGGCAGG - Exonic
1097282394 12:57852946-57852968 GGGATTGGAGAGGTGGGGGTGGG - Intergenic
1097552922 12:61098580-61098602 TTAAATGGAGAGGGGTGGGCTGG - Intergenic
1098035941 12:66302357-66302379 GGGAAGGGAGAGCGAGGGGCTGG - Intergenic
1098390905 12:69969018-69969040 GGGATTTGAGAGTGGTGGGATGG - Intergenic
1098435956 12:70468415-70468437 AGGAGTGAAGAGGGGTGGGGTGG - Intergenic
1099186528 12:79521373-79521395 AGGAAAGGAGAGGGGAGGGGAGG + Intergenic
1099636875 12:85224724-85224746 GGGCATGTTGAGGGGTGGGGGGG + Intronic
1100142956 12:91641393-91641415 GAGAATGGAGAGGGCAGGGTGGG - Intergenic
1100329198 12:93569784-93569806 AGGAAGGGGGAGGGGTGGGAGGG - Intergenic
1100479708 12:94966090-94966112 AGGAAAGGAGAGGGGAGGGGAGG + Intronic
1100847001 12:98669897-98669919 GGGCAGGAAGAGGGGAGGGCAGG - Intronic
1100847007 12:98669913-98669935 GGGCAGGAAGAGGGGAGGGCAGG - Intronic
1101308639 12:103555874-103555896 GGAAGTGGAGTGGGGTGGGGTGG - Intergenic
1101345592 12:103883192-103883214 GGGAAGGGAGGTGGGTGGGAGGG + Intergenic
1101533385 12:105595275-105595297 GTTAATGGAGATGGGTGGACTGG - Intergenic
1101598425 12:106188290-106188312 GGGAGTGGAGAGGAGTGTGGAGG - Intergenic
1102177490 12:110886749-110886771 GGGCATGGGGAGGTGTGGGGTGG + Intronic
1102208615 12:111107640-111107662 GGGAATGGAAAGGTCTGGGATGG + Intronic
1102657950 12:114499085-114499107 GGGATTGCAGTGGGGTGGGGAGG + Intergenic
1102692841 12:114774879-114774901 GGGAATGGGTGGGTGTGGGCAGG - Intergenic
1102879613 12:116474191-116474213 AGGAAAGGAGAGGGGAGGGGAGG - Intergenic
1103274615 12:119701182-119701204 GGGAAGGGGGAGGGGAGGGAGGG + Intronic
1103425573 12:120830505-120830527 GGGGAGGGGGAGGGGTGGGGAGG + Intronic
1103510353 12:121469279-121469301 GGGAATGGAGTGATGTGGGGTGG - Intronic
1103616057 12:122153173-122153195 GGGAATGGGGAGAGGTGGCTGGG - Intergenic
1103740551 12:123088322-123088344 GGGAAGAGAGAGGTGTGGGGTGG - Intronic
1103968673 12:124655966-124655988 GGGGATGGAGCGTGGTGGGCAGG - Intergenic
1104544449 12:129698627-129698649 GGGAGGGGAGAGGGGAGGGGAGG + Intronic
1104603672 12:130171344-130171366 TGGAATGGGGAGGGCTGGGGTGG - Intergenic
1104651052 12:130534254-130534276 GGGAGTGGAAGGGGGTGGGAGGG + Intronic
1104729036 12:131094958-131094980 GGGCATGGGAAGGGGTGGGTAGG - Intronic
1104805758 12:131588267-131588289 TGGAGTGGAGTGGGGTGGGGTGG + Intergenic
1104805786 12:131588357-131588379 TGGAATAGAGTGGGGTGGGGTGG + Intergenic
1104805799 12:131588407-131588429 TGGAATAGAGTGGGGTGGGGTGG + Intergenic
1104805818 12:131588487-131588509 TGGAATAGAGTGGGGTGGGGTGG + Intergenic
1104805832 12:131588542-131588564 TGGAATAGAGTGGGGTGGGGTGG + Intergenic
1104805851 12:131588622-131588644 TGGAATAGAGTGGGGTGGGGTGG + Intergenic
1104823418 12:131692219-131692241 GGGGTTGGAGAGGGGAGGGGAGG + Intergenic
1104850662 12:131871997-131872019 GGGGATGGAGACAGGAGGGCAGG + Intergenic
1104929454 12:132330014-132330036 CGGCTTGGGGAGGGGTGGGCAGG - Intergenic
1105514155 13:21075942-21075964 GGGGACGGAGGGGGGGGGGCGGG - Intergenic
1105697255 13:22900771-22900793 GTGGAGGGAGAGGTGTGGGCGGG - Intergenic
1105777667 13:23678170-23678192 GTGGAGGGAGAGGTGTGGGCGGG - Intergenic
1106083016 13:26516140-26516162 GGGTATGGACAGGGATGTGCAGG - Intergenic
1106157573 13:27172016-27172038 GGGGTTGCCGAGGGGTGGGCGGG - Intergenic
1106415623 13:29543693-29543715 GAGGAGGGAGAGGGGTGGGGAGG + Intronic
1106447480 13:29849862-29849884 GGACATGGAGAGGGGTGGGAGGG + Exonic
1106562883 13:30862089-30862111 GGGAAGGGGGAGGGGTTGGGGGG - Intergenic
1106600585 13:31183375-31183397 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
1106778131 13:33027988-33028010 GGGCAGGGAGAAGGATGGGCTGG + Intronic
1106883627 13:34158949-34158971 GGGAATATAGCAGGGTGGGCAGG + Intergenic
1106995014 13:35471155-35471177 GGGAACACAGAGGGCTGGGCTGG - Intronic
1107321784 13:39196962-39196984 GGAGATGGACAGGGGTGGGAGGG + Intergenic
1107682574 13:42866776-42866798 GGAGATGGAGAGTGGTGGACAGG - Intergenic
1107767857 13:43756521-43756543 GGGAAAGGAGAGGGGAGGGGAGG + Intronic
1107937988 13:45361298-45361320 GGGGATGGGGAGGGGAGGGGAGG - Intergenic
1108240200 13:48456684-48456706 TGGAACGGAGAGGGGTGTGTGGG + Intronic
1108299674 13:49061501-49061523 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
1108299720 13:49061601-49061623 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
1108299740 13:49061642-49061664 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
1108554710 13:51581787-51581809 TGCAGTGGAGAGGGTTGGGCAGG - Intergenic
1108586607 13:51875578-51875600 GGGTCTGGAGAGGGGTAGGTGGG - Intergenic
1109308449 13:60664485-60664507 GGGGATGGAGAGAGGGAGGCAGG + Intergenic
1109534122 13:63693910-63693932 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
1110211421 13:72978059-72978081 TAGAATGGAGAAGTGTGGGCAGG - Intronic
1110557199 13:76873196-76873218 GGGGATGGGGAGGGGTCGGTGGG + Intergenic
1110565191 13:76950711-76950733 TGGATTGGAGAGGGGTAGACAGG - Intronic
1111428808 13:88125341-88125363 GGGAATTACAAGGGGTGGGCAGG + Intergenic
1112015216 13:95325907-95325929 AGGAAAGGAGAGGGGAGGGGAGG - Intergenic
1112400815 13:99076979-99077001 GGCAACTGAGAGGGGTGGCCAGG + Intronic
1112900564 13:104352521-104352543 TGGGATGGAGTGGGATGGGCTGG - Intergenic
1113444742 13:110356549-110356571 GGGAACCCAGAGAGGTGGGCAGG - Intronic
1113554031 13:111216714-111216736 GGTAGGGAAGAGGGGTGGGCCGG + Intronic
1113650616 13:112031823-112031845 GGGAAGGGAGAGGGAAGAGCAGG - Intergenic
1113675246 13:112202518-112202540 GGGAATGGAGATGGACGTGCTGG - Intergenic
1113677304 13:112215469-112215491 GGAGATGGAGAGGGCTGAGCAGG + Intergenic
1113847893 13:113402931-113402953 GGGCATGGTGGGGTGTGGGCAGG + Intergenic
1113959538 13:114119034-114119056 GGGGGTGGAGAGGGAGGGGCAGG - Intronic
1113997868 14:16103010-16103032 GGGAAAGGAGAGGAGTGGAATGG - Intergenic
1114261391 14:21039147-21039169 GGGAAGGGAGAGAGGAGGGCCGG - Intronic
1114393434 14:22334912-22334934 GGGTTTAGGGAGGGGTGGGCAGG - Intergenic
1114565719 14:23631550-23631572 GGAAAAGGAAAGGGGTGGGGGGG - Intronic
1115174630 14:30547884-30547906 GTGGAGGGAGAGGTGTGGGCGGG - Intergenic
1115400146 14:32948767-32948789 AGGAATGGAGAGGGGCTGGTAGG - Intronic
1117232379 14:53733947-53733969 GGGACTGGTGAGGAGAGGGCAGG + Intergenic
1117552620 14:56851232-56851254 GTGAATGATGATGGGTGGGCAGG + Intergenic
1117774094 14:59164757-59164779 GGGGTTGGATAGGGGTGGGAAGG + Intergenic
1117792841 14:59358943-59358965 TGGAGTGGAGTGGGGTGGGGTGG - Intronic
1117920949 14:60724451-60724473 GGGAAAGGCGAGGGGTGGAGTGG - Intergenic
1118438352 14:65791255-65791277 GGGGGTGGGGAGGGCTGGGCTGG + Intergenic
1118731544 14:68670363-68670385 TGAACTGCAGAGGGGTGGGCCGG - Intronic
1118755890 14:68843550-68843572 GGGGGCGGAGGGGGGTGGGCAGG - Intergenic
1118928538 14:70217072-70217094 GGGAATGGAGTGGAGGGAGCAGG + Intergenic
1119214631 14:72859472-72859494 GGGAATGGTGTGGGGGGGGGGGG - Intronic
1119480117 14:74953704-74953726 GAGACTAGAGAGGTGTGGGCTGG - Intronic
1119505982 14:75173391-75173413 GGGAAGGAAGAGGGGAGGGGAGG + Intronic
1119620980 14:76131616-76131638 GGGCAAGAGGAGGGGTGGGCAGG + Intergenic
1119635010 14:76266805-76266827 AGGAAAGGAGAGGGGAGGGGAGG + Intergenic
1119636555 14:76278075-76278097 GAGATTGGAGAGGGGTAGGTTGG + Intergenic
1119649423 14:76373325-76373347 AGGGGTGGAGTGGGGTGGGCAGG - Intronic
1119759750 14:77141899-77141921 GGGAATCGAGAGGGGAGGAGGGG - Intronic
1119777787 14:77259172-77259194 GTGGATGGAGTGGGGTGGGGCGG - Exonic
1119920655 14:78442979-78443001 GGAAATGGACAGAGGTGGGAAGG + Intronic
1120129566 14:80788988-80789010 TGGAATGGATAGGGGGAGGCAGG + Intronic
1120817137 14:88872876-88872898 GGGAATGGAGAAAGGTGGCCAGG - Intronic
1121174903 14:91883720-91883742 CGGAGTGGTGAGGGATGGGCAGG + Intronic
1121176755 14:91896381-91896403 AGGAATGAAGAGGGGAGGGAAGG - Intronic
1121308414 14:92922013-92922035 GCAGATGGAGAGGGGTGGGCAGG + Intergenic
1121553588 14:94820206-94820228 AGGAAAGGAAAGGGGTGGCCAGG - Intergenic
1121737041 14:96225891-96225913 GGGAGTGGAGGGTGGTGGGCGGG - Intronic
1121775802 14:96589864-96589886 GAGCATAGAGAGGGGAGGGCAGG - Intergenic
1122052044 14:99067134-99067156 TGGTCTGGAGTGGGGTGGGCTGG - Intergenic
1122116698 14:99531156-99531178 GGGAGAGGAGGAGGGTGGGCTGG + Intronic
1122241151 14:100368556-100368578 GGAAATAGGGAGAGGTGGGCTGG + Intronic
1122329753 14:100904343-100904365 GAGAAGGGAGAGGTGTGGACGGG + Intergenic
1122378695 14:101286344-101286366 GGGAGTGGCGGGGTGTGGGCCGG + Intergenic
1122418814 14:101562939-101562961 GTGGATGGGGAGGGGTGGGCAGG + Exonic
1122463845 14:101917240-101917262 GGGAATGGAGAGGGAGCGTCAGG + Intronic
1122484151 14:102066646-102066668 GGTAGTGCAGAGGGGTTGGCTGG - Intergenic
1122835093 14:104426954-104426976 GAGGGAGGAGAGGGGTGGGCGGG - Intergenic
1123121386 14:105918568-105918590 GGGCCTGGACAGGGGTGGGTGGG + Intronic
1123229092 15:17082473-17082495 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1123229205 15:17083153-17083175 GGGAATGGAGTGGAGTGGAGTGG + Intergenic
1124036335 15:26056906-26056928 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
1125003722 15:34795841-34795863 AGAAAGGGGGAGGGGTGGGCTGG - Exonic
1125407333 15:39366987-39367009 GGGTGTAGAGAGGGGTGGGGAGG + Intergenic
1125605102 15:40935640-40935662 GGAGCTGGAGAGGGGTGGGAAGG + Intronic
1125684948 15:41558761-41558783 GGGAAAGGAGGGGCGTGGCCGGG + Intronic
1125968232 15:43891352-43891374 GGGAGTGGAGAAGGGAGGGAAGG + Intronic
1126738215 15:51752146-51752168 GGCGATGGGGAGGGGTGGACTGG + Intronic
1127328449 15:57917007-57917029 GGGAGGGGAGAGGGCTGGGAGGG + Intergenic
1127637991 15:60889335-60889357 GGGAAGGGAGTGGGGCGGGGGGG + Intronic
1127657742 15:61071553-61071575 GGGAAAGGGGAGGGGTAGGGAGG + Intronic
1127657751 15:61071570-61071592 GGGAGGGGAGAGGGGAGGGGTGG + Intronic
1127657754 15:61071575-61071597 GGGAGAGGGGAGGGGTGGGGAGG + Intronic
1127657785 15:61071634-61071656 GGGAGGGGAGAGGGGAGGGGTGG + Intronic
1127657788 15:61071639-61071661 GGGAGAGGGGAGGGGTGGGGAGG + Intronic
1128252237 15:66171522-66171544 GGGAATGGAGAGGTGGGAGGAGG + Intronic
1128333783 15:66773211-66773233 GGGGGTGGGGAGGGGTGGGTGGG + Intronic
1128482737 15:68054223-68054245 GGGAAGGTGGAGGGGCGGGCCGG + Exonic
1128545073 15:68561209-68561231 GGGCTGGGAGAGGGCTGGGCTGG + Intergenic
1128557272 15:68640288-68640310 GCGAAAGGAGAGGAGAGGGCAGG - Intronic
1128558811 15:68651058-68651080 AGGAATGGCGAGGGGTGGGGTGG + Intronic
1128593660 15:68925381-68925403 GGGAGGGGGGTGGGGTGGGCGGG + Intronic
1128674398 15:69597978-69598000 ATGAAGAGAGAGGGGTGGGCAGG + Intergenic
1128888728 15:71311949-71311971 GGCTATGGGGAGGGGTTGGCAGG - Intronic
1129183342 15:73890861-73890883 GGGGCTTGAGAGGGGTGGTCGGG - Intergenic
1129198215 15:73983512-73983534 GGGATTGGAGAGGGATGGGGAGG - Exonic
1129205539 15:74035241-74035263 TGGACTGGCGAGGAGTGGGCTGG - Intronic
1129273633 15:74432301-74432323 GGGATGGCAGAGGGGTGTGCAGG + Intronic
1129456063 15:75676723-75676745 GGACATGGGCAGGGGTGGGCTGG + Exonic
1129673204 15:77618304-77618326 GGGAAAAGAGGTGGGTGGGCAGG - Intronic
1129831831 15:78675789-78675811 GGGAATGAAGAGGTGTGGGTGGG - Intronic
1129844487 15:78761988-78762010 GGGAATGGACAGGCCAGGGCTGG + Intronic
1129975129 15:79815622-79815644 GGGAGTGGAGAGAGGAGGGTTGG - Intergenic
1130257327 15:82331880-82331902 GGGAATGGACAGGCTAGGGCTGG - Intergenic
1130597618 15:85258109-85258131 GGGAATGGACAGGCCAGGGCTGG + Intergenic
1130959817 15:88652364-88652386 GGAAATGGAGATGGGTGAGGAGG - Intronic
1131030776 15:89184538-89184560 GTGAGTGGGGAGGGCTGGGCAGG + Intronic
1131197091 15:90364322-90364344 GGGAGTGGGGGGGGGTGGGCAGG - Intronic
1131284156 15:91043688-91043710 GGGAATGAGGAGGTGTGGGAGGG + Intergenic
1131600940 15:93848151-93848173 GGGAATGGGCAGGGATGGGTGGG + Intergenic
1131721812 15:95177412-95177434 GGGCAGGGATAGGGGTGGGGAGG + Intergenic
1131830944 15:96354288-96354310 GGGGATGGAGGGGCGGGGGCGGG - Intergenic
1131852389 15:96556820-96556842 GGGAGTGGAGTGGGAAGGGCAGG + Intergenic
1131964825 15:97830738-97830760 TGGCATGGAGAGGGGTGTTCAGG - Intergenic
1132055425 15:98648119-98648141 AGGAGAGGGGAGGGGTGGGCGGG - Intergenic
1132219466 15:100094381-100094403 GAGAAGGGAAAGGGGTGAGCAGG + Intronic
1132457669 16:33072-33094 GGCAGTGGAGAGGGGAGGGGAGG + Intergenic
1132518574 16:377168-377190 GGGAAAGAACAGGTGTGGGCGGG + Intronic
1132572990 16:652065-652087 GGGCCTGGTGAGGTGTGGGCTGG + Intronic
1132665051 16:1077829-1077851 GTCCATGGAGAAGGGTGGGCTGG - Intergenic
1132704610 16:1237725-1237747 GGGAAAGGGAAGGGGTGGGGTGG - Intergenic
1132706903 16:1248700-1248722 GGGAAAGGGAAGGGGTGGGGTGG + Intergenic
1132763786 16:1524385-1524407 GGGTGGGCAGAGGGGTGGGCGGG + Intronic
1132774863 16:1587724-1587746 GGGAGTGCAGTGGGGCGGGCAGG + Intronic
1132841788 16:1981576-1981598 GGGAATCCAGAGAGGTGGGCAGG - Exonic
1132868476 16:2105026-2105048 GGGAAGGGGGAGGGGAGGGGAGG + Intronic
1132958013 16:2606645-2606667 GGGTCTGGAGAGGGGTTGGGTGG + Intergenic
1133015148 16:2936396-2936418 AGGGATGGAGAGGGCTGGGCAGG - Intronic
1133018191 16:2954697-2954719 GTGATTAGTGAGGGGTGGGCTGG - Intergenic
1133163434 16:3928276-3928298 GGGAAGGGAGAGGGAGGGGCAGG + Intergenic
1133201309 16:4206355-4206377 GGGAATGGATGGGGGTGGGTTGG - Intronic
1133270849 16:4610211-4610233 GCTGATGGAAAGGGGTGGGCTGG - Intronic
1133294501 16:4744724-4744746 GAGTAGGGAGAGGGCTGGGCGGG + Intronic
1133305406 16:4805124-4805146 GGAAATGGAGATAGGTGGGCTGG + Exonic
1133305435 16:4805202-4805224 GGGATTGGAGGGGTGAGGGCGGG + Exonic
1133326092 16:4943303-4943325 GAGAATGGAGAGGGGAGGGATGG - Intronic
1133331271 16:4975885-4975907 GGGAAGGGAGAGCATTGGGCTGG + Intronic
1133332076 16:4981021-4981043 GGGATGGGAGGTGGGTGGGCAGG + Intronic
1134047982 16:11115249-11115271 GGGAAAGGAGAGGAGGGGGAAGG + Intronic
1134071391 16:11262065-11262087 AGGAAGGGAGAGGGCTGGACTGG + Intronic
1134289709 16:12894052-12894074 AGGAAGGTAGAGTGGTGGGCTGG - Intergenic
1134602212 16:15542357-15542379 GACAGGGGAGAGGGGTGGGCAGG - Intronic
1134633750 16:15776828-15776850 GGGAGAGCAGAGGGGAGGGCAGG + Intronic
1134819756 16:17237389-17237411 GGGAAGGCAGAGGAGAGGGCAGG - Intronic
1134828390 16:17303019-17303041 GGGAAAGGAAAGGGGAGGACTGG + Intronic
1135055920 16:19232037-19232059 GGGGATGCAGAGAGGTCGGCCGG + Intronic
1135984534 16:27174378-27174400 GTGAATGGAAAGAGATGGGCAGG + Intergenic
1136185099 16:28583386-28583408 GGGAATGGATTGGGGTTGGGGGG - Intronic
1136407007 16:30053820-30053842 GGGGAGGGAGAGAGGTAGGCAGG + Intronic
1136685036 16:31988976-31988998 GGTAACGGAGTCGGGTGGGCAGG + Intergenic
1136785648 16:32932511-32932533 GGTAACGGAGTCGGGTGGGCAGG + Intergenic
1136884121 16:33921293-33921315 GGTAACGGAGTCGGGTGGGCAGG - Intergenic
1136903024 16:34062165-34062187 TGGAGTGGAGTGGGGTGGACTGG + Intergenic
1136903202 16:34063308-34063330 TGGAATGGAGAGGGATGGAATGG + Intergenic
1136903447 16:34064892-34064914 TGGAATGGAGAGGAATGGACTGG + Intergenic
1136903458 16:34064937-34064959 TGGAGTGGAGTGGGGTGGACTGG + Intergenic
1136906505 16:34098042-34098064 TGGAATGGAGAGGAGTGGAGTGG - Intergenic
1137344065 16:47638029-47638051 GGGAATGGGGAGGGGTGCTTTGG - Intronic
1137531402 16:49281055-49281077 GGGAACGAAGGGGAGTGGGCAGG + Intronic
1137576836 16:49605543-49605565 GGGAATGGAAGGAGGTGGGATGG - Intronic
1137585740 16:49663390-49663412 GGGCCTCGAGGGGGGTGGGCTGG - Intronic
1137884292 16:52085899-52085921 GGGAATGAAGAAGAGTGGGAGGG + Intergenic
1138019006 16:53459904-53459926 GGGAGTGGTGAGGTGGGGGCGGG + Intronic
1138445155 16:57058896-57058918 GGAGATGGAGGGGGCTGGGCAGG + Intronic
1138507269 16:57484621-57484643 TGGCATGTTGAGGGGTGGGCAGG - Intronic
1138532532 16:57642416-57642438 GGGAAGGGAGGGGAGGGGGCTGG + Intronic
1138595079 16:58025558-58025580 GGGAGTGACGCGGGGTGGGCTGG + Exonic
1139431147 16:66911705-66911727 GGGCATGGAGAGGGGTGTTTTGG - Intronic
1139442277 16:66974274-66974296 GCGGAGGGAGAGGGGCGGGCAGG + Exonic
1139486039 16:67257134-67257156 GGGTAGGGAGAGGGTTGGGCAGG + Intronic
1139559177 16:67730776-67730798 AGGCTTGGAGAGGGGTAGGCAGG + Intronic
1139908739 16:70383573-70383595 AGGAAAGGAGAGGGGTGGGGAGG + Intronic
1140128499 16:72137434-72137456 GGGAATGGAGGGGCATGGGCGGG + Intronic
1140224334 16:73066400-73066422 CGAAATGGAGATGGGTGTGCCGG - Intergenic
1140298868 16:73736944-73736966 GGATATGGAGAAGTGTGGGCAGG + Intergenic
1140320212 16:73943327-73943349 GGGAATGCAGCTGGGTGGGGTGG - Intergenic
1140412497 16:74749355-74749377 GGGGAGGGCGAGGGGTGGGTGGG - Intronic
1140589511 16:76335094-76335116 GGGAATGGGGTGGGGTGAGGTGG + Intronic
1141116930 16:81316475-81316497 GGGAGTGTGGAGGGGTGGGGGGG + Intronic
1141202680 16:81910000-81910022 GGGGATGGGGTGGGGTGGGGTGG + Intronic
1141457183 16:84151035-84151057 TAGAATGGAGAGGCGTGAGCAGG + Intronic
1141577451 16:84973309-84973331 GTGAATGGGGAGGGGAGAGCAGG + Intergenic
1141583640 16:85018335-85018357 GGGAAGGGAGCGTGGGGGGCAGG + Intergenic
1141676889 16:85522391-85522413 GGACATGGGGAGGGATGGGCTGG - Intergenic
1141714038 16:85716703-85716725 AGGGAGGGAGAGGGGAGGGCAGG + Intronic
1141721748 16:85759807-85759829 GGGATTAGAGAGGGCAGGGCCGG + Intergenic
1141775778 16:86121817-86121839 AGGAAGGGAGAGAGGTGGGGAGG - Intergenic
1141854924 16:86674258-86674280 AGGGATGGAGAGGGGTTGGAGGG - Intergenic
1142156626 16:88535376-88535398 GGGTATGGACAGGGCTGGGGTGG - Exonic
1142228086 16:88887170-88887192 GGGAATGGGGAGGCGCTGGCAGG - Intronic
1142228429 16:88888493-88888515 GGGGTTGGGGAGGGGTGGGGTGG + Intronic
1142359235 16:89618998-89619020 GGGAGGGGAGCGGGGGGGGCAGG - Intronic
1142466600 17:140685-140707 GGGCCTGGTGAGGGGTGGTCTGG + Intergenic
1142496771 17:310215-310237 GGGAAGGGAGAGGGGCTGGCTGG - Intronic
1142563650 17:825901-825923 GGGCATGGAGGAGGGAGGGCTGG + Intronic
1142711069 17:1724480-1724502 GGGAGTAGGGAGGGGTGGGGCGG + Intronic
1142760844 17:2041239-2041261 TGGAGTGGAGTGGGGTGGGTGGG + Intronic
1142889399 17:2933148-2933170 GGAAATGGAGTCGTGTGGGCGGG + Intronic
1143017229 17:3897555-3897577 GGGAATGGCTGGGGCTGGGCAGG - Exonic
1143249522 17:5512571-5512593 GGTAAAGGAGATGGGTGGGTGGG + Intronic
1143417584 17:6760861-6760883 GGCCATGGAGAAGGCTGGGCGGG + Intronic
1143697032 17:8629345-8629367 TGGAAGGGGGTGGGGTGGGCTGG - Intronic
1143704471 17:8687389-8687411 GGGAGTGGGGAGGAGAGGGCAGG - Intergenic
1143704600 17:8687700-8687722 GGGAGAGGAGAGGGGAGGGGAGG - Intergenic
1143708695 17:8718434-8718456 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
1143712439 17:8744025-8744047 AGGAAAGGAAGGGGGTGGGCTGG - Intronic
1144218056 17:13074381-13074403 GGGAGTGGAGGGGGGTGGGTGGG - Intergenic
1144523060 17:15967122-15967144 GGGAAAGGAGAGGGCGTGGCAGG + Intronic
1144646192 17:16975401-16975423 GGGGATGGAGTGGGGTGTGCTGG - Intergenic
1144807662 17:17978437-17978459 GGGCAGTGAGAGAGGTGGGCAGG + Intronic
1144867356 17:18345134-18345156 GGGCATGGAGAGGTGGGGCCTGG - Intronic
1145148757 17:20501818-20501840 GGGCAGGGAGAAGGGAGGGCTGG + Intergenic
1145342727 17:21969072-21969094 GGGAATGGAAGGGAGTGGGATGG + Intergenic
1145707799 17:26938313-26938335 GGGAGTGGAGTGGAGTGGGGTGG + Intergenic
1145790866 17:27625751-27625773 GGGGATGGAGAAGGCTGGGAGGG + Exonic
1145893641 17:28437476-28437498 GGGAGTGAAGAGGGGTGGACAGG + Intergenic
1145898687 17:28475774-28475796 GGGAAGGGGCAGGGCTGGGCAGG - Intronic
1146280342 17:31540502-31540524 GGTAAGGGAGATGGGAGGGCAGG + Intergenic
1146699990 17:34949063-34949085 GGGAAGGGGGAGGGGAGGGGAGG + Intronic
1146712461 17:35054542-35054564 AGGAATGGAGAGGTGGGGGAGGG - Intronic
1146845327 17:36178711-36178733 GGCCCTGGAGAGGGGTGGGCAGG - Intronic
1146873543 17:36390554-36390576 GGCCCTGGAGAGGGGTGGGCAGG - Intronic
1146880901 17:36441642-36441664 GGCCCTGGAGAGGGGTGGGCAGG - Intergenic
1147065846 17:37922319-37922341 GGCCCTGGAGAGGGGTGGGCAGG + Intergenic
1147122772 17:38345423-38345445 GGGAAAAGTGATGGGTGGGCAGG - Intergenic
1147145977 17:38484657-38484679 GGTAACGGAGTCGGGTGGGCAGG + Intronic
1147184755 17:38707037-38707059 GGGAGTGGAGAGGGGCAGTCTGG - Intronic
1147261527 17:39212055-39212077 GGGGATGGGGTGGGGTGGGAGGG - Exonic
1147285880 17:39402139-39402161 GGGAAGGGAGCTGGGTGGCCGGG - Intronic
1147293450 17:39461945-39461967 GGGAAGGGGGTGGGGAGGGCAGG - Intronic
1147375471 17:40020147-40020169 GGGCATGGAGAGGGAAGGGAGGG + Intronic
1147441137 17:40447901-40447923 AGGAGTTGAGAGGGGTGGGGTGG + Intronic
1147577284 17:41610084-41610106 GGGCAGGGAGAAGGGAGGGCTGG + Intronic
1148021257 17:44555562-44555584 TGGAATAGAGATGGGTGGGCTGG + Intergenic
1148152671 17:45405564-45405586 GGGGGTGGTGATGGGTGGGCGGG - Intronic
1148674167 17:49435340-49435362 GGGAAGGGAGAGCGGTCTGCAGG + Intronic
1148754230 17:49964214-49964236 GGGATTGGGGACGCGTGGGCTGG - Intergenic
1148758533 17:49987346-49987368 CGAAATGGAGAGGGGAGGGCTGG - Intergenic
1148798589 17:50209591-50209613 GGGAAGGGAGCCTGGTGGGCAGG + Intergenic
1148851193 17:50556153-50556175 GACAATGGGGAGGGGAGGGCAGG - Intergenic
1148856595 17:50582354-50582376 GGAAATGGAGAGCAGAGGGCTGG + Intronic
1148863975 17:50619056-50619078 GGGTGTGGAGGGTGGTGGGCGGG + Intronic
1149695867 17:58615620-58615642 GGGAATGGGTAGGGGAGGGGTGG + Intronic
1149965371 17:61157601-61157623 GGGAATGGGGGCGGGTGGGGGGG - Intronic
1149988710 17:61368236-61368258 GGGTATGGAGAGGAGCGGGTGGG + Intronic
1150125591 17:62632607-62632629 GGGAAAGAAGAGGGGAGGGGAGG - Intronic
1150243230 17:63652843-63652865 GGGAATGGAGATGGCTGAGATGG - Intronic
1150444610 17:65219039-65219061 GCTAAAGCAGAGGGGTGGGCAGG + Intronic
1150913562 17:69413428-69413450 AGGAATGGAGAGGAGTGAGCAGG - Intergenic
1150929864 17:69573046-69573068 AGGAAAGGAGAGGGGAGGGGAGG - Intergenic
1150947722 17:69765706-69765728 GGGAGGGGAGAGGAGTGGGGAGG - Intergenic
1151489655 17:74425180-74425202 GGAAATGAAGATGGGCGGGCAGG + Intronic
1151716397 17:75833184-75833206 GGGAAGGCAGAGAGGTGGGCAGG - Intronic
1151721381 17:75858261-75858283 GGGGTGGGAGAGGGGTGGGCAGG - Intergenic
1151907105 17:77056009-77056031 GGGAATGGAGGCCTGTGGGCTGG - Intergenic
1151963486 17:77419522-77419544 GGGAAGGGGGAGGGGTCAGCTGG - Intronic
1152267580 17:79305226-79305248 GGAAAGGGAGAGGTGGGGGCAGG + Intronic
1152268578 17:79310492-79310514 GAGAAAAGAGAGGGGTGGGAGGG - Intronic
1152300175 17:79491045-79491067 AGGAAAGGAGAGGGGAGGGGAGG + Intronic
1152327928 17:79652511-79652533 AGGAAAGGAGAGGGGAGGGGAGG + Intergenic
1152378349 17:79929953-79929975 GGGAGAGGAGAGGGGAGGGGAGG - Intergenic
1152485664 17:80591139-80591161 GGGAGGGGAGGGGGCTGGGCAGG - Intronic
1152571969 17:81124907-81124929 GTGAGTGGGGTGGGGTGGGCTGG - Intronic
1152572207 17:81125803-81125825 GGGGGTGGAGTGGGGTGGGTTGG + Intronic
1152655559 17:81517758-81517780 GGGACTGGAGGGGGGGGGGGCGG - Intronic
1152656415 17:81521474-81521496 GGGGATGGAGAGGGCTGAGGTGG - Intronic
1152706669 17:81847193-81847215 GGGGATGGGGAGGAGTGGGTTGG - Intronic
1152717669 17:81907665-81907687 GGGGATGGGGAGCAGTGGGCAGG + Intronic
1152753976 17:82079303-82079325 GGGACAGGAGTGGGGTGGGACGG - Intronic
1152789813 17:82273056-82273078 GGGTCTGGAGAGGGGAGGGTTGG - Intronic
1152793230 17:82293229-82293251 GGGCAAGGGGAGGGGAGGGCGGG + Intergenic
1152814524 17:82399633-82399655 CGGAATGGAGAGGGCAGGACTGG - Intronic
1152885269 17:82845644-82845666 CGGAAGGGACCGGGGTGGGCTGG - Intronic
1203201636 17_KI270729v1_random:280372-280394 TGGAATGGAGTGGAGTGGGGTGG + Intergenic
1203211237 17_KI270730v1_random:81098-81120 TGGAATGGAGTGGAGTGGGGTGG + Intergenic
1203211602 17_KI270730v1_random:83552-83574 TGGAATGGAGTGGGGTGGAATGG + Intergenic
1203211864 17_KI270730v1_random:85498-85520 GGGAATGGAATGGGGTGGAATGG + Intergenic
1203212159 17_KI270730v1_random:87544-87566 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1203212616 17_KI270730v1_random:92610-92632 TGGAATGGAGTGGAGTGGGGTGG + Intergenic
1203212864 17_KI270730v1_random:96199-96221 TGGAATGGAGAGGAGTGGAATGG + Intergenic
1203213265 17_KI270730v1_random:99105-99127 GGAAATGGAGTGGGGTGGAATGG + Intergenic
1203213286 17_KI270730v1_random:99225-99247 GGGAATGGAAAGGAGTGGAGTGG + Intergenic
1203213640 17_KI270730v1_random:103514-103536 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1203213957 17_KI270730v1_random:105614-105636 TGGAATGGAGTGGAGTGGGGTGG + Intergenic
1203214123 17_KI270730v1_random:106692-106714 AGGAATGGAGAGGAGTGGAGTGG + Intergenic
1203214146 17_KI270730v1_random:106832-106854 GGGAATGGAGTGGAGTGGAGTGG + Intergenic
1203214270 17_KI270730v1_random:107972-107994 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1203214384 17_KI270730v1_random:108729-108751 TGGAATGGAGTGGGGTGGAGTGG + Intergenic
1152961697 18:83881-83903 GGCAGTGGAGAGGGGAGGGGAGG + Intergenic
1154354671 18:13616072-13616094 GGGGTTGGGGAGGAGTGGGCTGG - Intronic
1155078043 18:22380274-22380296 GGTGATGGAGCGGGGTGGGTGGG + Intergenic
1155966065 18:32036616-32036638 GGGAGGGGAGAGGGGAGGGAGGG + Intronic
1155966075 18:32036636-32036658 GGGAGGGGAGAGGGGAGGGGAGG + Intronic
1155976745 18:32139859-32139881 GTGAAAGGAGAGGCGTGGGCGGG + Intronic
1156144627 18:34159904-34159926 GGGAGGGGAGTGGGGTGGGGTGG + Intronic
1156291041 18:35748723-35748745 GGAAAAGGAGATGGGAGGGCAGG - Intergenic
1156449937 18:37261220-37261242 GGGGCTGGAGGGGGCTGGGCAGG - Intronic
1156610204 18:38716362-38716384 GGCAATGGAGAGGTGTGGATGGG + Intergenic
1157095293 18:44680842-44680864 GGGTAAGGAAAGGGGTGGGAAGG + Intronic
1157499180 18:48178027-48178049 GGGCAAGGAGAGGGAGGGGCTGG - Intronic
1157577108 18:48750713-48750735 GGGAATGGGGAGGCCGGGGCTGG - Intronic
1157612137 18:48963781-48963803 GGGTGTGGAGTGGGGTGGGCGGG - Intergenic
1157612712 18:48968426-48968448 GGGAAGGGAGAGGGAAGGGAAGG + Intergenic
1158409832 18:57196095-57196117 GGGCACGGAGAGGTGAGGGCAGG + Intergenic
1158498936 18:57982901-57982923 GCGAATGCAGAGGGGAAGGCAGG + Intergenic
1158541108 18:58355251-58355273 AGGAATAGAGAGGGTTGGTCCGG + Intronic
1158601855 18:58863257-58863279 GGGAGTGGAGCGGGGTGGTGGGG - Intronic
1159624698 18:70679064-70679086 GGGCAAGGAGAGGGGAGGGGAGG - Intergenic
1160250247 18:77197210-77197232 GGGAAGGGAGGGGTGTGGCCAGG + Intergenic
1160409751 18:78667738-78667760 TGGATGGGAGAGGGGTGGGAGGG - Intergenic
1160409761 18:78667761-78667783 GTGGATGGGGAGGGGTGGGAGGG - Intergenic
1160526745 18:79543046-79543068 GGCAAGGGACAGGGGTGGCCAGG + Intergenic
1160663769 19:313384-313406 GGGAGGGCAGAGGGGAGGGCAGG - Intronic
1160721008 19:596886-596908 GGGCAAGGAGAGGGTTGGGGTGG + Intronic
1160734986 19:658312-658334 GCGCATGGAGGGGAGTGGGCTGG + Intronic
1160773546 19:844313-844335 GGCAAGGGAGAGGCGCGGGCGGG - Intronic
1160779588 19:871893-871915 GGGAGAGGGGAGGGGCGGGCGGG + Intronic
1160835299 19:1122103-1122125 GGCAATCGGGAGGGGAGGGCTGG - Intronic
1160867835 19:1263505-1263527 GGGGATGGAGAGGGGTTCCCAGG + Intronic
1160872137 19:1282386-1282408 GGGAGGGGAGAAGGGTGGGAAGG + Intergenic
1160939981 19:1615660-1615682 GGGAGTGCCGAGGGGTGGGTTGG + Intronic
1160966931 19:1750778-1750800 GGGCAGGGGGAGGGGTGGGCTGG - Intergenic
1160975559 19:1790625-1790647 GGGGATTGAGAGGGGAGGGAAGG - Intronic
1161093840 19:2377485-2377507 GGAAGGGGAGAGGGGTGGGGGGG - Intergenic
1161093908 19:2377628-2377650 GGGAGGGGAGAGGGGAGGGCAGG - Intergenic
1161179180 19:2867820-2867842 GGGAGGGGCGAGGGGTGGACAGG + Intronic
1161317746 19:3626168-3626190 AGGGATGGAGCGGGGTAGGCAGG - Intronic
1161498089 19:4598238-4598260 GGGCGTGGAGAGGGGAGGGGGGG + Intergenic
1161622897 19:5308656-5308678 GGGAAGAGAGCAGGGTGGGCAGG + Intronic
1161963555 19:7535571-7535593 TGGAATGGTAAGGGGTGGGGCGG + Exonic
1162183388 19:8886193-8886215 GGGAATTCAGAGGGATGGCCAGG + Intronic
1162332297 19:10037746-10037768 GGGAATGGAGGGGGCTCAGCCGG + Intergenic
1162333595 19:10046311-10046333 GGGAAAGAGGAGGGTTGGGCAGG - Intergenic
1162594020 19:11613154-11613176 AGGAAAGGAGAGGGGAGGGGGGG - Intronic
1162754891 19:12852047-12852069 GGGCATGGGTAGGGGTGGGTTGG + Intronic
1162909695 19:13842419-13842441 GGGAATGCGGTGGGGAGGGCGGG - Intergenic
1163095726 19:15055604-15055626 GGAAATGGAGAGGGGTTAGGAGG - Intronic
1163226079 19:15962563-15962585 GGGAATTGAGAGGAGGGTGCAGG - Intergenic
1163250806 19:16125292-16125314 AGGGATGGAGAGGAGGGGGCTGG + Intronic
1163288078 19:16361736-16361758 CGGAAGGGAGTGGGGTGGCCCGG + Intronic
1163314350 19:16532065-16532087 GGGAAGGGTGAGGGCTGGGTGGG + Intronic
1163334450 19:16661558-16661580 GGGGAAGGAGAGGCGTGCGCGGG + Intronic
1163351039 19:16777157-16777179 GGGAAGGGAAAGGGGAGGGAAGG + Intronic
1163351085 19:16777253-16777275 GGGAAGGGAAAGGGGAGGGAAGG + Intronic
1163351241 19:16777646-16777668 GGGAAGGGAAAGGGGAGAGCAGG + Intronic
1163351293 19:16777782-16777804 GGGAAGGGAAAGGGGAGGGAAGG + Intronic
1163489172 19:17606812-17606834 TGGAAGTAAGAGGGGTGGGCTGG - Intronic
1163530154 19:17844082-17844104 TGTAATGGAGAAGGGTGTGCAGG - Intronic
1163600904 19:18248417-18248439 GGGCATGGAGGGGGAGGGGCGGG + Intronic
1163633045 19:18426766-18426788 GGGAATGGAGGTGGGGGGCCAGG - Intronic
1164413155 19:28022230-28022252 GGGTATGGAGATGGGAGGGAGGG + Intergenic
1164580583 19:29432716-29432738 GGGGATGTAGGGGGGTGGGTGGG - Intergenic
1164671458 19:30074448-30074470 GGGAATGGTGAGGGGTGAAGGGG - Intergenic
1164976771 19:32579656-32579678 GGGAATGGGTGGGGGTGGGAGGG - Intergenic
1165091380 19:33389898-33389920 GAGAATGGGAAGGGCTGGGCCGG + Intronic
1165404116 19:35619586-35619608 GGGGAAGGGGAGGGGTGGGTGGG - Intronic
1165648882 19:37468868-37468890 GGGAGGGGAGCGGGGTGGGGGGG - Intronic
1166361237 19:42253802-42253824 GGGGATGGGGTGGGGTGGGTGGG + Intronic
1166409420 19:42546826-42546848 AGGGATGGAGAGGGGAGGGGAGG + Intronic
1166500818 19:43339947-43339969 GGTGGTGGAGAGGGCTGGGCTGG - Intergenic
1166505278 19:43367626-43367648 GGTGGTGGAGAGGGCTGGGCTGG - Intergenic
1166509281 19:43393469-43393491 GGTGGTGGAGAGGGCTGGGCTGG + Intergenic
1166678349 19:44753355-44753377 GGGGCTGGAGACTGGTGGGCCGG - Intronic
1166750185 19:45160882-45160904 GGGGGTGGGGAGTGGTGGGCAGG - Intronic
1166781946 19:45347605-45347627 GGGGATGGGGAGGTGAGGGCAGG + Intronic
1166785906 19:45366692-45366714 GGAAATGGAGAAGGAAGGGCTGG - Intronic
1166982488 19:46639417-46639439 GGGAAGGGAGACGGGCGGGGAGG + Intergenic
1167014982 19:46835300-46835322 AGGAAAGGAGAGGGGAGGGGAGG - Intergenic
1167148278 19:47695116-47695138 GGGCCTGAAGATGGGTGGGCGGG + Intronic
1167353758 19:48991535-48991557 GGGCCTGGGGTGGGGTGGGCCGG + Intronic
1167378626 19:49125759-49125781 GGGAATGGGGAGGTGGGGGCTGG + Intronic
1167602048 19:50459961-50459983 GGGTGTGGAGAGGGGAGGGGAGG + Intronic
1167637055 19:50661427-50661449 GGGAGGGGAGAGAGGTGAGCAGG + Intronic
1167676135 19:50887241-50887263 GGCAATGGGGAGGTGTGGGGAGG + Intergenic
1167693467 19:51001179-51001201 GGAAATGGAGAGGGCGGGGCCGG + Intronic
1167697895 19:51025707-51025729 GGAAATCGGGAGGGGGGGGCTGG + Intronic
1168072168 19:53959401-53959423 GGGAAGGGAAAGAGGGGGGCAGG - Intergenic
1168098055 19:54126625-54126647 GGGAAAGGTGAGGGGCGGCCGGG + Intronic
1168338527 19:55610815-55610837 GGGACTGGAGAGTGATGGGGTGG + Intronic
1168543512 19:57231693-57231715 AGGAAGGGAGAGGGGAGGGAAGG - Intronic
1168706945 19:58475778-58475800 GGGAATGGCGTGGGGGCGGCGGG + Intronic
925065333 2:925493-925515 GGGAAGAGAGGGGTGTGGGCAGG + Intergenic
925418461 2:3690406-3690428 GGGAAGGGGGAGGGGAGGGGAGG - Intronic
925751421 2:7093448-7093470 AGGAATGGACAGGAGTGAGCAGG + Intergenic
925755308 2:7127932-7127954 GGGAAAGGGGAGGGGAGGGGAGG - Intergenic
925913743 2:8589657-8589679 GGGAGAGGAGAGGGGAGGGCAGG + Intergenic
925913757 2:8589684-8589706 GGGAAGGGAGAGGGGAGGGGAGG + Intergenic
925913827 2:8589843-8589865 GGGAGAGGAGAGGGGAGGGGAGG + Intergenic
925918425 2:8623548-8623570 GGGGGTAGGGAGGGGTGGGCAGG - Intergenic
925990576 2:9251121-9251143 GGGAGTGGAGCGTGGAGGGCTGG + Intronic
926269471 2:11354338-11354360 GGGAAGGGAGGGGGGAGGGAGGG + Intergenic
926323204 2:11763225-11763247 AGGAGTGGAGAGAGGAGGGCTGG + Intronic
926325574 2:11782836-11782858 GGGCAAGGAGAGAGGTGGCCAGG - Intronic
926351738 2:12001700-12001722 GTGAATGGAGAAGAGTAGGCTGG + Intergenic
926437699 2:12854436-12854458 GTGGAGGGAGAGGGGTGGGCAGG - Intergenic
926646382 2:15294187-15294209 GGGAATACACAGGAGTGGGCAGG + Intronic
926669292 2:15561085-15561107 GGGAGTGGAGACGGGTGGGTGGG - Intronic
927137382 2:20106871-20106893 AGGAAGGGAGAGGCGCGGGCGGG - Intergenic
927181582 2:20450389-20450411 GGGAATGGGGAGGAGGGGGAAGG - Intergenic
927372170 2:22368818-22368840 GAGAATGGGGAGGGGAGGGGAGG + Intergenic
927416361 2:22884873-22884895 GGGAAAGGAATGGGGAGGGCAGG + Intergenic
927571468 2:24164499-24164521 GGGAATGGAGAGGGCTGCCCTGG + Intronic
927646253 2:24878837-24878859 GAGAATGAGTAGGGGTGGGCAGG - Intronic
927772641 2:25877734-25877756 CGGAAAGGAGAGGGGAGCGCTGG - Intronic
927844288 2:26463428-26463450 GGGAAGTGGGTGGGGTGGGCCGG + Intronic
927999162 2:27507792-27507814 GGGAGTGGTGAGGGGTGGGGAGG + Intronic
928084780 2:28339203-28339225 GGGGATGGAGAGGGGAGAGCCGG - Intergenic
928361444 2:30665135-30665157 GGGGATGGGGTGGGGTGGGGTGG + Intergenic
928559165 2:32461147-32461169 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
928701576 2:33903878-33903900 GTGGAAGGAGAGGCGTGGGCGGG - Intergenic
929002901 2:37365774-37365796 GGGAATGAAGATGGGTGAGGTGG + Intronic
929444527 2:41992008-41992030 GGGAGGGGAGAGGGGAGGGGAGG + Intergenic
929712723 2:44281134-44281156 GGGAAAGGAGAGGGGAGGGGAGG - Intronic
929810367 2:45184549-45184571 GGAAATGGTGAGGCCTGGGCTGG + Intergenic
929816507 2:45237155-45237177 GGGAAGTGAGAGGGGTGGAGTGG + Intergenic
930076406 2:47409102-47409124 GGGAAAGGGGAGGGGAGGGCAGG + Intronic
930137292 2:47915346-47915368 GGGTCTGGAGAGTGGGGGGCTGG + Intergenic
930151976 2:48068615-48068637 GGTAATGGCGAGTGGTGGGTGGG + Intergenic
930639536 2:53840619-53840641 GGGAGTGGAGGGGGGAGGGGAGG + Intergenic
930639551 2:53840646-53840668 GGGAGTGGAGGGGGGAGGGGAGG + Intergenic
930826317 2:55700278-55700300 GGGAGTGGGGAGGGGAGGGGAGG - Intergenic
931464613 2:62475419-62475441 GGGGCTGGAAATGGGTGGGCAGG - Intergenic
931827820 2:66019592-66019614 GGGAATGGAATGAGGTGGGAGGG + Intergenic
931925535 2:67068043-67068065 GAGAAGGGAGAGGGGAGGGGAGG - Intergenic
932039458 2:68283809-68283831 GGGAAGAGAGAGGCATGGGCTGG - Intergenic
932196253 2:69786563-69786585 AGGAAATCAGAGGGGTGGGCTGG - Intronic
932215282 2:69962366-69962388 GGAAATGGAGAGGGGTGGATAGG - Intergenic
932343645 2:70982126-70982148 GGGAGGGGAAGGGGGTGGGCAGG - Intronic
932422159 2:71607635-71607657 AGCAAAGGAGATGGGTGGGCGGG + Intronic
932423858 2:71616999-71617021 GGAAATGGACAGGGGGTGGCAGG - Intronic
932577885 2:72972674-72972696 GGGACCTGGGAGGGGTGGGCAGG + Intronic
932601896 2:73133392-73133414 GGGAAGGGAGAGGGGGAGGGAGG + Intronic
932621061 2:73265200-73265222 GGGAAAGGGGAGGGGGGTGCAGG + Intronic
933206467 2:79513108-79513130 GGGACTGGAGAGGCGGCGGCAGG - Intronic
933545965 2:83712818-83712840 GGGAAGGGAGCGGCGTGGGGAGG - Intergenic
933663415 2:84945803-84945825 GGGAATGGTGGGGGATGGGGTGG + Intergenic
934652153 2:96098871-96098893 AGGAATGGAGAAGGGAGGGTGGG + Intergenic
935014170 2:99164307-99164329 GGGAGTGGAGAGGGGAGGAGGGG - Intronic
935063298 2:99626558-99626580 AGGAAAGGAGAGGGGAGGGGAGG - Intronic
935308382 2:101759606-101759628 GGGAATGGGGAAGGGAGGGAAGG - Intronic
935308392 2:101759628-101759650 GGGAATGGGGAGGGGAGGGAAGG - Intronic
935558829 2:104540372-104540394 GGGCAGGGAGAGGAGTGGCCAGG - Intergenic
935695751 2:105769273-105769295 GGGGATGGGGAGGGGAGGGGTGG - Intronic
935878395 2:107536455-107536477 GTGGAGGGAGAGGTGTGGGCAGG - Intergenic
936073715 2:109388116-109388138 GGTCATGGAGAGGCGTGGGCAGG - Intronic
936344874 2:111667833-111667855 GGTATTGGAGAGAGCTGGGCAGG - Intergenic
936537744 2:113324992-113325014 GAGACTGGCGAGGGGAGGGCGGG - Intergenic
936538658 2:113332386-113332408 GGGACTGGAGAGGTGTGGCTAGG + Intergenic
937751463 2:125479523-125479545 GTGGAGGGAGAGGCGTGGGCAGG - Intergenic
937926863 2:127174444-127174466 GGGAATGGGAGGGGGTGGGTGGG - Intergenic
938109606 2:128554980-128555002 GGGGAAGGAGAGGGGTGGAGGGG + Intergenic
938207706 2:129438295-129438317 GGGCATGGAGAAAGTTGGGCAGG - Intergenic
938580090 2:132637918-132637940 GGGAAGGGAGAGGTGTGGGCTGG + Intronic
938833742 2:135078694-135078716 AGGAAAGGAGAGGGGAGGGGAGG - Intronic
938988917 2:136608013-136608035 GGGAATGGAGAGAAGTAGTCAGG + Intergenic
938995278 2:136671832-136671854 GGGCATGGAGAAGGGAGGGGGGG + Intergenic
939329730 2:140741626-140741648 GAGAATGGAGAGTGGTAGGACGG - Intronic
939362860 2:141196235-141196257 GAGAATGGAGAGGAGTGGAGTGG - Intronic
939715084 2:145573889-145573911 GGGAATGAAGAGTGGGTGGCCGG - Intergenic
939766137 2:146252174-146252196 GGGAAGGGGGAGGGGAGGGGAGG + Intergenic
939968711 2:148636868-148636890 GGGAGTGGGGAGGGGTGGGAGGG + Intergenic
940020879 2:149154671-149154693 GGGGATGGGGTGGGGTGGGGTGG + Intronic
940259573 2:151766011-151766033 GGGCGTGGAGAGCGATGGGCAGG - Intergenic
940754654 2:157668320-157668342 GTGAATGGAGTGGGGTGGGAAGG + Intergenic
940955248 2:159720021-159720043 GGGGCTGGAGGGGGGAGGGCGGG - Intronic
940977238 2:159959826-159959848 GGGAATGGGGATGGGTGAGGGGG - Intronic
941218821 2:162748856-162748878 GGGAAGGGGGAGGGGAGGGAAGG - Intronic
941928099 2:170915715-170915737 GTGGAGGGAGAGGCGTGGGCAGG - Intergenic
941995993 2:171602519-171602541 GAGAAGGAAGAGGGGAGGGCAGG - Intergenic
941998997 2:171627623-171627645 GGGAGTGGCGAGGGGTGTGTGGG - Intergenic
942388331 2:175465040-175465062 GGGAATGAATATGGGTGGCCAGG - Intergenic
943748384 2:191486102-191486124 GGAAATGGAGAGGAGTGGGAAGG - Intergenic
944442004 2:199752229-199752251 GGGAATGCTGTGGGGTGGGGAGG - Intergenic
944984212 2:205156252-205156274 GGGACTGTTGTGGGGTGGGCGGG + Intronic
945341353 2:208659818-208659840 GGGAATGGAGAGCTATGGGAGGG - Intronic
945444017 2:209914544-209914566 GGGGATGGGGAGAGGGGGGCGGG - Intronic
945655369 2:212616598-212616620 GGGAAGGGAGAGGGGAGGGGAGG - Intergenic
945655384 2:212616632-212616654 GGGAAGGGAGAGGGGAGGGGAGG - Intergenic
945741089 2:213662151-213662173 GGGAAAGGTGAGGGGTGAGGGGG + Intronic
946017081 2:216612587-216612609 GGGAATCCAGAGCTGTGGGCAGG - Intergenic
946199636 2:218064353-218064375 GGAGTTGGAGAGGAGTGGGCTGG - Intronic
946242938 2:218367904-218367926 GGGAGCGGAAAGGGTTGGGCCGG - Exonic
946331088 2:219009696-219009718 TGGGATGGAGTGGGGTGGGATGG + Intronic
946331107 2:219009746-219009768 TGGGATGGAGTGGGGTGGGATGG + Intronic
946380606 2:219346234-219346256 GGGAAAGGAGGGGAGGGGGCGGG - Intergenic
946409565 2:219509328-219509350 GGGGGTGGAAAGGGGTGGGTGGG + Intergenic
946412038 2:219520288-219520310 GGGAGAGGAGAGAGGAGGGCAGG - Intronic
946428841 2:219613945-219613967 GGGAAGGCAGGAGGGTGGGCAGG + Intronic
947006041 2:225512581-225512603 GGGAAAGGAAAGGGGAAGGCAGG - Intronic
947428656 2:230006665-230006687 GGGAATGAAGTGGGAGGGGCTGG + Intronic
947436580 2:230078264-230078286 GGGAATGGAGAAAGGTAGGGAGG - Intergenic
947470488 2:230397109-230397131 GGTAATGGATAGGGCTGGCCTGG + Intronic
947534599 2:230933052-230933074 GGGCAGGGAAAGGAGTGGGCTGG - Intronic
947745009 2:232502964-232502986 GGGAAGGCAGAGGCGGGGGCGGG + Intergenic
948012034 2:234656639-234656661 GGGAAGGGATGGGGGTGGCCAGG - Intergenic
948046227 2:234947526-234947548 AGGAGTGGAGAGGGGCGTGCTGG - Intergenic
948156635 2:235788575-235788597 GGGCAAGGAGAGGAGTGGGAGGG + Intronic
948255823 2:236567668-236567690 GGGAATGGGGCGGGGTGGGTCGG - Intergenic
948273106 2:236688799-236688821 GGGGGTGGGGAGGGGTGGGAAGG + Intergenic
948395990 2:237645449-237645471 GGGAACGGTGAGGGGTAGGAAGG - Intronic
948691296 2:239706797-239706819 GGGAAGGGAGAGAGGTAGGGAGG - Intergenic
948815563 2:240508541-240508563 GGGGATGGAGAGTGATGGGAAGG - Intronic
948855249 2:240727309-240727331 GGGAAGGGAGAGGGGAGGGCAGG + Intronic
948871945 2:240805091-240805113 GGGGAGGGAGAGGGGAGGGAGGG + Intronic
1168729412 20:64148-64170 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1168729476 20:64518-64540 TGGAATGGAGAGGAGTGGAGTGG - Intergenic
1168729480 20:64538-64560 TGGAATGGAGAGGAGTGGAGTGG - Intergenic
1168729583 20:65151-65173 GGGAATGGAGTGGAGTGGAATGG - Intergenic
1168729681 20:65750-65772 TGGAATGGAGAGGAGTGGTGTGG - Intergenic
1168729854 20:66870-66892 AGGAATGGAGTGGGGTGGAATGG - Intergenic
1168883304 20:1225766-1225788 GGGGATGGAGAGGGACGGGCAGG - Intergenic
1169082736 20:2807098-2807120 GGGAGTGCAGAGTGGTGGGAAGG - Intergenic
1169863331 20:10173924-10173946 GGGAATAGATTGGGGTGGGTAGG - Intergenic
1169929477 20:10816877-10816899 GGAAATTGGGAGGGGTGGGAGGG + Intergenic
1170227712 20:14010404-14010426 GGGAAGGTAGAGGGGGAGGCAGG + Intronic
1170269264 20:14506039-14506061 GGGAGTGTTGGGGGGTGGGCAGG + Intronic
1170343979 20:15362939-15362961 GGGAAAGGGGAGGGGAGGGGAGG + Intronic
1170596051 20:17806779-17806801 GGGAGTGGAGAGGAGTGAGCTGG - Intergenic
1170798336 20:19569623-19569645 GTGACAGGAGAGGGGAGGGCAGG + Intronic
1170855664 20:20052055-20052077 GGGAGTGGAGTGGGGTGGTTCGG - Intronic
1170906023 20:20515839-20515861 GGGAGTGGGGCGGGGGGGGCAGG + Intronic
1170993070 20:21323026-21323048 GTGAAGGGAGAGGAGAGGGCAGG + Intronic
1171139647 20:22729728-22729750 GGGTATGGAGAGCTGTGGGTGGG + Intergenic
1171249690 20:23638221-23638243 GGGAAGGGAGAGGAGAGGCCGGG - Intronic
1171249719 20:23638286-23638308 GGGAATGGATAGGGAAGGCCAGG - Intronic
1171266558 20:23776282-23776304 GGGCATGGAGTGGGGTGGGCTGG - Intergenic
1171488422 20:25500060-25500082 GGGAATAGGGAGAGGGGGGCAGG + Intronic
1171914979 20:31056016-31056038 GGGAATGGAATGGGATGGGATGG + Intergenic
1172016735 20:31879995-31880017 CGGAATGGGTAGGGGTGGGGCGG + Intronic
1172100509 20:32482274-32482296 GGGAATGGGGAGGAGGGGGTGGG + Intronic
1172444498 20:34986009-34986031 GCGGAGGGAGAGAGGTGGGCAGG - Intronic
1172608932 20:36234961-36234983 GGGAGTGGGGAGGGGTGGAGAGG + Intergenic
1172662051 20:36574471-36574493 GGGAAGGGAGGGGAGGGGGCTGG - Intronic
1172781006 20:37437118-37437140 GGGCAGGGAGAGGGGAGGGGTGG - Intergenic
1172845882 20:37929793-37929815 GGGAAGGGAGAGTGGAGGGAGGG + Intronic
1173247661 20:41347676-41347698 GGCACAGGAAAGGGGTGGGCGGG - Intronic
1173471185 20:43324829-43324851 GTGCATGGAGAGAGGAGGGCGGG - Intergenic
1173851355 20:46220396-46220418 GGGGGTGGGGAGGGGAGGGCAGG + Intronic
1173923114 20:46760645-46760667 AGGGATGGCGAGGGGTGGGGAGG + Intergenic
1174022408 20:47541417-47541439 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
1174332485 20:49831176-49831198 GGAAATGGAGACAGGTGGGCTGG - Intronic
1174465362 20:50712982-50713004 GGGAAGGGAGGGGGCAGGGCAGG + Intergenic
1174524938 20:51163247-51163269 GGGAAGGCACAGGGGTGGGGTGG + Intergenic
1174575936 20:51537222-51537244 GGGAGTGGAGAGGGGAGGTGGGG + Intronic
1174611129 20:51800217-51800239 GTGAATGGAGAGTGCTGGGCTGG - Intronic
1174803054 20:53581386-53581408 GGGAATAGAGAGGGGGAGACGGG + Intronic
1175380562 20:58559636-58559658 GGGAAGAGGGAGGGGTGGGCTGG + Intergenic
1175807475 20:61837901-61837923 GGGAAGGGAGATGGGAGGGGAGG - Intronic
1175895456 20:62333833-62333855 GGGAGTGGGGTGGGGTGGGGTGG + Intronic
1175920655 20:62449191-62449213 GGGAATGGACAGCTGTGAGCAGG + Intergenic
1175930319 20:62490726-62490748 GGTGAGGGTGAGGGGTGGGCAGG - Intergenic
1176025229 20:62982252-62982274 GGAAGTGGAGAGAGGTGGGGAGG - Intergenic
1176100530 20:63362396-63362418 GAGGGGGGAGAGGGGTGGGCAGG - Intronic
1176117672 20:63440125-63440147 GCCAGAGGAGAGGGGTGGGCAGG + Intronic
1176118924 20:63445502-63445524 GAGGCTGGAGAGGGGTGGGGGGG - Intronic
1176125542 20:63473004-63473026 GGGGAGGGGGAGGGGAGGGCAGG + Intergenic
1176176288 20:63727154-63727176 GTGAATGTAGTGGGGAGGGCAGG - Intronic
1176189346 20:63800557-63800579 GTGGAGGGAGAGGCGTGGGCGGG + Intronic
1176260504 20:64177270-64177292 GAGAAGGGAGAGGTGGGGGCAGG - Intronic
1176270401 20:64233184-64233206 GGGAAGGGAGAGGGGAGGAAAGG - Intronic
1176302036 21:5102992-5103014 GGGTAGGGGGAGGGGTGGGTGGG + Intergenic
1176321478 21:5329464-5329486 TGGAATGGAGTGGAGTGGGGTGG + Intergenic
1176321521 21:5329732-5329754 TGGAATGGAGAGGAGTGGAATGG + Intergenic
1176321529 21:5329762-5329784 TGGAATGGAGTGGGGTGGAGTGG + Intergenic
1176425788 21:6547537-6547559 GGGGATGGAGAGGAGAAGGCAGG - Intergenic
1176479141 21:7261282-7261304 TGGAATGGAGTGGAGTGGGGTGG + Intergenic
1176479184 21:7261550-7261572 TGGAATGGAGAGGAGTGGAATGG + Intergenic
1176479191 21:7261580-7261602 TGGAATGGAGTGGGGTGGAGTGG + Intergenic
1176528899 21:7942894-7942916 GGGAATGGAAAGGGGTGGAATGG - Intergenic
1176528977 21:7943478-7943500 TGGAGTGGAGAGGAGTGGACTGG - Intergenic
1176529211 21:7945175-7945197 GGGAATGGAGAGGAATGGAATGG - Intergenic
1176530232 21:7952469-7952491 GGGAATGGAAAGGGGTGAAATGG - Intergenic
1176530882 21:7957036-7957058 TGGAATGGAGTGGAGTGGGGTGG - Intergenic
1176598242 21:8767597-8767619 GGGACTGTTGTGGGGTGGGCAGG - Intergenic
1176636299 21:9247509-9247531 GGGAATGGAGTGGAGTGGAATGG + Intergenic
1176636406 21:9248120-9248142 TGGAATGGAGAGGAGTGGTGTGG + Intergenic
1176752466 21:10701797-10701819 GGGAATGGAGTGGAGTGGAATGG - Intergenic
1176752507 21:10702042-10702064 TGGAATGGAAAGGGGTGGAATGG - Intergenic
1176753249 21:10707125-10707147 GGGAATGGAGAGGAATGGAATGG - Intergenic
1176753796 21:10710798-10710820 TGGAATGCAGAGGAGTGGACTGG - Intergenic
1176754939 21:10718875-10718897 TGGAATGGAGTGGAGTGGGATGG - Intergenic
1176755217 21:10720883-10720905 TGGAGTGGAGTGGGGTGGGGTGG - Intergenic
1176756328 21:10728402-10728424 TGGAATGAAGAGGAGTGGACTGG - Intergenic
1176757468 21:10736202-10736224 GGGAATGCAGTGGGGTGGAATGG - Intergenic
1177318693 21:19493603-19493625 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
1178686902 21:34719003-34719025 GAGAATCAAGAGGTGTGGGCTGG - Intergenic
1178751274 21:35305753-35305775 AGGAAAGGAGAGGGGAGGGGAGG - Intronic
1178867848 21:36345226-36345248 AGGAAAGGAGAGGGCAGGGCAGG - Intronic
1178867850 21:36345231-36345253 GGGAAAGGAAAGGAGAGGGCAGG - Intronic
1179135806 21:38678894-38678916 GGGAATGGGGAGGAGAGGGGAGG + Intergenic
1179185512 21:39082838-39082860 GGGACGGGGGAGGGGTGGGGAGG - Intergenic
1179596017 21:42443727-42443749 GAGAATGGTGGGGGGCGGGCAGG - Intronic
1179626770 21:42653542-42653564 GGGGAGGGGGAGGGGCGGGCGGG + Intergenic
1179647570 21:42784848-42784870 GGGGATGGGGTAGGGTGGGCTGG - Intergenic
1179701279 21:43155854-43155876 GGGGATGGAGAGGAGAAGGCAGG - Intergenic
1179716886 21:43293031-43293053 GGGAATGGAGGAGGGAGGACAGG - Intergenic
1179716895 21:43293056-43293078 GGGAATGGAGGAGGGGGGACAGG - Intergenic
1179716930 21:43293156-43293178 GGGAATGGAGGAGGGGGGACAGG - Intergenic
1179854993 21:44158908-44158930 GGGTAGGGGGAGGGGTGGGTGGG - Intergenic
1179910184 21:44443332-44443354 GGAGCTGGAGAGGGGTGGGGTGG - Intergenic
1179966544 21:44810097-44810119 GGGAATGGAGAAATGTGGTCAGG + Intronic
1180530265 22:16344513-16344535 TGGAATGGAGAGGAATGGACCGG + Intergenic
1180958243 22:19750748-19750770 GGGAGAGGGGAGGGGTGGGAGGG - Intergenic
1180959331 22:19755534-19755556 GGGAGTGGAGAGGGGAGGAGAGG + Intergenic
1181509909 22:23384552-23384574 AGGACTGGAGTGGGGTGGGCCGG + Intergenic
1181692415 22:24571412-24571434 GGGGATGGAGACGGAGGGGCAGG - Intronic
1181876767 22:25945948-25945970 GGGAAGGGAGAGGGGAGGGGAGG - Intronic
1182146207 22:27998438-27998460 GGGGTTGGGGAGGGGAGGGCAGG - Intronic
1182354078 22:29714348-29714370 GGGAAGGGGCAGGGTTGGGCTGG + Intergenic
1182503302 22:30764268-30764290 GGCAGTAGAGTGGGGTGGGCGGG + Intronic
1182551409 22:31102758-31102780 GGGAAGGGAGTGGGGCGGGAGGG + Intronic
1182686173 22:32122806-32122828 GTGGGTGGAGGGGGGTGGGCTGG + Intergenic
1182977715 22:34639014-34639036 GGGGATGGGGAGGGATGGGGAGG - Intergenic
1182984610 22:34704727-34704749 GGGAAGAGAGAGGCTTGGGCTGG + Intergenic
1183247091 22:36702313-36702335 GTGAAAGGGGAGGGGTGGGGTGG + Intronic
1183404417 22:37623481-37623503 GGGCAGGGAGTGGGGTAGGCAGG - Intronic
1183502467 22:38189051-38189073 GGGGATGGAGAGGGATGGAGAGG + Intronic
1183502488 22:38189101-38189123 GGGGATGGAGAGGGATGGTGAGG + Intronic
1183502505 22:38189151-38189173 GGGGATGGAGAGGGATGGTGAGG + Intronic
1183502522 22:38189201-38189223 GGGGATGGAGAGGGATGGAGAGG + Intronic
1183512840 22:38245904-38245926 GGGGACGGAGTGGGGAGGGCTGG - Intronic
1183526469 22:38326092-38326114 GGGAATAGTGAGGGGTGGGTAGG - Intronic
1183564146 22:38601221-38601243 GGGTATGGAGAGTGGTAGGGAGG + Intronic
1183590600 22:38777330-38777352 GTGAACGGAGAGGCGGGGGCCGG - Intronic
1183604750 22:38861728-38861750 GGGAAAAGAGTGGGGTTGGCAGG - Exonic
1183744427 22:39684889-39684911 AGGAATGGAGGTGGGAGGGCGGG + Intronic
1183791769 22:40077098-40077120 GGGAGAGGAGAGGGGAGGGGAGG + Intronic
1184084948 22:42255745-42255767 TGGGAAGGAGAGGGGAGGGCCGG - Intronic
1184164622 22:42720322-42720344 GGGGATGGAGAGCGGCCGGCAGG - Intronic
1184769371 22:46588711-46588733 GGGGATGGAGAGGGCGGTGCTGG - Intronic
1184782116 22:46654723-46654745 GGGAAGGGAGAGTGGTTGGGAGG - Intronic
1184802417 22:46769641-46769663 GGGCATGGAGGGTGGTGAGCAGG + Intronic
1184929928 22:47673370-47673392 GGGAATGGAGAGGAGTGTTGGGG + Intergenic
1185032345 22:48450644-48450666 GGGAGGGGAGAGGGCTGGGTCGG + Intergenic
1185061936 22:48611704-48611726 TGGAAGGAAGAGGGGTGGGTAGG - Intronic
1185103129 22:48852304-48852326 GAGAATGGACAGTGGTGGCCTGG + Intergenic
1185133529 22:49055396-49055418 AGGACTGGAGCTGGGTGGGCTGG + Intergenic
1185147503 22:49147275-49147297 GGGAAGGGAGAGGTGGGGTCAGG - Intergenic
1185381289 22:50508459-50508481 GGGAGTGACGCGGGGTGGGCCGG + Intronic
1185414301 22:50701292-50701314 GGGAATGGAGAAGCGAGGTCAGG + Intergenic
1203291361 22_KI270735v1_random:42085-42107 GGGAATGGAGTGGAGTGGAGTGG - Intergenic
1203296621 22_KI270736v1_random:48216-48238 GGGAATGGAGTGGAGTGGAATGG + Intergenic
1203296684 22_KI270736v1_random:48531-48553 GGGAATGGAGTGGAGTGGAATGG + Intergenic
1203297327 22_KI270736v1_random:52436-52458 TGGAATGGAAAGGGGTGGAGTGG + Intergenic
1203297397 22_KI270736v1_random:52941-52963 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1203297821 22_KI270736v1_random:55570-55592 GGGAATGGAGTGGAGTGGAATGG + Intergenic
1203298183 22_KI270736v1_random:58591-58613 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1203298720 22_KI270736v1_random:62156-62178 TGGATTGGAGAGGGCTGGACTGG + Intergenic
1203299047 22_KI270736v1_random:64279-64301 GGGAATGGAGTGGAGTGGAATGG + Intergenic
1203299061 22_KI270736v1_random:64354-64376 TGGAATGGAGTGGGGTGGAGTGG + Intergenic
1203300510 22_KI270736v1_random:73801-73823 TGGAATGGAGAGGAGTGGAATGG + Intergenic
1203300700 22_KI270736v1_random:75044-75066 TGGAATGGAGTGGGGTGGAAAGG + Intergenic
1203300754 22_KI270736v1_random:75409-75431 TGGAATGGAGAGGAGTGGAATGG + Intergenic
1203300895 22_KI270736v1_random:76354-76376 TGGAATGGAGAGGAATGGACTGG + Intergenic
1203300906 22_KI270736v1_random:76409-76431 GGGAATGGAGTGGAGTGGAGTGG + Intergenic
1203301151 22_KI270736v1_random:77985-78007 TGGAATGGAGTGGAGTGGGAAGG + Intergenic
1203301652 22_KI270736v1_random:81397-81419 TGGAATGGAGATGAGTGGGGTGG + Intergenic
1203301826 22_KI270736v1_random:82475-82497 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1203302183 22_KI270736v1_random:84841-84863 TGGAATGGAGTGGGGTGGAGTGG + Intergenic
1203302272 22_KI270736v1_random:85456-85478 GGGAATGGAGACGAGTGGAGTGG + Intergenic
1203302294 22_KI270736v1_random:85561-85583 TGGAATGGAGTGGGGTGGGGTGG + Intergenic
1203302493 22_KI270736v1_random:86815-86837 TGGAATGGAGTGGGGTGGAATGG + Intergenic
1203303482 22_KI270736v1_random:93349-93371 TGGAATGGAGAGGAGTGGAAAGG + Intergenic
1203303517 22_KI270736v1_random:93559-93581 TGGAATGGAGTGGAGTGGGGTGG + Intergenic
1203304225 22_KI270736v1_random:97975-97997 TGGAATGGAGTGGGGTAGACGGG + Intergenic
1203304670 22_KI270736v1_random:100881-100903 TGGAATGGAGTGGGGTGGAGTGG + Intergenic
1203304748 22_KI270736v1_random:101344-101366 TGGAATGGAGTGGAGTGGGGTGG + Intergenic
1203305737 22_KI270736v1_random:107797-107819 TGGAATGGAGTGGAGTGGACTGG + Intergenic
1203305875 22_KI270736v1_random:108752-108774 TGGAATGGAGAGCAGTGGACTGG + Intergenic
1203306088 22_KI270736v1_random:110208-110230 TGGAATGGAGTGGGGTGGAATGG + Intergenic
1203308262 22_KI270736v1_random:124620-124642 GGGAATGGAATGGAGTGGGCTGG + Intergenic
1203311085 22_KI270736v1_random:143269-143291 TGGAATGGAGAGGAGTGGATTGG + Intergenic
1203311136 22_KI270736v1_random:143584-143606 TGGAATGGAGTGGAGTGGACTGG + Intergenic
1203311817 22_KI270736v1_random:148040-148062 AGGAATGGAGAGGAGTGGAGTGG + Intergenic
1203312599 22_KI270736v1_random:153231-153253 TGGAATGGAGTGGGGTGGAATGG + Intergenic
1203312611 22_KI270736v1_random:153301-153323 TGGAATGGAGAGGAGTGGAATGG + Intergenic
1203313362 22_KI270736v1_random:158234-158256 TGGAGTGGAAAGGGGTGGACGGG + Intergenic
1203313389 22_KI270736v1_random:158394-158416 AGGAATGGAGTGGAGTGGACTGG + Intergenic
1203313418 22_KI270736v1_random:158573-158595 TGGAATGGAGAGGAGTGGAATGG + Intergenic
1203313644 22_KI270736v1_random:163158-163180 TGGAATGGAGGGGAATGGGCTGG + Intergenic
1203313659 22_KI270736v1_random:163253-163275 TGGAATGGAGAGGAGTGGAGAGG + Intergenic
1203313934 22_KI270736v1_random:167126-167148 TGGAATGGAAAGGCGTGGACTGG + Intergenic
1203314161 22_KI270736v1_random:171471-171493 AGGAATGGAGAGGAGTGGAGTGG + Intergenic
1203314522 22_KI270736v1_random:173970-173992 GGGAATGGAGTGGAGTGGAGTGG + Intergenic
1203314946 22_KI270736v1_random:180315-180337 TGGAATGGAGTGGAGTGGACTGG + Intergenic
1203319383 22_KI270737v1_random:41298-41320 TGGAATGGAGAGGAATGGACCGG - Intergenic
949501464 3:4684091-4684113 GGGAAGGGATAGTAGTGGGCTGG - Intronic
950095304 3:10325636-10325658 GGCCATGGTGAGGGGTTGGCGGG + Exonic
950125127 3:10505929-10505951 GGGCACGGAGAGGGTAGGGCTGG + Intronic
950154783 3:10713381-10713403 GGGGATGGAGAGGAGTCTGCAGG + Intergenic
950204887 3:11071589-11071611 GTGGAGGGAGAGGCGTGGGCAGG - Intergenic
950390729 3:12694492-12694514 GTGCATGGTGCGGGGTGGGCTGG - Intergenic
950399816 3:12761201-12761223 GGGGATGGAGAGGGGAGAGGAGG + Intronic
950572480 3:13810008-13810030 GGGTTTGGGGTGGGGTGGGCGGG + Intergenic
950964783 3:17138693-17138715 GGGACTGCAGAGGCTTGGGCTGG + Intergenic
950969755 3:17174548-17174570 GGGAATGGTGAGGTGTGGAGTGG - Intronic
951909228 3:27731562-27731584 GGGCCTGAAGAGGGTTGGGCAGG + Intergenic
952316747 3:32238642-32238664 GGGCGGGGAGAGGGGCGGGCGGG - Intergenic
952383032 3:32818862-32818884 GAGGATGGAGAAGGGCGGGCCGG - Exonic
952713278 3:36453339-36453361 GTGGAGGGAGAGGCGTGGGCGGG + Intronic
952767904 3:36970890-36970912 GGGAGTGGAGATGGGAAGGCAGG - Intergenic
952867118 3:37861796-37861818 GGGAAAGAAGAAGGGCGGGCGGG - Intergenic
952965397 3:38617889-38617911 GGGAATGGAGTAGGGTTGCCAGG - Intronic
953191389 3:40691134-40691156 GGGAATGGGGAGGCATGGGGAGG - Intergenic
953540139 3:43810928-43810950 AGGAATGGGAAGGGATGGGCAGG - Intergenic
953885577 3:46712788-46712810 GGGAAGGGAAGGGGGTGGGCAGG - Intronic
953891854 3:46756743-46756765 GGGAGTGGACAGGGCGGGGCTGG - Intronic
953912516 3:46900096-46900118 CAGACTGCAGAGGGGTGGGCCGG + Intronic
954133024 3:48569694-48569716 GGGCATGGGGAGGGCAGGGCAGG - Intronic
954259488 3:49428424-49428446 AAGAATGGGGAGGGGTGGCCGGG + Intronic
954411873 3:50374372-50374394 GGGAGTGGAGGTGGGTGGGGAGG + Intronic
954413959 3:50383826-50383848 GGGAATGGGGAAGGGTGGTGAGG + Intronic
954619268 3:51986355-51986377 GGGAAAGGGGAGGGTGGGGCGGG + Intronic
954662874 3:52235324-52235346 GGTGATGGGGCGGGGTGGGCAGG + Intronic
955121515 3:56064299-56064321 GGGCATGGACAAGGGTGGCCAGG - Intronic
955467678 3:59253777-59253799 GGGAAGGGAAAGGGGAGGGGAGG - Intergenic
955758900 3:62257003-62257025 GGGAGTGGAATGGGGAGGGCAGG + Intronic
955937059 3:64112210-64112232 GGGAAAGGAGGGGTGTGGACAGG - Intronic
956154280 3:66278391-66278413 CAGAATGGAGAGGGATGGGCAGG - Intronic
956426220 3:69138546-69138568 GGGAGAGGATAGGGGTGGGAGGG - Intergenic
957307885 3:78481253-78481275 TGGAATGGCGAGGGGTGTGTGGG - Intergenic
957743761 3:84310361-84310383 GGGGAGGGAGAGGGGTGAACAGG - Intergenic
957940911 3:87002342-87002364 GGGACAGGAGAGGAGTGGACAGG + Intergenic
958471323 3:94524230-94524252 GGGACTGGAGAGGGAGGGGGTGG - Intergenic
958866127 3:99503623-99503645 GGGAATGGAGTGGAGTGATCGGG + Intergenic
958952860 3:100435268-100435290 GGCAGTGGAGAGGAGTGGTCAGG + Intronic
959890438 3:111549169-111549191 AGGAAAGGAGAGGGGAGGGGAGG - Intronic
960036071 3:113104447-113104469 GGCAATGGAGAGATGGGGGCGGG + Intergenic
960195282 3:114759307-114759329 GGGGATGGGGAGGGGTGTGGGGG + Intronic
960479504 3:118171391-118171413 GTGGAGGGAGAGGTGTGGGCAGG + Intergenic
960721228 3:120626317-120626339 GGGGATGGGGAGAGGTGGGAAGG - Intergenic
960852553 3:122071284-122071306 GGGGTTGGGGAGGGGTGGGAAGG - Intronic
960992916 3:123323506-123323528 GGGAAGGCAGAGAGGTGGCCAGG - Intronic
961067175 3:123885013-123885035 GGGAAAGGGGAGGGGGGGGAGGG + Intergenic
961115571 3:124326217-124326239 GGGCATGGGCAGGGGAGGGCTGG + Intronic
961132586 3:124482904-124482926 GGGGATGTAGAGGGGAGGGGAGG - Intronic
961136935 3:124520125-124520147 GGGAAGGCAGAGGAGGGGGCAGG + Intronic
961594598 3:128006578-128006600 TGGGATGGAGCTGGGTGGGCAGG + Intergenic
961668692 3:128510662-128510684 GGGAATGGTGAAGGGTGGGCAGG - Intergenic
961775117 3:129278937-129278959 GGGTATGGCGAGGGGAGGGGAGG + Intronic
961801328 3:129452397-129452419 GGGGATTGAGAGTGCTGGGCAGG + Intronic
962106597 3:132396416-132396438 GTGGAGGGAGAGGCGTGGGCAGG + Intergenic
962222208 3:133573632-133573654 GGGAAGGGAGTGGGGAGGGGAGG - Intergenic
962237375 3:133718084-133718106 GGGAAGGGAGAGTGGTGGGAAGG + Intergenic
962715911 3:138125923-138125945 AGAATTGGAGAGGGGTGGGGAGG + Intronic
962893440 3:139692907-139692929 GGGACTGGAGAGCTGTGGGATGG + Intergenic
962958951 3:140292196-140292218 AGGAATGGAGAGAGGTGAGAGGG - Intronic
963606697 3:147418984-147419006 GAGAAAGGACAGGGGTGGGATGG + Intronic
963908294 3:150792329-150792351 GGGAAAGCAGCGTGGTGGGCAGG + Intergenic
964002807 3:151796145-151796167 GGGAAAGGGGAGGGGAGGGGAGG + Intergenic
964129212 3:153268680-153268702 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
964198126 3:154088031-154088053 GTGGAGGGAGAGGTGTGGGCAGG + Intergenic
964265417 3:154889606-154889628 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
964630526 3:158804966-158804988 GGGGATGGAGAGGGTAGGGTAGG + Intronic
964642580 3:158925872-158925894 GAGAATGATGGGGGGTGGGCAGG + Intergenic
965520832 3:169666822-169666844 GGGAAAGGCGAGAGGTGGGGTGG - Intergenic
965604453 3:170484835-170484857 GGGGATGGGGCAGGGTGGGCTGG + Intronic
966179256 3:177172676-177172698 GGGAGGGGAGAGGGGAGGGGAGG + Intronic
966288386 3:178324816-178324838 GAGAATGAACAGGGGTGGGGAGG + Intergenic
966360734 3:179126870-179126892 GGGACTGTTGTGGGGTGGGCGGG - Intergenic
966372450 3:179263374-179263396 GGGGAGGGAGAGGCGCGGGCGGG - Intronic
966746893 3:183285605-183285627 GGGAATGGAGAGGTGAGTGAAGG - Intronic
966860540 3:184229218-184229240 GGGCAGGGGGTGGGGTGGGCTGG + Intronic
967054867 3:185823555-185823577 CGGAATGGAGAGGTGGGGGCCGG - Intronic
967904203 3:194487117-194487139 GGCAAAGGCGATGGGTGGGCGGG - Intronic
967943547 3:194784678-194784700 GGGAAGGGTGGGGGGTGGGCAGG - Intergenic
968036901 3:195555253-195555275 GGGAATGGAGAGGGGATGCACGG - Intergenic
968132806 3:196201883-196201905 GGGAATGGGGAGAGGGGGGTTGG - Intronic
968412834 4:404325-404347 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
968539432 4:1156224-1156246 GGGAGTGGCGAGGGGTTGGCTGG + Intergenic
968647809 4:1749022-1749044 GGGGAGGGAGAGCGGTGGGGAGG - Intergenic
968702283 4:2062747-2062769 GGCAATGGGGAGGGATGGGAGGG + Intronic
968940082 4:3633272-3633294 GGGAAGGGGGAGGGGAGGGGAGG - Intergenic
969048569 4:4356466-4356488 GGGGGTGGAGAGGGCTTGGCCGG - Intronic
969073645 4:4559615-4559637 GGGAAGGGAAGGGGTTGGGCAGG + Intergenic
969101930 4:4775819-4775841 GTGGAGGGAGAGGGGTGGGGAGG + Intergenic
969112358 4:4851969-4851991 GGGACTGGGGAGGGGAGGGGAGG - Intergenic
969288258 4:6221962-6221984 GGCGGGGGAGAGGGGTGGGCGGG - Intergenic
969495784 4:7525489-7525511 GGGAAGGTGGAGGGCTGGGCTGG - Intronic
969517239 4:7654585-7654607 GGGAGTGCGGAGTGGTGGGCCGG - Intronic
969672960 4:8599733-8599755 GGGACTGGAGAGGGATGGAGAGG - Intronic
969865315 4:10072694-10072716 GTGGATGGAGAGGGGAGGGGAGG - Intergenic
970497819 4:16645045-16645067 GGTAATGTAGAGAGTTGGGCAGG - Intronic
970560925 4:17281688-17281710 GGAAATGGAGAAGTATGGGCTGG + Intergenic
970634316 4:17990506-17990528 GGGAGTGGGGTGGGGTGGGAGGG + Intronic
970646982 4:18133650-18133672 GTGATTGGAAAGGGGAGGGCTGG + Intergenic
970955269 4:21803560-21803582 GGTAATGGTGGGGGTTGGGCAGG - Intronic
971031498 4:22642258-22642280 GAGCATGGAGAGGGATGGACTGG + Intergenic
971197996 4:24487476-24487498 GGGAATGGAGACGGTCTGGCTGG - Intergenic
971273079 4:25170091-25170113 GGGAGTGGAGAGGGGGAGGTGGG - Intronic
971727748 4:30335619-30335641 GGGAGTGGAGGGGGGAGGGGAGG + Intergenic
971852059 4:31996383-31996405 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
972127724 4:35790158-35790180 GGGAAGGGAGAAGGGAGGGAAGG + Intergenic
973048538 4:45567050-45567072 GTGGAGGGAGAGGTGTGGGCAGG + Intergenic
973190351 4:47378420-47378442 GTGGAGGGAGAGGTGTGGGCGGG - Intronic
973223187 4:47752180-47752202 GGGAATGGAGAGCTTTGGGAGGG - Intronic
973345217 4:49047661-49047683 GGGGCTGGAGAGGGTTGGGGTGG + Intronic
973536201 4:51884850-51884872 GGGAAGGGAGAGGAGGGGACAGG + Intronic
974089919 4:57300535-57300557 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
974207413 4:58724130-58724152 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
974739530 4:65987444-65987466 GGGAATGTTGTGGGGTGGGTGGG + Intergenic
974807597 4:66899825-66899847 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
975372849 4:73608033-73608055 GGGAGAGGAGAGGGGAGGGGAGG - Intronic
976744747 4:88391947-88391969 GGGAAAGGAGTGGGGAGGGGAGG - Intronic
976826156 4:89262808-89262830 GGGGATGGCGGAGGGTGGGCAGG - Intronic
976900139 4:90163843-90163865 GGGAATGAAGTGGGGTTGGGAGG + Intronic
977299662 4:95253676-95253698 GGGAATGAAGAGGGGGGCCCAGG + Intronic
977969888 4:103200954-103200976 GGCAATGGAGAGAGGTAGGCAGG + Intergenic
978285493 4:107073092-107073114 GTGGAGGGAGAGGTGTGGGCGGG + Intronic
978291784 4:107150543-107150565 GGGGATGGGGAGGGGAGGGGAGG + Intronic
978546564 4:109876994-109877016 AGGAAAGGAGAGGGGAGGGGAGG - Intergenic
978625395 4:110679704-110679726 GGGAATGGAGAGAGGAAGGGGGG - Intergenic
978665648 4:111178092-111178114 GGGAAGGGAGAGGGGAGGGGAGG - Intergenic
978809050 4:112830801-112830823 GTGGAGGGAGAGGCGTGGGCAGG + Intronic
978918012 4:114148923-114148945 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
979509415 4:121535276-121535298 AGGAATGGAGAGGTGTGGAGGGG + Intergenic
979521637 4:121674228-121674250 GGGGAGGGAGAGGGGAGGGGAGG + Intronic
979689652 4:123547148-123547170 GGGGCTGGAGGGGGGAGGGCGGG - Intergenic
979865181 4:125744986-125745008 GTGGAGGGAGAGGTGTGGGCGGG + Intergenic
979947433 4:126850630-126850652 TGGAAAGGAGAGGTGAGGGCAGG + Intergenic
980236312 4:130111587-130111609 TGAAATGGAGAGGTCTGGGCAGG - Intergenic
981136160 4:141213528-141213550 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
981624766 4:146742756-146742778 AGGAAAGGAGAGGGGAGGGGAGG - Intronic
982004897 4:151054107-151054129 GTGAGGGGAGAGGGGTGGGGAGG - Intergenic
982438339 4:155402871-155402893 GGGATTAGAGAGAGGTGTGCTGG + Intergenic
982441249 4:155438787-155438809 TGGAATAGAGAGGGGTGGGAAGG - Intergenic
982480992 4:155909890-155909912 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
982481004 4:155909912-155909934 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
983545721 4:168961898-168961920 AGGAAGGGAGAGGGGAGGGGAGG + Intronic
984241865 4:177227892-177227914 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
984266115 4:177499668-177499690 GTGGAGGGAGAGGCGTGGGCAGG + Intergenic
984352479 4:178613327-178613349 GGGAATGGAGAGGACTGTCCTGG + Intergenic
984479812 4:180285700-180285722 GGAGAGGGAGAAGGGTGGGCAGG - Intergenic
984630619 4:182056810-182056832 GAGAATGGAGGGAGGTGGGTGGG + Intergenic
984872699 4:184341136-184341158 GGAAAAGGAGAGATGTGGGCAGG + Intergenic
984886584 4:184455241-184455263 GGGAAGGGGGAGGGGAGGGGAGG - Intronic
985331891 4:188846274-188846296 GGGAAAGGACAGGGTTGGGGTGG - Intergenic
1202750459 4_GL000008v2_random:1216-1238 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1202750565 4_GL000008v2_random:1925-1947 GGGAGTGGAGTGGAGTGGACTGG + Intergenic
1202750875 4_GL000008v2_random:3977-3999 GGGAATGGAGTGGAGTGGAATGG + Intergenic
1202750984 4_GL000008v2_random:4602-4624 TGGAATGGAGAGGAGTGGTGTGG + Intergenic
1202751300 4_GL000008v2_random:6605-6627 TGGAATGGAGAGGAGTGGTGTGG + Intergenic
985478800 5:94443-94465 GAGAGTGAAGAGGGGTAGGCTGG + Intergenic
985478834 5:94556-94578 GAGAGTGAAGAGGGGTAGGCTGG + Intergenic
985484478 5:140783-140805 GGGAAGGGGGTGGGGTGTGCAGG - Intronic
985485508 5:146264-146286 GGGAAAGGAGGGAGGGGGGCAGG - Intronic
985653048 5:1115854-1115876 GGGAAAGGAAAGAGGTGGGAAGG + Intergenic
986008360 5:3687219-3687241 GAGAGAGGAGTGGGGTGGGCAGG + Intergenic
986299330 5:6466033-6466055 GGGAAGGAAGAGGGAGGGGCAGG - Intronic
986722505 5:10569761-10569783 GGGCTTGGCGATGGGTGGGCTGG + Intronic
986772579 5:10987622-10987644 GGGAATGGAAAGAGGAGGGCAGG - Intronic
986772586 5:10987644-10987666 GGGAGTGGGGAGGGGAGGGACGG - Intronic
986772598 5:10987671-10987693 GGGAATAGAGTGGGGAGGGGAGG - Intronic
986969611 5:13316514-13316536 AGGGATGGAGAGGGGTGAGGAGG + Intergenic
987373927 5:17217493-17217515 GGGAGGGGAGAGAGGCGGGCGGG + Intronic
987867723 5:23567799-23567821 GGGAGTAGAGAGGGGTGATCAGG - Intergenic
988186076 5:27863817-27863839 GTGAATGGCGAAAGGTGGGCTGG + Intergenic
988495547 5:31742534-31742556 GGGAATGGGGTGGGGAGGGGGGG - Intronic
989175529 5:38521621-38521643 TGGTATTGAGAGTGGTGGGCTGG + Intronic
989197697 5:38731780-38731802 GGGCAAGGAGAGGGCTGGGCAGG + Intergenic
989281333 5:39646941-39646963 GGGAGAGGAGAGTGGTAGGCAGG + Intergenic
990196154 5:53318675-53318697 GGGGAAGGAGAGAGGAGGGCAGG + Intergenic
990446228 5:55896669-55896691 GGGAGTGGAGAGGGGAGGGGAGG - Intronic
990805283 5:59653881-59653903 GGGAGAGGAGAAGGGTGGGAGGG + Intronic
991550604 5:67831806-67831828 AGGAATGGCGAGTGGGGGGCGGG + Intergenic
992312135 5:75511632-75511654 GGGAAAGGACAGGGGAGGGGAGG - Intronic
992578969 5:78151826-78151848 GGGAAGGGGGAGGGGAGGGAAGG - Intronic
993032571 5:82722160-82722182 TGGAATGGAGTGGGTTTGGCAGG - Intergenic
993201253 5:84818184-84818206 GGGAAGGGGGAGGGGAGGGGAGG - Intergenic
993204648 5:84863532-84863554 AGCAAGAGAGAGGGGTGGGCAGG - Intergenic
994239836 5:97407177-97407199 GTGGAGGGAGAGGTGTGGGCAGG + Intergenic
994829256 5:104757056-104757078 GAGAATGGAGGGGGGGGGGGGGG + Intergenic
994947904 5:106420092-106420114 GGGAATGGATAGGGGTGTGTGGG - Intergenic
995112408 5:108442404-108442426 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
995272138 5:110233249-110233271 GGGAATGGTGAGTGGTGGTTGGG + Intergenic
995701486 5:114939927-114939949 GGGAAGGGACAGGGGTGGAATGG + Intergenic
996110737 5:119563584-119563606 GGGAATGCATACGGGTGGGCAGG - Intronic
996221363 5:120936815-120936837 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
996339007 5:122415572-122415594 GGAAATGGAGAGAAGAGGGCAGG + Intronic
996461844 5:123753679-123753701 GGGAGAGGAGAGGGGAGGGGAGG - Intergenic
996714263 5:126574072-126574094 GGAATTGGAAAGTGGTGGGCTGG - Intronic
997131268 5:131278744-131278766 GGGAGAGGAGAGGGGAGGGGAGG - Intronic
997158232 5:131580400-131580422 GTGGAGGGAGAGGGGTGGGCAGG - Intronic
997264213 5:132485726-132485748 GGGAAAGCAGAGAGGTTGGCTGG + Intronic
997269906 5:132527719-132527741 GTGAATGGTGCAGGGTGGGCTGG - Intergenic
997285083 5:132672272-132672294 GGGGGTGGTGAGGGGGGGGCGGG + Intergenic
997400472 5:133598124-133598146 GGGAAAGGAGAGAAATGGGCAGG - Intronic
997656328 5:135557562-135557584 GGGAATGGAGGGGGCTGGGATGG - Intergenic
997949549 5:138231273-138231295 GGGAATTGGGAGGAGTGGGGTGG - Intergenic
998207121 5:140165876-140165898 GGGACTGAGCAGGGGTGGGCGGG + Intergenic
998385798 5:141756523-141756545 TGGCATGGAGAGGGGTGGATAGG - Intergenic
998740680 5:145197497-145197519 GGGAAAGGAGAGGGAAGGGGAGG + Intergenic
998838632 5:146229470-146229492 AAGTATGGGGAGGGGTGGGCAGG - Intronic
998892774 5:146764216-146764238 GAGTCTGGAGGGGGGTGGGCAGG + Intronic
998896373 5:146804443-146804465 GGGGATGGAGGGGAGAGGGCAGG - Intronic
998991574 5:147823198-147823220 GGGAAAGGAGAAGGAGGGGCAGG - Intergenic
999103456 5:149047678-149047700 AGGAGTGGAGAGGAGTGGGCAGG - Intronic
999188808 5:149731495-149731517 GGGCACGGAGAGGGGCGGCCGGG + Intronic
999348360 5:150844270-150844292 GAGAATGGAGTGGGGAGGTCTGG - Intergenic
999432658 5:151537431-151537453 AGGAAAGGAGAGGGGAGGGGAGG + Intronic
999450000 5:151670805-151670827 GGGAGTGGGGAGGGGTGAGGAGG + Intronic
1000075339 5:157779323-157779345 GGGAATGGAGGAGAGAGGGCTGG + Intergenic
1000406082 5:160889697-160889719 GGGAATGGAGAGACATGGGGAGG + Intergenic
1000851168 5:166341616-166341638 GGGAATTGAGAAGTGGGGGCCGG + Intergenic
1000905327 5:166959344-166959366 GAGAATGGAGATGGATGGGCAGG + Intergenic
1001648782 5:173301182-173301204 GGGAGGGGAGAGGGGAGGGGAGG - Intergenic
1001662900 5:173409874-173409896 GGGAATGCAGAGGTAGGGGCAGG - Intergenic
1001761211 5:174209942-174209964 GGGGGTGAAGAGGGGTGAGCTGG + Intronic
1001761218 5:174209963-174209985 GGGGGTGAAGAGGGGTGAGCTGG + Intronic
1001761225 5:174209984-174210006 GGGGGTGAAGAGGGGTGAGCTGG + Intronic
1001771696 5:174301804-174301826 GGGATGGGAGGGGGGTGGGTGGG - Intergenic
1001939352 5:175729599-175729621 AGGAGTGGGGAGCGGTGGGCGGG - Intergenic
1002082615 5:176746373-176746395 GGGAAGGGAAAGGCGGGGGCGGG + Intergenic
1002270319 5:178067446-178067468 GGGGAAAGAGATGGGTGGGCTGG + Intergenic
1002277585 5:178113815-178113837 GGGGGTGGGGAGGGGTGGGGCGG + Intronic
1002345017 5:178542694-178542716 AGGAAGGGGGAGGGGAGGGCTGG + Intronic
1002577290 5:180181476-180181498 TGGAGTGGAGTGGGGTGGGGTGG + Intronic
1002653667 5:180724188-180724210 GGGACAGGAGAGGGGAGGGCAGG - Intergenic
1002697590 5:181100944-181100966 AGGGGTGGGGAGGGGTGGGCAGG - Intergenic
1003020473 6:2505003-2505025 GGAGATGGGGAGGGGTGGGGAGG - Intergenic
1003273113 6:4624535-4624557 GGGAATGGAGAAGGGAGGAGAGG - Intergenic
1003640044 6:7868855-7868877 GGAGAGGGAGAGAGGTGGGCAGG - Intronic
1003860681 6:10319422-10319444 GGGGATGGAGGGATGTGGGCAGG + Intergenic
1003860789 6:10319784-10319806 GGGGATGGAGGGACGTGGGCGGG + Intergenic
1003956641 6:11171069-11171091 GTGGAGGGAGAGGGGCGGGCGGG + Intergenic
1004019887 6:11767909-11767931 GGGAATGGAGAGCCCTGGGGAGG - Intronic
1004047526 6:12040866-12040888 GGGAGTGAAGAGTGGTGGGGGGG + Intronic
1004113919 6:12749019-12749041 GGGAGTAGAGAGGGCTGGGCTGG + Intronic
1004179314 6:13367292-13367314 GGGAATTGTGAGGGGTGGAGAGG - Intronic
1004572650 6:16862904-16862926 GGGAAGGCAGAGAGGAGGGCTGG + Intergenic
1004617387 6:17303512-17303534 GGGAGGGGGGAGGGGAGGGCAGG + Intergenic
1004771372 6:18786162-18786184 GGGAGAGGAGAGGGGAGGGGAGG - Intergenic
1004861411 6:19807333-19807355 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
1005089510 6:22042237-22042259 AGGAAGGGAGGGGGGCGGGCAGG - Intergenic
1005283872 6:24303386-24303408 GGGAATGGAGGGGAGCAGGCTGG - Intronic
1005681196 6:28210229-28210251 AGGAATGGAGAGAGGTGGATGGG - Intergenic
1005795626 6:29358798-29358820 AGGAGTGGACAGGGGTGGACTGG + Intronic
1006108334 6:31729689-31729711 GAGAAGGGAGAGAGGTGGGTAGG + Exonic
1006184787 6:32175678-32175700 GGGAAAGGAGAGGGGCCGACTGG - Intronic
1006271219 6:32968806-32968828 GGGAAAGGCGGGGGGTGGGGGGG + Intronic
1006333033 6:33405658-33405680 GGAAATGGGGAGGAGTGGGCAGG + Intronic
1006419512 6:33924531-33924553 GGGAAGGGAGAGGAGGAGGCAGG - Intergenic
1006442621 6:34061677-34061699 GGAAATGGAGAGGGGAGGGAAGG + Intronic
1006560570 6:34908176-34908198 GGTAATGGAGTAGGGTGGTCTGG + Intronic
1006645581 6:35512323-35512345 GGGATTAGAGGGGGATGGGCGGG - Intronic
1006720943 6:36150599-36150621 AGGAAGGGAGAGGGGTGAGGGGG - Intergenic
1006750443 6:36373461-36373483 GGGACTGGAGAGTGCTGGGTGGG + Exonic
1006752697 6:36388325-36388347 GGAAAGGGTGATGGGTGGGCAGG - Intergenic
1006913463 6:37579206-37579228 GGGTCTGGAGAGGGGCAGGCTGG - Intergenic
1007109492 6:39304688-39304710 GTGAGTGGACAGGGCTGGGCTGG - Intronic
1007197282 6:40073716-40073738 GAGAATGGAGAGGCGGGGGGTGG + Intergenic
1007352003 6:41280853-41280875 GGGAAAGGGGAGGGTGGGGCAGG - Intronic
1007358064 6:41335262-41335284 GGGAAAGGAGAGGGGAGAGGAGG - Intergenic
1007369551 6:41417362-41417384 GGTCCTGGAGAGGGGTGGGATGG - Intergenic
1007520152 6:42445756-42445778 GTGCATGGAGAGGAGTGGGTGGG - Intronic
1007738699 6:43998093-43998115 GTGGAGGGAGAGGGGCGGGCGGG + Intergenic
1007778557 6:44237877-44237899 GGGACTGGAGAGGCGGGGGAGGG - Intergenic
1007835787 6:44672540-44672562 GGGATGGGGTAGGGGTGGGCTGG + Intergenic
1008070118 6:47091080-47091102 GGGAATGGTGAGGTGAAGGCCGG - Intergenic
1009593762 6:65708837-65708859 GGGAGTGGAGAGGAGTGGAGGGG - Intergenic
1011001042 6:82588842-82588864 GGGAAAGGGGAGGGGAGGGGAGG + Intergenic
1011228836 6:85137447-85137469 GAGGATGGAGAGGGGAGGGGAGG - Intergenic
1011445250 6:87432461-87432483 AGGAATGGAGAGGGGGAGGCAGG - Intronic
1011632344 6:89339560-89339582 GGGAGGGAAGAGGGGTGGGGAGG + Intronic
1011643451 6:89435320-89435342 GGCAATGGAGAGGGGTACTCAGG - Intronic
1011825766 6:91303494-91303516 GTGGAGGGAGAGGCGTGGGCAGG - Intergenic
1011857527 6:91713240-91713262 GGAAAAGGAGAGGGGAGGACTGG - Intergenic
1012039802 6:94189609-94189631 GGGGAAGGAGAGGGGAGGGGAGG + Intergenic
1012052610 6:94362552-94362574 GGGCCTGGAGGGGGGTGGGGAGG + Intergenic
1013449822 6:110269070-110269092 AGGAATGGAGAGGCTTGGGGTGG - Intronic
1013619132 6:111872388-111872410 GGGAAAGGGGAAGGGTGGGTGGG + Intronic
1015167661 6:130216235-130216257 GGACTTGGAGAGGGGTGGGGTGG + Intronic
1015543387 6:134338579-134338601 GAGAAGGGAGAGGAGAGGGCTGG + Intergenic
1016539619 6:145149941-145149963 GGGTAGGGAGAGGGGGGAGCTGG + Intergenic
1017043274 6:150324783-150324805 GGGAAAAAAGAGGTGTGGGCAGG + Intergenic
1017511969 6:155122423-155122445 GGGAATGGAGAATGGAAGGCAGG + Intronic
1017661977 6:156683868-156683890 AGGAAAGGGGAGGTGTGGGCAGG - Intergenic
1017854033 6:158333016-158333038 GGGAAGGTATAGGGGTGGTCTGG - Intronic
1018169806 6:161135946-161135968 GGCAGCTGAGAGGGGTGGGCAGG - Exonic
1018331621 6:162733876-162733898 GGGAAGGGAGATGGGAGTGCTGG - Intronic
1018433472 6:163741828-163741850 GGGAAGGCAGGGGTGTGGGCTGG - Intergenic
1018684911 6:166296823-166296845 GAGGTGGGAGAGGGGTGGGCAGG - Intergenic
1018812636 6:167308645-167308667 GGGAGTGCAGAGGAGTGGGGTGG + Intronic
1018813751 6:167316424-167316446 GGGTCTGGGGAGGGGTGGGGGGG - Intergenic
1018857176 6:167683099-167683121 TGGAATGGACAGAGGTGAGCAGG - Intergenic
1018871896 6:167790171-167790193 GTGGATGGTGAGGGGTGGGGTGG - Intronic
1018959941 6:168441105-168441127 GGGGAGGGAGAGAGGCGGGCGGG + Intergenic
1019086193 6:169480031-169480053 GTGGAGGGAGAGGCGTGGGCAGG + Intronic
1019304260 7:325412-325434 GTGGAAGGAGAAGGGTGGGCAGG - Intergenic
1019318329 7:401779-401801 GGGGGTGGGGAGGGGTGGGGAGG + Intergenic
1019343264 7:518336-518358 GGGGATGGGGATGGGGGGGCGGG + Intronic
1019383677 7:741434-741456 GGTAATGGGGTGGGGTGGGAGGG - Exonic
1019387874 7:768633-768655 GGGAAGGCAGATGGGTGGCCCGG + Intronic
1019405443 7:881340-881362 GGGGATGGGGTGGGGTGGGGTGG - Intronic
1019428844 7:989255-989277 GGGAATGGAGTGGGGTCTGCAGG - Exonic
1019514847 7:1435067-1435089 GGGGATGCTGAGGGCTGGGCTGG - Intronic
1019548988 7:1592936-1592958 GGGCGTGGAGAGGGGGCGGCTGG + Intergenic
1019562181 7:1664667-1664689 GGGCAGGGAGAGGGGAGGGGAGG - Intergenic
1019727830 7:2612678-2612700 GGGAAAGGTGAGCTGTGGGCGGG + Exonic
1020202828 7:6093622-6093644 AGGAAAGGAGAGGGGAGGGGTGG - Intergenic
1020429933 7:8108463-8108485 GGGAATGGAGGGAGGAGGACAGG - Intergenic
1020666311 7:11047918-11047940 GGGAAGGGAGAGGGAGGGGGAGG + Intronic
1021573838 7:22090327-22090349 GTGGAGGGAGAGGCGTGGGCAGG + Intergenic
1021586712 7:22216385-22216407 GGGAATGGAGAGGGGTGGGCTGG - Intronic
1022009009 7:26292506-26292528 AGGAATTGGGAGGGGTAGGCAGG + Intronic
1022761898 7:33364640-33364662 GGGAGTGGAGAGGAGGGGGAAGG - Intronic
1022878950 7:34565746-34565768 GGGAAGTGAGAGGGGTGGAGAGG + Intergenic
1023010076 7:35918303-35918325 GGGAATGTAGAGGGGTTGCCAGG - Intergenic
1023062709 7:36343516-36343538 GGGAGGGGAGAGGGGAGGGGAGG + Intronic
1023080720 7:36523796-36523818 GGGAATGGCAGGGGATGGGCTGG - Intronic
1023086700 7:36577391-36577413 GAGAAGGCAGAGGGGTGAGCTGG + Intronic
1023156467 7:37256778-37256800 GGGAAGGGAGAAGGGAGGGAGGG + Intronic
1023161541 7:37301555-37301577 AGGGCTGGAGAGGGGTGGGTGGG - Intronic
1023499232 7:40830352-40830374 GGGCATGGACAGGGGAGGGCAGG - Intronic
1023752405 7:43385217-43385239 GGGAGGGGAGAGGGGAGGGGTGG - Intronic
1023752422 7:43385251-43385273 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
1023752431 7:43385268-43385290 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
1023752440 7:43385285-43385307 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
1023871376 7:44264711-44264733 GGGAGGGGAGAGGGGAGGGAGGG - Intronic
1023911249 7:44558479-44558501 AGGAAAGGAGAGGGGAGGGGAGG - Intergenic
1024080519 7:45851790-45851812 GGGAATGTAAAGGGGTTGCCAGG + Intergenic
1024725468 7:52189380-52189402 GGGAAAGGAGAGGGGAGGGGAGG + Intergenic
1025123708 7:56328404-56328426 GGGAATGTAGACGGGTTGCCAGG - Intergenic
1025123939 7:56329887-56329909 GGGAATGTAAAGGGGTTGCCAGG - Intergenic
1025184586 7:56847631-56847653 GGGAATGGGCTGGGGTGGGATGG - Intergenic
1025268403 7:57486395-57486417 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1025268590 7:57488127-57488149 CGGAATGGAGTGGAGTGGACAGG + Intergenic
1025269108 7:57492400-57492422 TGGAATGGAGAGGAGTGGAGTGG + Intergenic
1025269633 7:57496987-57497009 TGGAATGGAATGGAGTGGGCTGG + Intergenic
1025687343 7:63729337-63729359 GGGAATGGGCTGGGGTGGGATGG + Intergenic
1025848229 7:65219125-65219147 GGGAATGTAGAGGGGTTTCCAGG - Intergenic
1025898464 7:65724991-65725013 GGGAATGTAGAGGGGTTGCCAGG - Intergenic
1026237033 7:68535466-68535488 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
1026319899 7:69259201-69259223 GAGTATGGAAAGGGGTGGGAGGG + Intergenic
1026545205 7:71316298-71316320 GAGAATGGAACAGGGTGGGCTGG + Intronic
1026643673 7:72149592-72149614 GGGAACGGTGAGGGGAGGGTGGG - Intronic
1026846270 7:73700634-73700656 GAGAAGGGAGAGAGGTGGGATGG + Intronic
1026930000 7:74218500-74218522 GGGAATGCAGAGATGAGGGCCGG - Intronic
1027141935 7:75663753-75663775 GGGAATGGAAGGGAGTGGGAGGG + Intronic
1027222075 7:76220569-76220591 GGCAATGGAGGTGGCTGGGCTGG - Intronic
1027222916 7:76225469-76225491 GGGAAAGGGGCGGGGGGGGCGGG - Intronic
1027261509 7:76468061-76468083 GGGAATGGAGAGAGGAGGGGAGG + Intronic
1027312890 7:76966170-76966192 CGGAATGGAGAGAGGAGGGGAGG + Intergenic
1027464945 7:78503617-78503639 GGGGAGGGAGAGGAGTGGGAGGG - Intronic
1027674433 7:81141742-81141764 GTGAAGGGAGAGGAGCGGGCGGG + Intergenic
1028039894 7:86038417-86038439 TGTAATGGAGGGTGGTGGGCAGG - Intergenic
1028264066 7:88701622-88701644 TGGAATGGTGAGGGGTTGGGAGG - Intergenic
1028316103 7:89404958-89404980 GGGAAGGGGGAGGGGAGGGACGG + Intergenic
1028454866 7:91027838-91027860 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
1028775334 7:94669732-94669754 GGGAATGGGGTGGGGTAGGGTGG + Intergenic
1028835106 7:95366030-95366052 GGGAGTGGGGTGGGGAGGGCAGG + Intronic
1029144480 7:98436104-98436126 GGGAATGTAGAGGGGTTGCCGGG - Intergenic
1029297536 7:99553318-99553340 AGGAATGGGGACGGGTGGGGAGG - Intronic
1029538146 7:101167615-101167637 GAGAAGGGAGAGGGGAGGGAGGG + Intergenic
1029699257 7:102235753-102235775 GGGACGGGGGTGGGGTGGGCTGG - Intronic
1029709814 7:102293402-102293424 GGGGATGGAGCGAGGAGGGCAGG - Intronic
1029992268 7:104973233-104973255 GGGAGAGGAGAGGGGAGGGGAGG + Intergenic
1030051959 7:105545994-105546016 GGGGATGGGGAAGGGGGGGCGGG + Intronic
1030088557 7:105837775-105837797 GTGAGTGGAGAAGGGTGGCCAGG - Intronic
1031513350 7:122674195-122674217 GTGAAGGGAGAGGTGCGGGCGGG - Intronic
1031693231 7:124816841-124816863 GGGCATGGAGTGGGATGGGTAGG + Intergenic
1032058271 7:128701375-128701397 GGGGAGGGAGAGGGGAGGGGAGG + Intergenic
1032490108 7:132318145-132318167 GGGACTGGAGCGGAGAGGGCAGG + Intronic
1033035150 7:137868484-137868506 TGGAATGGAGTGGGATGGGATGG - Intergenic
1033656741 7:143380552-143380574 GGGAATGGAGGTGGGAGGGCGGG - Intergenic
1033969793 7:147025367-147025389 GGGATAGGAGAGGGGAGGGGAGG + Intronic
1034065872 7:148136063-148136085 GGGAAGGGAGAGGGAGGGGGAGG + Intronic
1034272489 7:149810021-149810043 TGGAGTGGAGTGGAGTGGGCTGG + Intergenic
1034293196 7:149948519-149948541 TGGGATGGAGAGGGTGGGGCAGG - Intergenic
1034316623 7:150139123-150139145 GGGAGTGGGGTGGGGTGGGATGG - Intergenic
1034339355 7:150341785-150341807 GGGGAAGGAGGGGGGTGGGATGG - Intergenic
1034467927 7:151240649-151240671 GGGATGGGATTGGGGTGGGCTGG + Intronic
1034516616 7:151585864-151585886 GAGGAAGGAGACGGGTGGGCGGG + Intronic
1034534994 7:151720912-151720934 GGGAATGGAGGGGGATGGAGAGG + Intronic
1034534997 7:151720922-151720944 GGGGATGGAGAGGGATGGAGCGG + Intronic
1034692893 7:153028152-153028174 GGGGATGTGGAGGGGAGGGCTGG + Intergenic
1034790241 7:153961559-153961581 GGGAGTGGGGTGGGGTGGGATGG + Intronic
1034812878 7:154148360-154148382 TGGGATGGAGAGGGTGGGGCAGG + Intronic
1034987692 7:155527347-155527369 GGGAATGGAGCGGGGTCGGGAGG + Intronic
1034989450 7:155538801-155538823 GTGAGTTGAGTGGGGTGGGCAGG - Intergenic
1035166885 7:156996040-156996062 GGGAATGGAGGGGAGGGGGAGGG - Intronic
1035259474 7:157652552-157652574 GGGAAGGGGCAGGGGTGGGCAGG - Intronic
1035287251 7:157814375-157814397 GGGCAGGGAGAAGGGTGGGGAGG + Intronic
1035385348 7:158468642-158468664 TTGAATAGAGAGGGGTGCGCAGG + Intronic
1035404303 7:158587934-158587956 GGGAAGGGAGCCGGGCGGGCGGG - Intergenic
1035435874 7:158858871-158858893 GGGAGGGGAAAGGGGAGGGCAGG - Intronic
1035583017 8:752134-752156 GGGAAGGGAGAAGGGGGTGCAGG - Intergenic
1035683816 8:1508391-1508413 GGGGGTGGTGAGGGGTGGGGGGG - Intronic
1035718670 8:1773711-1773733 TGGAGTGGAGAGGTGTGTGCTGG + Intronic
1035948351 8:3990781-3990803 GAGGAAGGAGAGGGGAGGGCAGG + Intronic
1036130397 8:6104259-6104281 GGGAATGGAGAGGAGGGGAGAGG + Intergenic
1037004374 8:13759346-13759368 GGGGATGGGGAGGGGTGGGGAGG - Intergenic
1037473011 8:19229130-19229152 GGAACTGGAGAGGGTTGGGAAGG + Intergenic
1037490884 8:19396040-19396062 GGGACTGGACTGAGGTGGGCGGG - Exonic
1037654201 8:20868885-20868907 GGGAGTGGAGGGAGGTGGGAAGG - Intergenic
1037698867 8:21253704-21253726 GGAGATGGAGAGGAGAGGGCAGG - Intergenic
1037767413 8:21780664-21780686 TAGAGTGGAGAGGGGAGGGCAGG - Intronic
1037886622 8:22599300-22599322 GGGAAAGGAGAGGGAGGGGAGGG - Intronic
1037936342 8:22917416-22917438 TAGAATGGAAGGGGGTGGGCAGG - Intronic
1038042632 8:23737982-23738004 GGGAAGGGGAAGGGGTGGGGAGG - Intergenic
1038411397 8:27362268-27362290 GGAAGTGGAGAGGGGAGGACAGG - Intronic
1038473270 8:27843356-27843378 GGGGATGGCGGGGGGGGGGCGGG + Intergenic
1039167895 8:34706837-34706859 GGGAAAAGAGAGAGGTAGGCAGG - Intergenic
1039407597 8:37326611-37326633 AGGGAAGGAGAGGGGAGGGCAGG - Intergenic
1039764941 8:40618783-40618805 GAGCAAGGAGAGGGTTGGGCAGG - Intronic
1039904867 8:41779176-41779198 GGGATAGGAGAGGGATGGGTTGG - Intronic
1040026515 8:42786770-42786792 GTGGAGGGAGAGGTGTGGGCGGG + Intronic
1040355580 8:46614919-46614941 GGGGATGGAGAGAGTGGGGCTGG - Intergenic
1041422146 8:57679565-57679587 GAGAATGGAGAAGTGTGGGTGGG - Intergenic
1041588337 8:59547116-59547138 GTGGAAGGAGAGGCGTGGGCGGG + Intergenic
1042269000 8:66937099-66937121 GGGAGAGGAGAGGGGAGGGGAGG - Intergenic
1042655903 8:71096165-71096187 GTGAGTTGAGAGAGGTGGGCAGG + Intergenic
1043002115 8:74771959-74771981 GTGAAGGGAGAGGCGCGGGCGGG - Intronic
1043322666 8:79009396-79009418 GGGAAGGGAGAAGGGAGGGAGGG - Intergenic
1043431792 8:80202066-80202088 GGGAAGGGAAAGGGGAGGGGAGG + Intronic
1043431795 8:80202071-80202093 GGGAAAGGGGAGGGGAGGGGAGG + Intronic
1043670601 8:82880684-82880706 GTGGAGGGAGAGGCGTGGGCAGG + Intergenic
1043708514 8:83382464-83382486 GAGAAAGGAGAGGGGAGGGGAGG + Intergenic
1043708523 8:83382485-83382507 GGGAAAGGAGAGGGGAGGGGAGG + Intergenic
1043814213 8:84781697-84781719 GGGAATTGAGGGAGGTGGGCAGG + Intronic
1043857122 8:85276057-85276079 GTGGAGGGAGAGGCGTGGGCGGG + Intronic
1043985769 8:86693893-86693915 TGGAATGGAGAGGGGGGGAAGGG - Intronic
1044370345 8:91402903-91402925 GGGAATGGATGGGGGAGGGGAGG + Intergenic
1044441610 8:92230784-92230806 GTGGAGGGAGAGGGGCGGGCAGG + Intergenic
1044662043 8:94600943-94600965 AGGAAAGGAGAGGGGAGGGAAGG + Intergenic
1044666826 8:94640802-94640824 ATGAATGGAGAGGCGAGGGCAGG - Intergenic
1044819790 8:96148130-96148152 TGGAAAGGGTAGGGGTGGGCTGG - Intronic
1045451444 8:102330800-102330822 GGTAAGGGAGAGGGGAGTGCAGG + Intronic
1045828948 8:106434995-106435017 GTGAATGGGTAGGGGTGGGGAGG + Intronic
1046055251 8:109071187-109071209 GTGGAAGGAGAGGCGTGGGCGGG - Intergenic
1046828200 8:118715226-118715248 GGCAATGGAGAGTAGGGGGCTGG - Intergenic
1047214200 8:122863590-122863612 GGGAAAGGAGAGGGATGGGAGGG + Intronic
1047478558 8:125258720-125258742 GGTAATGGAGAGAGGTGGGGGGG + Intronic
1047492665 8:125387380-125387402 CTGAAAGGAGAGGGGAGGGCAGG + Intergenic
1047493379 8:125391895-125391917 GGGAAAGGAGAGGGACTGGCTGG - Intergenic
1047537682 8:125734479-125734501 GGGAAGGGAGAGGGCTGAGTAGG - Intergenic
1047620960 8:126607327-126607349 GGGAATGGAGAAGAGAGGACAGG + Intergenic
1047927254 8:129693748-129693770 GGGAATGGGGGTGGGTGGGGAGG - Intergenic
1048183128 8:132214546-132214568 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
1048334188 8:133490825-133490847 TGGACTGGAGAGGGGTGCACAGG + Intronic
1048345680 8:133572555-133572577 GGGAAGGGAGGAGCGTGGGCTGG + Intergenic
1048462986 8:134638401-134638423 GGGAATTAAGAGGGGTGAGCGGG + Intronic
1048574352 8:135679286-135679308 GGGCTTGGGGATGGGTGGGCAGG + Intergenic
1048574364 8:135679332-135679354 GGGCATGGGGAAGGGCGGGCAGG + Intergenic
1048757542 8:137755486-137755508 GTGGATGGAGAGGCGTGAGCGGG - Intergenic
1049090762 8:140511846-140511868 GGGAGCGGCGAGGGGTGGGCGGG - Intronic
1049094499 8:140540432-140540454 TGGCATGGCGAGGGGTGGGGAGG + Intronic
1049217785 8:141415711-141415733 GGGACTGGGGTGGGGTGGGGTGG + Intronic
1049240223 8:141533962-141533984 TGGACTGGATTGGGGTGGGCTGG + Intergenic
1049326740 8:142025461-142025483 GGAAGTAGAGAGGGCTGGGCAGG + Intergenic
1049353614 8:142177248-142177270 GGGAATGGGAAGGGGCAGGCCGG - Intergenic
1049444662 8:142624458-142624480 AGGAGTGGAGAGGGGAGGCCAGG + Intergenic
1049487521 8:142874293-142874315 GGGAGAGAAGAGGGGTGGCCTGG + Exonic
1049536662 8:143185794-143185816 GGGAGTGGACAGGGGAGGGCAGG - Intergenic
1049537443 8:143188905-143188927 GAGAATGGGTGGGGGTGGGCAGG + Intergenic
1049570837 8:143369586-143369608 GGCAAGTGGGAGGGGTGGGCAGG + Intronic
1049712377 8:144071199-144071221 GGGAGGGGAGAGGGGAGGGGAGG - Intergenic
1049732549 8:144185884-144185906 GGGGATGGTGAGGGGTGGCGGGG + Intronic
1049737726 8:144218735-144218757 GGGAAGCGAGAGGGGAGGGGAGG - Intronic
1049800296 8:144514557-144514579 GGGAAGGGCCAGGGCTGGGCTGG - Intronic
1049827189 8:144676735-144676757 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
1050309617 9:4339796-4339818 GGGAAGGGGGAGGGGAGGGGAGG + Intronic
1050884669 9:10749309-10749331 TGGAGTGGAGCGGGGAGGGCAGG - Intergenic
1050985459 9:12076621-12076643 GGGAGGGGAGAGGGGAGGGGAGG - Intergenic
1051192747 9:14532411-14532433 GGGAGGGGAGGGGGGTGGGAGGG + Intergenic
1051220458 9:14843286-14843308 GGGAGTGGAGAGGGGTGAGTGGG - Intronic
1051324016 9:15945030-15945052 GGGACTGTTGTGGGGTGGGCGGG - Intronic
1052851002 9:33378356-33378378 GGGAATGGCGAGGGTTGGGGAGG + Intergenic
1052951827 9:34219750-34219772 GGGAGGGGAGAGGGGAGGGGAGG - Intronic
1052994737 9:34545828-34545850 GGGATGGGACAGGGGTTGGCGGG - Intergenic
1053040586 9:34867399-34867421 GGTAATGGAGAGAGGTGGGGAGG + Intergenic
1053123419 9:35561932-35561954 TGGAAGGGAGAGAGGTGGGTGGG - Exonic
1053130689 9:35613551-35613573 AGCAATGGAGAGAGGTGGCCTGG - Intronic
1053233786 9:36434251-36434273 GGGAGGGGAGAGGGGAGGGGGGG + Intronic
1053275462 9:36780243-36780265 GGGGATGGAGAGGAGAGAGCTGG + Intergenic
1053293338 9:36896562-36896584 AGGGCTGGAGAGGGATGGGCTGG - Intronic
1053329219 9:37188615-37188637 GGGAAAGGAGGGGGAGGGGCGGG - Intronic
1053436060 9:38075372-38075394 GTGGAAGGAGAGGCGTGGGCGGG + Intergenic
1053455006 9:38227049-38227071 GCGAATGGAGCGGGGGGGGGGGG + Intergenic
1054450668 9:65402001-65402023 GGGAAGGGGGAGGGGAGGGGAGG + Intergenic
1055354741 9:75426349-75426371 GGGAAGGGAGAAGGGAGGGAGGG - Intergenic
1055378545 9:75679700-75679722 AGGAAAGGGGAGGGGAGGGCAGG + Intergenic
1055397881 9:75892569-75892591 GGGAAGGGAGAGGGAGGTGCTGG + Intronic
1055523453 9:77106042-77106064 GTGAAGGAAGAGGGGAGGGCTGG + Intergenic
1055584846 9:77748012-77748034 TGGCATAGAGAGGGGTGGTCAGG + Intronic
1055757380 9:79571268-79571290 GGGTTGGGAGACGGGTGGGCGGG + Intergenic
1055862908 9:80774990-80775012 GGGATTGGAGAGGGTTAGCCAGG - Intergenic
1056667305 9:88590876-88590898 AGAAATGGAGTGTGGTGGGCTGG + Intergenic
1056677277 9:88686283-88686305 GTGGAGGGAGAGGGGTGGGTGGG - Intergenic
1056764192 9:89434831-89434853 GGGAATGTAGAGGGGAGGCAGGG + Intronic
1056774006 9:89498257-89498279 GGGAAAGGAGGGAGGTGAGCAGG - Intergenic
1056829548 9:89904039-89904061 GGGATGGGATAGGTGTGGGCTGG + Intergenic
1056877541 9:90349301-90349323 GGGTGTGGGGAGGGGTGGCCAGG - Intergenic
1057013880 9:91633113-91633135 GGGAAGGGAGAGGGGAAGGGAGG + Intronic
1057141001 9:92726738-92726760 GGGAAGGCTGAGGGGTGTGCAGG + Intronic
1057171798 9:92967379-92967401 GGGAATGGAGAGGGTTTAACAGG - Intronic
1057297320 9:93856713-93856735 GGAAAGGGAGAGTGGTTGGCAGG - Intergenic
1057300670 9:93879936-93879958 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
1057436610 9:95045880-95045902 CGGAATGGAGAGTGGTGTTCGGG + Intronic
1057448665 9:95137373-95137395 GGGAAGGGAGAAGGGAGGGAGGG + Intronic
1057700373 9:97359812-97359834 GGGAGTGGGGAAGGCTGGGCTGG - Intronic
1057837169 9:98454772-98454794 CAGGATGGAGAGGGGTGGGAAGG - Intronic
1058005156 9:99906622-99906644 GGGCATCACGAGGGGTGGGCAGG - Exonic
1058379604 9:104363266-104363288 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
1058430937 9:104918716-104918738 GGGAATGGAGAAGGGTCTGCAGG + Intronic
1059107149 9:111521620-111521642 GGATATGGGGAGGGGTGGGCAGG + Intergenic
1059303076 9:113331154-113331176 GGGAGTGGATGGGGGTGGGGTGG + Intronic
1059400335 9:114065639-114065661 GGGAATGGTGAGGGTGGGGGTGG - Intronic
1059416811 9:114167622-114167644 GGGTAGGGGGTGGGGTGGGCTGG + Intronic
1059438920 9:114291864-114291886 GGGAGAGGAGAGGGGAAGGCAGG + Intronic
1059459158 9:114418784-114418806 GAGACTGGAGAGGGGTGGGGTGG - Intronic
1059676793 9:116547972-116547994 AGGAGTGGAGACAGGTGGGCAGG - Intronic
1060006712 9:120006657-120006679 GGGGTTGGAGAGGGGTTGGCAGG - Intergenic
1060015740 9:120084817-120084839 GGGCATGGAGAGAGTTGGGGGGG - Intergenic
1060716000 9:125929403-125929425 GGAACTGGACAGGGGTGGGTGGG + Intronic
1060840553 9:126789864-126789886 GGGCAGGAAGATGGGTGGGCTGG + Intergenic
1060869848 9:127030763-127030785 GAGAAGGCAGAGGGGTGGGATGG + Intronic
1061059964 9:128245267-128245289 GGGGGCAGAGAGGGGTGGGCGGG + Intronic
1061060137 9:128246148-128246170 GGGGCTGGTGAGGGGTGGGGAGG - Intronic
1061098363 9:128473181-128473203 GGGAAGTGAGAGTGGTGGGTGGG - Intronic
1061134075 9:128723461-128723483 GGAAATGGAGGTGGGTGGGTGGG + Intronic
1061391537 9:130319706-130319728 GGGGCTGGTGGGGGGTGGGCAGG + Intronic
1061449210 9:130659615-130659637 GGGAGGGGACAGGGGTGGGGTGG + Intergenic
1061821707 9:133231610-133231632 GGAAGTGGAAAGGGGTGGGCAGG + Intergenic
1061833155 9:133309338-133309360 GGAACTGGAACGGGGTGGGCAGG - Intergenic
1061946304 9:133910109-133910131 GGCAATAGAGAGGGCTGGGGTGG - Intronic
1062076709 9:134593656-134593678 GGGAAGAGAGAGAGGAGGGCAGG - Intergenic
1062234957 9:135503342-135503364 AGGCATGCAGAGGGGTGGCCTGG + Intronic
1062237547 9:135518487-135518509 GGAAGTGGAAAGGGGTGGGCAGG - Intergenic
1062321044 9:135990732-135990754 GGGCGTGGAGAGGGGAGGGCTGG - Intergenic
1062384114 9:136302340-136302362 TGGAAGGGTGAGGGGTGGGAGGG - Intronic
1062484003 9:136765130-136765152 GGGACCGGACAGGGCTGGGCTGG + Intronic
1062532858 9:137009339-137009361 GGGCAGGGCCAGGGGTGGGCTGG - Intronic
1062736454 9:138140239-138140261 GGCAGTGGAGAGGGGAGGGGAGG - Intergenic
1203772806 EBV:58088-58110 GGGGATGAAGAGGGGAGGGCTGG + Intergenic
1203782064 EBV:106137-106159 GGGACGGGAGAGGGGTCGTCGGG + Intergenic
1203786948 EBV:133466-133488 GGGGATGGGGAGGGCGGGGCTGG - Intergenic
1203385416 Un_KI270438v1:46429-46451 TGGAATGGAGTGGGGTGGATTGG + Intergenic
1203385544 Un_KI270438v1:47215-47237 TGGAATGGAGTGGAGTGGGGTGG + Intergenic
1203387741 Un_KI270438v1:70497-70519 GGGAATGGAGAGGAATGGAATGG + Intergenic
1203387977 Un_KI270438v1:72194-72216 TGGAGTGGAGAGGAGTGGACTGG + Intergenic
1203388051 Un_KI270438v1:72783-72805 GGGAATGGAAAGGGGTGGAATGG + Intergenic
1203342358 Un_KI270442v1:1692-1714 TGGAATGGAGAGGAATGGACTGG + Intergenic
1203344763 Un_KI270442v1:25885-25907 CGGAATGGAGTGGAGTGGGATGG + Intergenic
1203345373 Un_KI270442v1:30410-30432 TGGAATGGAAAGGGGTGGATTGG + Intergenic
1203349057 Un_KI270442v1:60830-60852 TGGAATGGAAAGGGGTGGAATGG + Intergenic
1203349545 Un_KI270442v1:68538-68560 TGGAATGGAGTGGAGTGGACTGG + Intergenic
1203349630 Un_KI270442v1:69185-69207 TGGAATGGAATGGGGTGGGATGG + Intergenic
1203351122 Un_KI270442v1:82218-82240 TGGAATGGAGAGGAGTGGAATGG + Intergenic
1203362013 Un_KI270442v1:223988-224010 GGGGGGGGAGGGGGGTGGGCAGG + Intergenic
1203395327 Un_KI270512v1:22260-22282 TGGAATGGAGTGGAGTGGACAGG + Intergenic
1203403423 Un_KI270519v1:137784-137806 GGGAATGGAGTGGAGTGGAGTGG + Intergenic
1203653278 Un_KI270751v1:150129-150151 TGGAATGGAGTGGGGTGGAGTGG - Intergenic
1203673290 Un_KI270756v1:469-491 TGGAATGGAGAGGAGTGGAGTGG - Intergenic
1203673311 Un_KI270756v1:594-616 TGGAATGGAGAGGAGTGGAGTGG - Intergenic
1185459794 X:328798-328820 GGGCAGGGAGAGGGGAGGGCAGG - Intergenic
1185511427 X:667798-667820 GGGAGGGGAGTGGGGAGGGCAGG - Intergenic
1185511567 X:668093-668115 GGGAAAGGAGAGGGGAGGGGAGG - Intergenic
1185581265 X:1213030-1213052 GGGAGGGGAGAGGGGAGGGGAGG - Intergenic
1185581384 X:1213265-1213287 GGGAAGGGGGAGGGGAGGGAAGG - Intergenic
1185598851 X:1325373-1325395 AGGAAAGGAGAGGGGAGGGGAGG + Intergenic
1185640505 X:1587835-1587857 GGGAAGGGGGAGGGGAGGGGAGG - Intergenic
1185779084 X:2829664-2829686 GGGAGTGGAGAGGGGTGACCGGG + Intronic
1186507436 X:10104192-10104214 GGGTGTGGAGTGGGGTGGGTGGG + Intronic
1187269214 X:17764872-17764894 GGGACTGGAGAGGGGTAGAGTGG - Intergenic
1187333727 X:18363847-18363869 GAGAATAGAGAGAGGTGTGCAGG - Intergenic
1187873493 X:23783568-23783590 GGGAACGGAATGGGGCGGGCGGG - Intronic
1188051351 X:25490966-25490988 GAGAATGGAGATGGTGGGGCTGG - Intergenic
1188619238 X:32199532-32199554 GGGAAGGGGGAGGGGTGTGAAGG + Intronic
1188976687 X:36683813-36683835 GGGAATGGGGAATGGTAGGCAGG + Intergenic
1189104028 X:38219169-38219191 GAGAAAGGAGAGGGGAGGGCAGG + Intronic
1189214514 X:39311636-39311658 GGGGATGGAGAGAAGTGGGGAGG - Intergenic
1189396182 X:40624830-40624852 GGGAAACGAGAAGGGTGGGGTGG + Intergenic
1189398920 X:40647248-40647270 GGGGATGAGGAGGGGTGGGGTGG + Intronic
1189511424 X:41665885-41665907 GGGAAAGGAGAGGAGGGGGCAGG + Intronic
1189555808 X:42144138-42144160 GGGAATGGAAAGGGAGGGGCTGG + Intergenic
1189743099 X:44141984-44142006 GGGGATAGAGAGAGGAGGGCAGG + Intergenic
1189843900 X:45114173-45114195 GAGAGGGGAGAGGGTTGGGCAGG + Intergenic
1190066670 X:47246087-47246109 GGGGATGGAGAGGGATGGTGGGG - Intronic
1190407249 X:50100442-50100464 GGGAACTGTGAGGGGTAGGCAGG + Intergenic
1190417971 X:50199796-50199818 GGGAATGGAAAGGGGAGGGAGGG - Intronic
1190440306 X:50469861-50469883 GGGAATGGGAAGGGGTTGGGAGG - Intronic
1190808494 X:53861739-53861761 GGGATGGGAGAGGGGTGGTGTGG + Intergenic
1190860050 X:54336323-54336345 GGGGATGGGGAGGGTGGGGCAGG - Intronic
1190868109 X:54401603-54401625 GGGAAGGGAGGGGGGTTGGGAGG - Intergenic
1190928310 X:54927843-54927865 GGCAATGCACAGGGATGGGCAGG + Intronic
1190931312 X:54951370-54951392 TGGAAGGGAGTGGGGAGGGCAGG + Intronic
1191126808 X:56964711-56964733 GGAAATGGAGAGAGGTGGATTGG + Intergenic
1191255500 X:58277907-58277929 GGGGATGGAGACAGGTGGCCAGG - Intergenic
1191256455 X:58281629-58281651 GGGAATGGAGACAGGAGGCCAGG - Intergenic
1191761864 X:64655211-64655233 GGGAATTGAGAGTGGTGGTTTGG - Intergenic
1191842738 X:65524746-65524768 TGGAATGGGGTGGGGTGGGATGG - Intronic
1191851515 X:65589200-65589222 GGGACTGGGGTGGGGTGGGGTGG - Intronic
1191902853 X:66056676-66056698 GGAGAAGGAGAGGGGTGGTCAGG + Intergenic
1192163195 X:68803986-68804008 GAGAATGGAGAGGAGGGGGTGGG + Intergenic
1192210911 X:69127167-69127189 GGCAGTGGAGAGGGGAGGGAGGG - Intergenic
1192233365 X:69280898-69280920 CAGAATGGAGGGGTGTGGGCTGG - Intergenic
1192546391 X:72018325-72018347 GGGAACGGTGAGGCGAGGGCCGG - Intergenic
1193084969 X:77440819-77440841 GGTAAGGGAGAGGGGTGGATGGG - Intergenic
1193703982 X:84798056-84798078 GGGAAAGGAGAGGGGAAGGGAGG - Intergenic
1193807270 X:86010176-86010198 GGGCCTGTAGAGGGGTGGGGGGG + Intronic
1193951745 X:87808788-87808810 GGACGTGGAGAGGGGAGGGCCGG + Intergenic
1194113945 X:89873170-89873192 TGTGATGAAGAGGGGTGGGCTGG + Intergenic
1194185093 X:90765657-90765679 GGGGAGGGAGAGGCGTGGGCAGG + Intergenic
1194348528 X:92796052-92796074 GGGAGGGGAGAGGGGAGGGGGGG + Intergenic
1194556841 X:95370076-95370098 GGGAATGTTGTGGGGTGGGGGGG - Intergenic
1194684277 X:96893312-96893334 TGGAGTGGAGAGGGGTCGGGGGG + Intronic
1195319483 X:103710059-103710081 GAGGATGAAGAGAGGTGGGCAGG + Intronic
1195464701 X:105167622-105167644 GGGTATGTGGGGGGGTGGGCGGG - Intronic
1196237443 X:113299776-113299798 GGGAGGGGAGAGGGGAGGGGAGG - Intergenic
1196288856 X:113915420-113915442 TTCAATGGAGAGGGGAGGGCAGG - Intergenic
1196683802 X:118494817-118494839 GGAAATGGAGAGGTGAGTGCAGG + Intergenic
1198276147 X:135097737-135097759 GGGAATGGAAGGTAGTGGGCTGG - Intergenic
1198479049 X:137023723-137023745 AGGGATGGAGAGGGGTCAGCAGG - Intergenic
1198989961 X:142501371-142501393 GGGACTGTTGTGGGGTGGGCGGG - Intergenic
1199097218 X:143757570-143757592 GTGAAGAGAGAGGCGTGGGCGGG - Intergenic
1199556463 X:149114267-149114289 GTGGAGGGAGAGGCGTGGGCGGG - Intergenic
1200106180 X:153714171-153714193 GGTATGGGGGAGGGGTGGGCTGG - Intronic
1200136248 X:153876079-153876101 GCGGATGGGGAGGGGAGGGCTGG - Intronic
1200398692 X:156006328-156006350 GGCAGTGGAGAGGGGAGGGGAGG - Intronic
1200466684 Y:3528526-3528548 TGTGATGAAGAGGGGTGGGCTGG + Intergenic
1200531717 Y:4347768-4347790 GGGGAGGGAGAGGCGTGGGCAGG + Intergenic
1200828096 Y:7663677-7663699 GGGGATGGAGTGGGGAGGGATGG + Intergenic
1200842438 Y:7796460-7796482 AGGAAAGGAGAGGGGAGGGGAGG - Intergenic
1201000386 Y:9466828-9466850 GGGAAGGCAGGGGGGTGGGGGGG + Intergenic
1201096890 Y:10628296-10628318 TGGAATGGAGAGGAATGGGATGG - Intergenic
1201096978 Y:10628875-10628897 GGGAATGGAGTGGAGTGGAGTGG - Intergenic
1201097343 Y:10631441-10631463 AGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201097355 Y:10631496-10631518 AGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201097711 Y:10646470-10646492 TGGAATGGAGAGGAATGGGATGG - Intergenic
1201097828 Y:10647317-10647339 GGGAATGGAGTGGAGTGGAGTGG - Intergenic
1201098196 Y:10649873-10649895 AGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201098208 Y:10649928-10649950 AGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201099518 Y:10660884-10660906 TGGAATGGAATGGAGTGGGCTGG - Intergenic
1201099727 Y:10662330-10662352 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201099789 Y:10662830-10662852 AGGAATGGAGTGGGATGGGATGG - Intergenic
1201100292 Y:10666547-10666569 GGGAGTGGAGAGGAGTTGACTGG - Intergenic
1201100371 Y:10667073-10667095 TGGAATGGAGAGGAGTGGACTGG - Intergenic
1201101355 Y:10677747-10677769 TGGAATGGAGTGGAGTGGGTTGG - Intergenic
1201101974 Y:10684911-10684933 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1201102184 Y:10686371-10686393 TGGAATGGAGGGGGGTGGAATGG - Intergenic
1201102807 Y:10691002-10691024 GGGAGTGGAGAGGAGTTGACTGG - Intergenic
1201102982 Y:10692506-10692528 TGGAATGGAGAGGAGTGGAGTGG - Intergenic
1201103465 Y:10746037-10746059 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1201104671 Y:10754669-10754691 GGGAATGGAGATGAGTGGAGTGG - Intergenic
1201104711 Y:10754921-10754943 TGGAATGGAGAGGAGTGGAGTGG - Intergenic
1201104964 Y:10756708-10756730 GGGAATGGAGTGGAGTGGAGTGG - Intergenic
1201105116 Y:10757604-10757626 GGGAATGGAGTAGAGTGGGGTGG - Intergenic
1201105644 Y:10761432-10761454 TGGAATGGAGTGGAGTGGGATGG - Intergenic
1201105678 Y:10761652-10761674 GGGAATGGAGTGGAGTGGAATGG - Intergenic
1201106005 Y:10763775-10763797 TGGAATGGAGTGGAGTGGGATGG - Intergenic
1201107406 Y:10773409-10773431 TGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201107634 Y:10775130-10775152 TGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201108990 Y:10785137-10785159 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1201111665 Y:10803855-10803877 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201111805 Y:10804889-10804911 TGGAATGGAGTGGAGTGGACCGG - Intergenic
1201112216 Y:10807809-10807831 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1201112490 Y:10810515-10810537 TGGAATGGAGAAGAGTGGGGTGG - Intergenic
1201113569 Y:10818850-10818872 GGGAATGGAGACGAGTGGAATGG - Intergenic
1201113685 Y:10819545-10819567 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201113690 Y:10819575-10819597 TGGAGTGGAGAGGGGTGGGGTGG - Intergenic
1201113754 Y:10820019-10820041 TGGAGTGGAGAGGGGTGTGGTGG - Intergenic
1201113867 Y:10820823-10820845 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201114063 Y:10822165-10822187 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201114332 Y:10823961-10823983 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201114612 Y:10825980-10826002 GGGAATGGAGTGGAGTGGAGTGG - Intergenic
1201115145 Y:10829666-10829688 TGGAATGGAGAGGAGTGGAAAGG - Intergenic
1201115403 Y:10831620-10831642 GGGAGTGGAGAGGAGTGGAGTGG - Intergenic
1201115467 Y:10832105-10832127 TGGAATGGAGAGGAGTGGAGTGG - Intergenic
1201115599 Y:10833032-10833054 TGGAATGGAAAGGGGTGGAGTGG - Intergenic
1201115924 Y:10835350-10835372 GGGAATGGAGTGGAGTGGAGTGG - Intergenic
1201117012 Y:10842589-10842611 GGGAATGGAGTGGAGTGGATTGG - Intergenic
1201117236 Y:10844082-10844104 GGGAATGGACAGGAGTGGAATGG - Intergenic
1201117332 Y:10844742-10844764 GGGAATGGAGTGGAGTGGAATGG - Intergenic
1201117735 Y:10847506-10847528 TGGAATGGAGAGGAGTGGAGTGG - Intergenic
1201117987 Y:10849150-10849172 GGGAATGGAGAGCAGTGGAGTGG - Intergenic
1201118066 Y:10849849-10849871 GGGAATGGAAAGGAGTGGAATGG - Intergenic
1201118092 Y:10850029-10850051 TGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201118331 Y:10851772-10851794 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1201120050 Y:10866026-10866048 GGGAATGGAGTGGAGTGGAATGG - Intergenic
1201120333 Y:10868058-10868080 GGGAATGGAGTGGAGTGGAGGGG - Intergenic
1201123627 Y:10893442-10893464 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201123779 Y:10894380-10894402 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201123958 Y:10895618-10895640 AGGAATGGAGAGGAGTGGAGTGG - Intergenic
1201124129 Y:10898487-10898509 GGGAATGGAGTGGAGTGGAGTGG - Intergenic
1201124240 Y:10899228-10899250 GGGAATGGAGTGGAGTGGAATGG - Intergenic
1201124312 Y:10899628-10899650 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201126780 Y:10922102-10922124 TGGAATGGAGTGGAGTGGACAGG - Intergenic
1201126905 Y:10923915-10923937 TGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201127964 Y:10931210-10931232 TGGAATGGAGAGGAGTGGAGTGG - Intergenic
1201128507 Y:10935037-10935059 TGGAATGGAGTGGGGTGGAATGG - Intergenic
1201128908 Y:10937914-10937936 AGGAATGGAGTGGGGTGGAGTGG - Intergenic
1201129904 Y:10944691-10944713 TGGAATGGAGAGGAGTGGAGTGG - Intergenic
1201129909 Y:10944721-10944743 AGGAATGGAGAGGAGTGGAGTGG - Intergenic
1201130192 Y:10946558-10946580 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201130611 Y:10949192-10949214 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1201131250 Y:10953581-10953603 TGGAATGGAGAGGAGTGGAAAGG - Intergenic
1201131309 Y:10953955-10953977 GGGAGTGGAGAGGAGTGGAATGG - Intergenic
1201131461 Y:10954930-10954952 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1201131523 Y:10955335-10955357 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201131881 Y:10958770-10958792 TGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201132117 Y:10960336-10960358 TGGAGTGGAGTGGGGTGGACTGG - Intergenic
1201132200 Y:10961050-10961072 TGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201132220 Y:10961150-10961172 TGGAATGGAGAGGAGTGGACTGG - Intergenic
1201132252 Y:10961330-10961352 GGGAATGCAGAGGAGTGGACTGG - Intergenic
1201132409 Y:10963167-10963189 TGGAATGGAGTGGAGTGGGGAGG - Intergenic
1201133220 Y:10971114-10971136 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1201133379 Y:10972233-10972255 TGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201133385 Y:10972253-10972275 TGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201133735 Y:10974747-10974769 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201133767 Y:10974921-10974943 TGGAATGGAGTGGAGTGGGATGG - Intergenic
1201134178 Y:10977875-10977897 TGGAATGGAGAGGAGTGGACTGG - Intergenic
1201134472 Y:10980124-10980146 TGGAATGGAGAGGAGTGGGGTGG - Intergenic
1201134502 Y:10980264-10980286 AGGAATGGAGAGGAGTGGAATGG - Intergenic
1201134841 Y:10982760-10982782 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201135468 Y:10986961-10986983 TGGAATGGAGAGGAGTGGATTGG - Intergenic
1201135527 Y:10987408-10987430 GGGAATGGAGTGGAGTGGAGTGG - Intergenic
1201135616 Y:10987963-10987985 TGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201135790 Y:10989176-10989198 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201135818 Y:10989370-10989392 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1201135844 Y:10989508-10989530 TGGAATGGAGAGGAGTGGAGTGG - Intergenic
1201136870 Y:10996722-10996744 GGGAATGGAGTGGAGTGGGTTGG - Intergenic
1201136896 Y:10996862-10996884 TGGAATGGAGTGGAGTGGGGTGG - Intergenic
1201137093 Y:10998225-10998247 GGGAATGGAAAGGAGTGAACTGG - Intergenic
1201137802 Y:11004034-11004056 TGGAATGGAGAGGAGTGGAATGG - Intergenic
1201138405 Y:11008163-11008185 TGGAATGGAGTGGGGTGGAGTGG - Intergenic
1201138945 Y:11012051-11012073 TGGAATGGAAAGGGATGGGAAGG - Intergenic
1201139800 Y:11018886-11018908 GGGAATGGAGAGGAATGGAATGG - Intergenic
1201139871 Y:11019348-11019370 CGGAATGGAGAGGAGTGGACTGG - Intergenic
1201140029 Y:11020417-11020439 TGGAATGGAGAGGAGTGGATTGG - Intergenic
1201140336 Y:11022507-11022529 TGGAGTGGAGAGGGGTGGAAAGG - Intergenic
1201140423 Y:11023101-11023123 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1201140441 Y:11023205-11023227 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1201140447 Y:11023235-11023257 GGGGATGGAGTGGGGTGGAGAGG - Intergenic
1201140612 Y:11025157-11025179 TGGAGTGGAGTGGGGTGGACTGG - Intergenic
1201142044 Y:11037157-11037179 TGGAATGGAGTGGGGTGGAGTGG - Intergenic
1201173486 Y:11293217-11293239 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1201226573 Y:11824458-11824480 GAGAAAGGAGAGAGGAGGGCGGG - Intergenic
1201290956 Y:12420832-12420854 GGGAGTGGAGAGGGGTGACCGGG - Intergenic
1201320167 Y:12689835-12689857 TGGAATGGAAAGGGGCTGGCTGG - Intergenic
1201458894 Y:14201178-14201200 GGAAAGGGAGAGGGGAGGGAGGG + Intergenic
1201885744 Y:18880168-18880190 GTGGAGGGAGAGGCGTGGGCGGG + Intergenic
1202605762 Y:26638526-26638548 TGGAATGGAAAGGGGTGGAATGG + Intergenic
1202608501 Y:26659314-26659336 TGGAATGGAGCGGAATGGGCAGG + Intergenic
1202608760 Y:26661252-26661274 TGGAATGGAGTGGAGTGGGCTGG + Intergenic
1202609131 Y:26664100-26664122 TGGAATGGAGTGGCGTGGGGTGG + Intergenic
1202623157 Y:56832843-56832865 TGGAATGGAGTGGAGTGGACTGG - Intergenic
1202623608 Y:56835811-56835833 GGAAATGGAGAGGAGTGGAGTGG - Intergenic
1202623712 Y:56836502-56836524 AGGAGTGGAGAGGGGTGGAGTGG - Intergenic