ID: 1021586713

View in Genome Browser
Species Human (GRCh38)
Location 7:22216389-22216411
Sequence CCTAGGGAATGGAGAGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 455}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021586713_1021586724 12 Left 1021586713 7:22216389-22216411 CCCACCCCTCTCCATTCCCTAGG 0: 1
1: 0
2: 3
3: 28
4: 455
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586713_1021586725 13 Left 1021586713 7:22216389-22216411 CCCACCCCTCTCCATTCCCTAGG 0: 1
1: 0
2: 3
3: 28
4: 455
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021586713 Original CRISPR CCTAGGGAATGGAGAGGGGT GGG (reversed) Intronic
900639922 1:3683823-3683845 ACAATGGAATGGAGTGGGGTGGG + Intronic
900868606 1:5286115-5286137 CCTGGGCACTGGGGAGGGGTGGG + Intergenic
900988701 1:6087622-6087644 CCTTGAGAAGGGAGAGTGGTCGG + Intronic
901203872 1:7483047-7483069 CATATTGAATGCAGAGGGGTTGG - Intronic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
901633214 1:10657876-10657898 CCTTTGGGATGGAAAGGGGTTGG + Intronic
901937525 1:12636831-12636853 CCTAGGGAATGGGATGGGGTGGG + Intergenic
902259891 1:15216877-15216899 CTGTGGGATTGGAGAGGGGTAGG + Intronic
902473222 1:16664787-16664809 CCTAGGAAATGAAGTTGGGTGGG + Intergenic
902485581 1:16742655-16742677 CCTAGGAAATGAAGTTGGGTGGG - Intronic
902499316 1:16898108-16898130 CCTAGGAAATGAAGTTGGGTGGG - Intronic
902744072 1:18461486-18461508 CCTAGAGATTTGAGAGGAGTTGG + Intergenic
903352592 1:22726960-22726982 CCTAGAGGCTGGAAAGGGGTAGG + Intronic
903870355 1:26429661-26429683 CCCAGGGAAAGGAGAAGGGAAGG - Exonic
903933263 1:26876829-26876851 CCCATGGAGTGGAGATGGGTGGG - Exonic
904267233 1:29325060-29325082 GCTAGGGAATCTAGAAGGGTGGG - Intronic
904439971 1:30523978-30524000 GCTAGGGAATGGAGAGTGTTTGG + Intergenic
904826245 1:33275779-33275801 CCTGGGGGATGGAGATTGGTTGG + Intronic
904841875 1:33377463-33377485 GCTTGGCAGTGGAGAGGGGTTGG + Intronic
905182036 1:36173253-36173275 CCAAGGGAAGGGAGTGGGGGAGG + Intronic
905291006 1:36921915-36921937 CCTGGGGAAAGGAGAGAGGTGGG - Intronic
905363795 1:37437955-37437977 CCTAGGGTTTGGGGAAGGGTTGG - Intergenic
905561804 1:38933255-38933277 TGTAGGGAAGGGAGAGGGCTAGG - Intronic
905617388 1:39410316-39410338 CCTGGGGAAAGGAGAGGAGGAGG + Intronic
905665536 1:39761100-39761122 CCTGGGGAGTGGAGAGGTGCGGG - Intronic
906344159 1:45004806-45004828 CCTAGGGGTTGGAGAGAGGCAGG + Exonic
906362902 1:45179443-45179465 CATAGGGAAGGGAGAGGGTTAGG + Intronic
906416095 1:45622251-45622273 CCTTGCAAATGCAGAGGGGTCGG - Exonic
906480241 1:46194764-46194786 CCTAGGAGATGGGGTGGGGTGGG - Intronic
906642496 1:47449764-47449786 CGAAGGGAATGGGGAGGGGCGGG + Intergenic
907249096 1:53126171-53126193 TCTAGGGCCTGCAGAGGGGTGGG - Intronic
907918211 1:58889984-58890006 CCCAAGGAATGGAGGGGGCTGGG - Intergenic
910208852 1:84774139-84774161 GCTGGGGAATGCAGAGGGGAAGG + Intergenic
910210121 1:84783651-84783673 CCCCGGGACTGGAGAGTGGTGGG + Intergenic
910231744 1:84994998-84995020 CTCAGGGAATAGAGAGGGTTGGG + Intronic
913196726 1:116462903-116462925 CCTTGGGAATGGAGAGGCTGGGG - Intergenic
914222101 1:145690308-145690330 CCTATGAAATGGAAAGGTGTAGG - Intronic
914813465 1:151046629-151046651 CCTAGGAGAGGGAGAGGGGGAGG - Exonic
915556638 1:156664491-156664513 CCCATGGAAGGGAGAGGGGATGG - Intergenic
915646886 1:157278960-157278982 CATAGCGAATGGAGCGTGGTGGG + Intergenic
915934931 1:160084892-160084914 CCTGGGGAGGGGAGCGGGGTTGG + Intronic
916006372 1:160664901-160664923 CAGAGGAAGTGGAGAGGGGTTGG - Intergenic
917158795 1:172033815-172033837 CATAGTGCATGGAGCGGGGTAGG - Intronic
917330772 1:173878413-173878435 CCCAGGGAAAGGAGAAGGGAAGG + Intronic
917591267 1:176479510-176479532 CCTTGGGAAGGGAGAGGTTTAGG + Intronic
918095371 1:181329944-181329966 CCAAGGGAGTGGAGGGGAGTAGG + Intergenic
919519721 1:198572898-198572920 CCTACGGGGTGGAGAGGAGTAGG + Intergenic
919738803 1:200970385-200970407 CCTTGGGAAGGGACAGCGGTGGG - Intronic
920260751 1:204686131-204686153 ACTAAGGAATGTAGTGGGGTGGG + Intergenic
920887941 1:209951275-209951297 AGAAGGGAATGGAGAGGGGCAGG - Intronic
922096571 1:222447949-222447971 CCTTTGGAAGGGAGAGTGGTTGG - Intergenic
924635695 1:245785573-245785595 CCAAGGGGATGGGGAGGGGTTGG - Intronic
1063171621 10:3514826-3514848 CAGAGGGAAGGGAAAGGGGTGGG + Intergenic
1063428331 10:5966609-5966631 CTGAGGGCTTGGAGAGGGGTGGG - Intronic
1064980919 10:21165780-21165802 CCCAGGGAAAGGTGTGGGGTCGG + Intronic
1065094402 10:22266285-22266307 GCTAGGGAATGGAGCAGAGTGGG + Intergenic
1065994322 10:31042292-31042314 CACAGGGAATGGAAAGGGCTAGG + Intergenic
1067174217 10:43931073-43931095 CCCAGGGAGAGCAGAGGGGTGGG + Intergenic
1067972633 10:50990875-50990897 CCAAGGGAAGGGGGTGGGGTGGG - Intergenic
1068956073 10:62819179-62819201 CGCAGGGAATGGAGTGGGGGCGG + Intronic
1069267151 10:66474218-66474240 GCTAGGGAGTGTAGAGGGGAAGG - Intronic
1069705955 10:70459093-70459115 CCTGGGGCTTGGAGTGGGGTGGG - Intergenic
1069710300 10:70483561-70483583 CCATGGGAGGGGAGAGGGGTGGG + Intronic
1072316136 10:94205201-94205223 CCTGGGGAATGGAAAGGTGGTGG - Intronic
1072724237 10:97801692-97801714 GCTGGGGAATGGAGGGGGGCAGG + Intergenic
1072910762 10:99498837-99498859 CGAAGGGAATGGAGAGGAGAAGG - Intergenic
1073988118 10:109232496-109232518 CTTTGGGACTGGAGAGTGGTAGG - Intergenic
1074563363 10:114554040-114554062 TCTGGGAAATGGAGAAGGGTGGG + Intronic
1075549157 10:123379431-123379453 CCTGGGGAATGCAGAGGGAGAGG - Intergenic
1076381833 10:130028714-130028736 CCCAGGGAATGGACAGGGGCAGG + Intergenic
1076899720 10:133332190-133332212 CATTGGAAATGGAGAGGTGTGGG + Intronic
1077440591 11:2566970-2566992 CCTAGGGGGTGGAGTGGGGGAGG + Intronic
1078436372 11:11328987-11329009 CCTAAGGGATGGTGGGGGGTGGG - Intronic
1080709322 11:34731619-34731641 TCTAGGGACTGGAGAGGAGCTGG + Intergenic
1081442417 11:43094707-43094729 GCTAGGGAATGGGGAGATGTGGG + Intergenic
1081584536 11:44375419-44375441 CCTTGGGTATGGAAAGGGGTGGG + Intergenic
1081942362 11:46954853-46954875 CCCAGGGAAAGGAGAAGGGAAGG + Intronic
1082814849 11:57501053-57501075 CACAGGGAAGGGCGAGGGGTTGG + Intronic
1083367924 11:62152651-62152673 CCTGGGGAATGGAGAGGGTAGGG - Exonic
1083666299 11:64276693-64276715 CCTGGGGGAAGGAGAGGGCTGGG + Intronic
1083713917 11:64565066-64565088 CCTAGGGGAAGGGGAGGGGATGG - Intronic
1083949079 11:65944074-65944096 CATAGGCAATGGGGAGGGGATGG - Intergenic
1084682364 11:70673784-70673806 CCTAGTGAGTGGAGGGAGGTTGG - Intronic
1085346190 11:75769384-75769406 CCTGGTGAAGGGAGAGGGGAGGG - Intronic
1086270869 11:85065078-85065100 TCTGGGCAGTGGAGAGGGGTGGG + Intronic
1087252894 11:95923819-95923841 CGAAGGGGATGGAGAGGGGCCGG - Intronic
1087289247 11:96301440-96301462 CCTACGCAGTGGAGAGGAGTTGG - Intronic
1089536135 11:119161725-119161747 CCTGGGGATTGGAGAGGCCTGGG + Exonic
1089760195 11:120717443-120717465 CTTAGGGATTGGAGAAGGATGGG + Intronic
1090422365 11:126584326-126584348 GCCAGGCAATGGAGAGGTGTTGG - Intronic
1090642223 11:128739545-128739567 CCTTGGGAATGGAGAGTAGTGGG - Intronic
1090777910 11:129981324-129981346 TCTAGGGAATGGGTTGGGGTGGG - Intronic
1090782110 11:130016421-130016443 CCTGGGGAGTGAAGAGAGGTTGG + Intergenic
1090880667 11:130829171-130829193 GGTAGGGAAAGGAGAGGGGCTGG + Intergenic
1091198614 11:133753174-133753196 CCCAAGGAATGGGGAAGGGTCGG + Intergenic
1091834979 12:3579364-3579386 CCTGGGGAGTGGAGAGGGCCAGG - Intronic
1091966497 12:4746626-4746648 ACTAGGGAATGCAGACGTGTGGG + Intronic
1096463209 12:51834256-51834278 CCTCAGGAATGGATAGGGGAGGG + Intergenic
1097166193 12:57087845-57087867 CCCAGGGAAAGGAGGGGGGGTGG - Intronic
1098304540 12:69089629-69089651 ACTAGAGAAGGGAGAGGGGAAGG - Intergenic
1098456934 12:70685114-70685136 CATAGGGAAAGGAGAGAGATGGG - Intronic
1098560811 12:71869597-71869619 GCTAGGAAATGGAGAGATGTAGG + Intronic
1099262482 12:80400597-80400619 CCTTGGGAAGGGAGAGGAGTGGG - Intergenic
1100371867 12:93975996-93976018 CCATGGGAATGAAGAGGAGTAGG - Intergenic
1100644714 12:96516547-96516569 CTTAGGGAATAGAGGGCGGTCGG + Intronic
1102702817 12:114854448-114854470 CCTAAGGAGGGGAGAGGGGCTGG + Intergenic
1103234033 12:119357375-119357397 TGTTGGGAATGGAGAGAGGTTGG - Intronic
1103389802 12:120563733-120563755 CCTTGGGCATGGGGAGGGGTGGG + Intronic
1103728038 12:123008564-123008586 CCTGGGTAATGGAGAGAGGCAGG + Intronic
1103843649 12:123886296-123886318 CCTAGGAAGTGGCGAGGGTTGGG + Intronic
1106020012 13:25905594-25905616 CAGAGGGCATGGAGAGGGGCCGG - Intronic
1106929002 13:34643484-34643506 CCTAAGGAATGGAGCTGGATAGG - Intergenic
1107331602 13:39307193-39307215 CCTGGGGGAAGGAGAGGGGATGG - Intergenic
1107438605 13:40404027-40404049 CCTAGTGAGTGGAGGGGTGTTGG + Intergenic
1107937387 13:45356582-45356604 CCTATTGAATGGAGAGAGGTGGG + Intergenic
1108358687 13:49650625-49650647 CCTAGCCAGTGGAAAGGGGTTGG - Intergenic
1110607941 13:77454899-77454921 TCGAGGGAGTGGAGAGGGGCTGG - Intergenic
1112183158 13:97104784-97104806 TCCAGGGAACGGAGATGGGTGGG - Intergenic
1112563805 13:100535259-100535281 TCCAGGGAGTGGAAAGGGGTAGG - Intronic
1112575880 13:100636286-100636308 CCTAGGGAAAGGGGAAGGGAGGG + Intronic
1113452210 13:110419145-110419167 CCTGGGGAATGGAGAGGATATGG + Intronic
1114033333 14:18595943-18595965 CCTAGGGAAGGCAGAGGGAAAGG + Intergenic
1114125367 14:19719410-19719432 CCTAGGGAAGGCAGAGGGAAAGG - Intronic
1114738033 14:25063193-25063215 CCTAGGGAAGGGAAAGTGATTGG - Intergenic
1114750131 14:25194790-25194812 TCTAGGGAATAGAGAGAAGTAGG - Intergenic
1115939749 14:38595580-38595602 GCTAGGGGATGGAGAGCGTTAGG - Intergenic
1117520070 14:56542529-56542551 CCTAGGCTATGGATAGGAGTGGG - Intronic
1119419847 14:74502039-74502061 CTTAGGGAGTGAAGAGGGTTAGG - Intronic
1120233895 14:81868683-81868705 CCTGGGAAAAGGAGATGGGTGGG + Intergenic
1120759640 14:88274044-88274066 CCTAGGGCAGGGTGGGGGGTGGG - Intronic
1121855555 14:97266256-97266278 CCTAGGGAAAGAAGAGGCTTGGG - Intergenic
1122604923 14:102941809-102941831 CCTAAGGGATGGGGAGGGGCAGG + Intronic
1122838091 14:104441210-104441232 AATAGGGAATGGGCAGGGGTAGG - Intergenic
1122848286 14:104512799-104512821 CCAAGGGAATGGTGAGGTGAGGG + Intronic
1123121384 14:105918564-105918586 CATAGGGCCTGGACAGGGGTGGG + Intronic
1123404105 15:20010228-20010250 CATAGGGCCTGGACAGGGGTGGG + Intergenic
1123513443 15:21016874-21016896 CATAGGGCCTGGACAGGGGTGGG + Intergenic
1124207112 15:27730521-27730543 CCTTGGGAATGGGGAGGGGTGGG - Intergenic
1125099587 15:35895675-35895697 CCTAGGAAAGGGAGAGAGATGGG + Intergenic
1125313208 15:38402874-38402896 CCTGGGGAATGGAGCAGGATGGG - Intergenic
1125521596 15:40350921-40350943 TCGAGGGAATGAAGAGGGATGGG - Intergenic
1125713642 15:41806454-41806476 TCTGGGGGATGGAGAGTGGTAGG + Intronic
1126278440 15:46913817-46913839 TCTAGGGACTGGAGGGGTGTGGG + Intergenic
1127053594 15:55110011-55110033 GCTAGGCATTGGACAGGGGTTGG + Intergenic
1128263446 15:66249231-66249253 CTTAAGGAATTGGGAGGGGTGGG - Intronic
1128725617 15:69986532-69986554 CCTAGGAAAAGGAGGGTGGTGGG + Intergenic
1128931285 15:71706930-71706952 CCTGGAGGATGGAGAGGAGTTGG + Intronic
1129262822 15:74378345-74378367 CCTAGAGAATGGAGTGGACTTGG - Intergenic
1130157429 15:81363786-81363808 CCTAGGGCATAGAGAGGGAGAGG + Intronic
1130398188 15:83523373-83523395 CCTAGGAAGTGGTGCGGGGTGGG + Intronic
1130974900 15:88766639-88766661 CCTAGGCAATGGGGTGAGGTAGG - Intergenic
1131445727 15:92496770-92496792 CCTAGGGGAGGGAGAGGCATGGG + Intronic
1131537815 15:93252242-93252264 GCTAAGGAATGGATAAGGGTTGG + Intergenic
1132044035 15:98548902-98548924 CCTTGGGAAGGCAGAAGGGTGGG - Intergenic
1132518572 16:377164-377186 CCTAGGGAAAGAACAGGTGTGGG + Exonic
1132744388 16:1430661-1430683 CCTGGGGAAGGGGGAGGGGAAGG - Intergenic
1133326093 16:4943307-4943329 CCTAGAGAATGGAGAGGGGAGGG - Intronic
1134060704 16:11197912-11197934 CCTAGGGAAAGGGATGGGGTGGG + Intergenic
1134108108 16:11498585-11498607 CCTGGGGAGAGGAGGGGGGTGGG - Intronic
1135668045 16:24352310-24352332 TCTAGGGAATGGGGTGGGGCCGG - Intronic
1136316581 16:29458041-29458063 CCCAGGGCAGGGAGTGGGGTAGG - Intronic
1136431157 16:30197383-30197405 CCCAGGGCAGGGAGTGGGGTAGG - Intronic
1137364369 16:47848097-47848119 CCTATGGAATGGAGTGGAGGTGG + Intergenic
1137848545 16:51715292-51715314 CCCAGGGATTGGAAGGGGGTAGG + Intergenic
1138125815 16:54437616-54437638 CGGAGGGAAGGGACAGGGGTCGG + Intergenic
1138319292 16:56098264-56098286 CCAAGGAAAGGGAGATGGGTGGG + Intergenic
1138514242 16:57527139-57527161 CCTACGGGATGGAGGGGGCTGGG + Intronic
1138680155 16:58678358-58678380 CCCTGGGGATGGAGAGGGGCAGG + Exonic
1140840989 16:78838890-78838912 GCCAGGGACTGGAGAGGAGTGGG + Intronic
1140868658 16:79087002-79087024 CCTAGGGAATGGAGATACCTGGG + Intronic
1141253238 16:82378073-82378095 CCTAGGAAAGGCAGAGGGGGTGG - Intergenic
1141302529 16:82830531-82830553 GCTTGTGAATGGTGAGGGGTGGG + Intronic
1141920937 16:87134927-87134949 CCTAGAGAATAGAGAGAGGGGGG - Intronic
1141954941 16:87364460-87364482 CCTCTGGAATGGAGAAGAGTCGG - Intronic
1142067584 16:88071614-88071636 CCTTGGGAATGGGGAGGGTTTGG + Intronic
1142186042 16:88695176-88695198 CCTGGGGAAGGGAGAGGAGCCGG - Intergenic
1142472041 17:170088-170110 CCTGGGGACTGGAGAGGTGCCGG - Intronic
1142720696 17:1773834-1773856 CCTGGGGTAGGGGGAGGGGTTGG + Intronic
1143405248 17:6673113-6673135 CCTGGGGACTGGAGTGGGGGAGG + Intergenic
1144335566 17:14266155-14266177 TCTGGGGAGGGGAGAGGGGTTGG - Intergenic
1144598008 17:16587840-16587862 CCTCAGGAGTGGAGTGGGGTTGG + Intergenic
1144630378 17:16869041-16869063 CCTAGGGATGGGAGAGAGGAGGG - Intergenic
1144877726 17:18411140-18411162 CGTTGGGAAAGGAGAAGGGTCGG - Intergenic
1145154495 17:20533248-20533270 CGTTGGGAAAGGAGAAGGGTCGG + Intergenic
1145181559 17:20757566-20757588 CCAAGGGTATGGACATGGGTAGG - Intergenic
1145265496 17:21377862-21377884 CCTGGGAAATGGGGAGGGGGAGG - Intronic
1145929658 17:28676051-28676073 CCAAGGGAACTGAGAGGGTTAGG - Intronic
1145941521 17:28745491-28745513 CCTCGGGAAAGGAGCGGGGGAGG + Intronic
1146147809 17:30437104-30437126 CCTAGGGTTTGGAGTGGGGGTGG + Intronic
1147600136 17:41740199-41740221 CCTGGGGAAAGGAGCGGGGCTGG - Intergenic
1148484552 17:47982290-47982312 CCTGGGAAATGGGGATGGGTAGG - Intergenic
1148717836 17:49728484-49728506 CCTGGGGAATGCAGAGGGAATGG + Intronic
1148811644 17:50296697-50296719 CCCAGGGGAGGGAGAAGGGTAGG + Intergenic
1148854840 17:50572999-50573021 CCTAGGGGGTGCAGAGGGGCAGG - Exonic
1149336828 17:55644141-55644163 CCTAGAGAAGGGAGAAGGGAAGG - Intergenic
1149350612 17:55783294-55783316 CTTAGGGAAGGGAGAGAGGCTGG + Intronic
1149395619 17:56239243-56239265 CATAAGAAATGGAGAGAGGTTGG + Intronic
1149699557 17:58644102-58644124 TCTAGGGAGAGGAGAGGGGCTGG + Intronic
1149730982 17:58945995-58946017 TCTAGGGAAGGGAGAGAGATGGG - Intronic
1151046215 17:70922618-70922640 CTTAGGGAAAGCAGAGGAGTGGG + Intergenic
1151462485 17:74262786-74262808 GCAAGGGAAAGGAGTGGGGTGGG + Intergenic
1151815108 17:76467974-76467996 CCTGGGGAATGGGGAGGAGCAGG - Intronic
1151958481 17:77392625-77392647 CCTTGGGAAGGCAGAGGGGGAGG + Intronic
1152163664 17:78686541-78686563 CGTAGAGAATGGTGAGTGGTGGG + Intronic
1152236932 17:79143663-79143685 CCTAGGGACAGGAACGGGGTAGG + Intronic
1152572206 17:81125799-81125821 CCTAGGGGGTGGAGTGGGGTGGG + Intronic
1152928937 17:83100303-83100325 CCCAGGGAAGGGTGAGGGGCCGG + Intergenic
1153198954 18:2630153-2630175 CCCAGGTAATGGTGAGGGTTGGG - Intergenic
1153591056 18:6674530-6674552 CCCTGGGGATGGAGAGTGGTGGG + Intergenic
1153778808 18:8476666-8476688 CCTAGGGTCGTGAGAGGGGTTGG + Intergenic
1154228119 18:12527077-12527099 CCTAGTGAATGGAGAGATGCTGG - Intronic
1157642825 18:49234564-49234586 CCTAGGGGATGGTTAGGGGATGG + Intronic
1158224134 18:55182889-55182911 CTTGGGGAATGGAGAGTGGGAGG - Intergenic
1158693542 18:59683012-59683034 CCAAGGGAATGGAGATTGTTAGG - Intronic
1158949493 18:62480052-62480074 GCTAGGAAAGGGAGAGGAGTAGG - Intergenic
1159876031 18:73812396-73812418 CCTATGGAAAAGAGAGGGGGAGG + Intergenic
1162098788 19:8327107-8327129 CTTGGGGAAAGGAGCGGGGTCGG + Intronic
1162601799 19:11675245-11675267 CCCAAGGAATGGAAACGGGTTGG - Intergenic
1162744346 19:12790367-12790389 TCTAAGGAAGGGAGTGGGGTTGG + Intronic
1163822711 19:19505435-19505457 ACTGGGGGATGGAGCGGGGTGGG - Exonic
1163871825 19:19828192-19828214 CATAGGGAATTGAGGGAGGTGGG - Intergenic
1164028717 19:21380486-21380508 CATAGGGAATTGAGGGAGGTGGG + Intergenic
1164705269 19:30314810-30314832 CCCAGAGAAAGGGGAGGGGTTGG - Intronic
1165595979 19:37011537-37011559 CCTAGGCATTGGAGAGGTGGGGG + Intronic
1167104786 19:47423866-47423888 CCCAGGGAATCGGGAAGGGTTGG - Intergenic
1168031445 19:53683033-53683055 CTTTGGGAATGGAGTGGGGCGGG + Intergenic
1168041965 19:53765894-53765916 CTTTCGGAATGGAGTGGGGTGGG + Intergenic
924998648 2:386584-386606 GCCAGGGAATGGGGAGGAGTTGG - Intergenic
925641312 2:5988333-5988355 CCCTGGGAATGGAGAAGGGATGG - Intergenic
926004470 2:9362272-9362294 CCTTGTGAAAGGAGAGTGGTGGG + Intronic
926232437 2:11014607-11014629 CCTGGGGTTTGGAGTGGGGTTGG - Intergenic
928361442 2:30665131-30665153 CCTGGGGGATGGGGTGGGGTGGG + Intergenic
929504305 2:42516434-42516456 CCTATGGAAGTGAGATGGGTTGG - Intronic
929825539 2:45306816-45306838 CCCAGGGAGGGGAGAGGAGTTGG - Intergenic
930441370 2:51411624-51411646 CATGGGGAATGGAGAAGGGGGGG - Intergenic
930507157 2:52297737-52297759 CTTAGGGAATAGAGAGGCCTGGG - Intergenic
932614484 2:73223302-73223324 CCTGGAGAATGAAGTGGGGTGGG + Intronic
933580280 2:84118019-84118041 CCTAGGGAAAGGAGAGTGAAAGG - Intergenic
933617397 2:84496864-84496886 CCTGGGGCTGGGAGAGGGGTAGG - Intergenic
933692968 2:85194034-85194056 GCTATGGGATGGAGAGGGGTGGG + Intronic
934921609 2:98348500-98348522 CCTAGGGAGTGGGGCGGGGACGG + Intronic
936166945 2:110129053-110129075 CCTAGACAATGGATAGGGATTGG + Intronic
936257740 2:110931338-110931360 CCTGGGGAATGGGGAGAGATGGG + Intronic
936557939 2:113512096-113512118 CCCAGGGAGGGGAGAGGGGCTGG + Intergenic
937680552 2:124640062-124640084 GTTAGGGACTGGAAAGGGGTCGG - Intronic
937905337 2:127050228-127050250 CCAAGGGAAGGGAGAGGAGAGGG + Intronic
938104062 2:128518078-128518100 CATAGGGAATTGAGGGAGGTGGG + Intergenic
938764971 2:134454784-134454806 CTTAAGGAGTGGAGAGGGGAAGG + Intergenic
939329731 2:140741630-140741652 ACTTGAGAATGGAGAGTGGTAGG - Intronic
939677275 2:145088151-145088173 CATAGGGAAGGGAGAGGTGCCGG + Intergenic
940660163 2:156535415-156535437 CCTAGGAAAGAGAGGGGGGTGGG + Intronic
941857615 2:170246830-170246852 CCTAGGGCATGGTTAGGGATGGG + Intronic
942940377 2:181608416-181608438 GCTGGGGGATGGAGCGGGGTGGG + Intronic
944212208 2:197218325-197218347 CCTGGAGAATGGAGGGGTGTAGG - Intronic
946159486 2:217827502-217827524 CCTGGGGAGTGGAGCGGGGAAGG - Intronic
946942764 2:224786914-224786936 ACCAGTGAATGGAGAGGTGTGGG - Intronic
946947125 2:224832771-224832793 GCTAAGGGATGGAGAGGGGTAGG - Intronic
947966804 2:234289026-234289048 CGTAGGGAACAGAGAGGTGTAGG - Intergenic
948636216 2:239339450-239339472 CCTGGGGAATGGACAGGGGCAGG - Intronic
948855248 2:240727305-240727327 CACAGGGAAGGGAGAGGGGAGGG + Intronic
948867204 2:240782250-240782272 CCTCGGACATGGAGAGGGCTGGG - Intronic
949065491 2:241987828-241987850 TCTATGGAATGAAGACGGGTGGG + Intergenic
1169999970 20:11605008-11605030 CCCAGGGAAAGGAGAAGGGAAGG + Intergenic
1170704897 20:18736600-18736622 CCCAGGGCAAGGAGAGGGGGTGG - Intronic
1170921891 20:20686985-20687007 GCTTGGGAATGGAGGGGTGTAGG - Intronic
1171473476 20:25390322-25390344 CCTGGGGAAGGGAGCGGGGGTGG + Intronic
1172125504 20:32623024-32623046 CCTAGGGAAGGGAGAGGTCAGGG + Intergenic
1172687779 20:36770002-36770024 AAGAGGGAAGGGAGAGGGGTGGG + Intronic
1172889113 20:38251488-38251510 CCTGGGCAATGGAGTGGGGGTGG + Intronic
1172905267 20:38364358-38364380 CCTAGGGCATATAGAGGGGCTGG + Intronic
1173851055 20:46218652-46218674 TCTAGGGCCTGGAGAGGGTTGGG - Intronic
1176118929 20:63445506-63445528 CCCAGAGGCTGGAGAGGGGTGGG - Intronic
1176218257 20:63958205-63958227 CCTGGGGAATGGGGGAGGGTGGG + Exonic
1178104133 21:29299278-29299300 CCGAGGGCAGGGAGGGGGGTGGG - Intronic
1179141889 21:38732994-38733016 ACTGGGGAGTGGGGAGGGGTGGG + Intergenic
1179498455 21:41790694-41790716 GCTAGGGAATGGGGGAGGGTAGG + Intergenic
1179717886 21:43299381-43299403 CCTAGGGGCTGGAGCGGGTTTGG - Intergenic
1180457448 22:15522998-15523020 CCTAGGGAAGGCAGAGGGAAAGG + Intergenic
1181174298 22:21027175-21027197 TCTAGGGAATGGGGTGGAGTAGG + Exonic
1181182758 22:21079075-21079097 CGGAGGGAATGGGGTGGGGTAGG + Intergenic
1181582160 22:23834383-23834405 CCCAGAGACTGGGGAGGGGTAGG - Exonic
1182572486 22:31249405-31249427 CCTAGGGACTGAGGAGGTGTGGG - Intronic
1183099749 22:35576580-35576602 CCTAAGGAAGGGAGAGGAGAGGG + Intergenic
1183300481 22:37056684-37056706 CTTATGGGATAGAGAGGGGTGGG + Intronic
1183526471 22:38326096-38326118 CCCTGGGAATAGTGAGGGGTGGG - Intronic
1183564143 22:38601217-38601239 GCCAGGGTATGGAGAGTGGTAGG + Intronic
1183619018 22:38961968-38961990 CCTAGGGGAGGGAGAGGGAAAGG + Intronic
1183624221 22:38991904-38991926 CCTAGGGGAGGGAGAGGGAAAGG + Intronic
1183639980 22:39086881-39086903 CCTAGGGGAGGGAGAGGGAAAGG + Intronic
1184995006 22:48199183-48199205 CCTAGGGAAGAGAGTGGGGGAGG + Intergenic
950221914 3:11202549-11202571 GCTAGGGGATGGAGGAGGGTGGG - Intronic
952752607 3:36837411-36837433 CCCTGGGCATTGAGAGGGGTAGG - Intronic
954145848 3:48633969-48633991 CCTGGGGACTGGAGAGGGACTGG - Intronic
956458053 3:69443157-69443179 CCCAGGGAGGGGAGAGGGGCTGG + Intronic
956814216 3:72893246-72893268 GCAAGTGAATGGAGAGTGGTAGG - Intronic
957978026 3:87472461-87472483 CTTATGGAATGGAGTGGTGTGGG + Intergenic
958851726 3:99334703-99334725 CCAAGGGTTTGGAGAGAGGTAGG + Intergenic
959399124 3:105877713-105877735 CATAGGGAATGAAGAAGTGTAGG - Intergenic
960605358 3:119498937-119498959 CCTAGGGTGTGAAGTGGGGTAGG + Intronic
961752977 3:129108127-129108149 CCTAGGGAAGTGAGATGGGCAGG - Intronic
962006121 3:131351770-131351792 CCCAGAGAAGGGAGTGGGGTGGG - Intergenic
964373424 3:156025664-156025686 GCTAGGAAATGGAAAGGGGGAGG + Intergenic
964974765 3:162605429-162605451 ACTAGGTAATGGACAGAGGTTGG + Intergenic
965865537 3:173200329-173200351 ACTGGGTAATGGAGAGAGGTTGG - Intergenic
965984765 3:174737189-174737211 CCTGGGGAATATAGAGGTGTTGG - Intronic
966158202 3:176940918-176940940 AGTAGGGAATGAAGAGGAGTTGG + Intergenic
966218058 3:177522577-177522599 CCTAGGAAAAGGAAAGGAGTGGG + Intergenic
967151507 3:186654547-186654569 CCTAAGGAATGAAGAGGTGGTGG - Intergenic
968231409 3:197006859-197006881 CGTGGAGAATGGAGAGGGTTGGG - Intronic
969244963 4:5925868-5925890 CTTAAGGACTGGAGAGGGCTGGG + Intronic
969388051 4:6869541-6869563 CCAGGGGAATGGACAGGGCTGGG - Intronic
969573404 4:8023180-8023202 CCTAGTGATGGGAGAGGGGACGG - Intronic
973772791 4:54222091-54222113 TCCAGGGCATGGTGAGGGGTGGG + Intronic
974225573 4:59038751-59038773 TCCAGGGAAGGGAGAGGGATTGG + Intergenic
975226111 4:71874623-71874645 AGTTGGGAATGGAGAGAGGTTGG - Intergenic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976332136 4:83844757-83844779 CCTAGGGAATAGAGTATGGTGGG + Intergenic
976839748 4:89418326-89418348 CTTAGGAGATGGAGAGGGATGGG - Intergenic
978036189 4:103998217-103998239 CTTATGGAATGGAGAAAGGTGGG + Intergenic
979383467 4:120036126-120036148 CATAGGGCATAGTGAGGGGTTGG - Intergenic
980221316 4:129919637-129919659 CCAAGGAAATGGAGAGAGATAGG - Intergenic
981306156 4:143248837-143248859 CTTAGGGATGGGAGACGGGTTGG + Intergenic
982731393 4:158958686-158958708 CTTAGAGAATGCAAAGGGGTGGG + Intronic
983090012 4:163492382-163492404 CTTAGGGAATGGGGTAGGGTGGG + Intergenic
984127587 4:175831596-175831618 CCTAGGAGGTGGAGAAGGGTGGG - Intronic
986287417 5:6370194-6370216 CCCAGGCAATGAAGAGGTGTTGG - Intergenic
986470097 5:8065004-8065026 CCTGGGGGGTGGGGAGGGGTGGG - Intergenic
987304501 5:16624971-16624993 CCTGGGGAGAGGAGAGGGGCTGG - Intergenic
988113774 5:26856397-26856419 CCTAGCTAATGGACAGAGGTTGG - Intergenic
988155238 5:27441336-27441358 TTTAGGGAATGGAGTGTGGTAGG + Intergenic
989413723 5:41149594-41149616 CCCAGGGCTTGGAGTGGGGTGGG - Intronic
991079500 5:62582418-62582440 GCTAGGGAAAGAAAAGGGGTGGG + Intronic
991099421 5:62776165-62776187 CATAGGGAATTGAGGGAGGTGGG + Intergenic
995849758 5:116532696-116532718 CCTAGGGAAAAGAGAAGGGAAGG - Intronic
996110738 5:119563588-119563610 TCTAGGGAATGCATACGGGTGGG - Intronic
996403303 5:123085698-123085720 CCTAGGAAATGGATGGGGGTGGG - Intergenic
996783427 5:127213238-127213260 ACTAGAGAATGGAGAGAGGGAGG - Intergenic
997432201 5:133848285-133848307 CCTTGGGAATGGGGAAGGATGGG - Intergenic
997583273 5:135030410-135030432 CCTAGGGAGGGGTGAGGGCTGGG + Intronic
997639742 5:135441442-135441464 GTTGGGGAATGGAGAGGGGAAGG + Intergenic
997759407 5:136430712-136430734 CCTAGGAAATGAAGATTGGTAGG + Intergenic
998496096 5:142590816-142590838 ACTAGGAATTGGTGAGGGGTTGG + Intergenic
998646309 5:144066112-144066134 CCTAGGGTGTGGAGAGGGGCTGG + Intergenic
1000528138 5:162384445-162384467 CATAGGGAAGTGAGAGGGGAAGG - Intergenic
1001604157 5:172948145-172948167 CCCAGGGAGTGGAGAGGACTGGG - Intronic
1002334305 5:178467422-178467444 CCTAAGGCAGGGAGTGGGGTAGG - Intronic
1002354994 5:178619992-178620014 TCTGGGGAAAGGAAAGGGGTTGG - Intronic
1002421902 5:179153323-179153345 CCTAGGGGGTGGGGAGTGGTGGG + Intronic
1002440937 5:179264177-179264199 TCTTGGGGATAGAGAGGGGTGGG - Intronic
1002874489 6:1199548-1199570 CCCAGGGAAGGGAGATGAGTGGG + Intergenic
1002887189 6:1308248-1308270 CCTGGGGAGTGGAGAGAGGCAGG - Intergenic
1003192157 6:3883756-3883778 GCTGGGGAATGGAAATGGGTTGG - Intergenic
1003545706 6:7056598-7056620 ACGAGGGAAGGGAGAGGGGAAGG + Intergenic
1004005900 6:11637074-11637096 CCTAGGAGATGAGGAGGGGTTGG - Intergenic
1004326139 6:14675595-14675617 CCCATGGAAAGGAGAGAGGTGGG + Intergenic
1004678367 6:17866603-17866625 CCTAGTGCATGTAGAGGGATCGG + Intronic
1004723295 6:18287998-18288020 CATAGAGAAAGGAGAGAGGTGGG + Intergenic
1005410349 6:25538843-25538865 CCATGGAAATGGAGAGGGGCTGG + Intronic
1005466746 6:26123380-26123402 TATAGGAACTGGAGAGGGGTGGG - Intronic
1006303686 6:33207168-33207190 CTCAGAGAAAGGAGAGGGGTGGG - Intergenic
1006561092 6:34913284-34913306 ACTAGTGAATGGGTAGGGGTGGG - Intronic
1009842385 6:69093291-69093313 CCTAGGGAAAGGGATGGGGTGGG + Intronic
1009902906 6:69830930-69830952 CCTAGGAAATGTGAAGGGGTGGG + Intergenic
1010133518 6:72523251-72523273 GCAAGGGCATGGGGAGGGGTGGG + Intergenic
1010625374 6:78131761-78131783 CCTTGGGAAAAGAGAGGAGTGGG + Intergenic
1013449824 6:110269074-110269096 CCTAAGGAATGGAGAGGCTTGGG - Intronic
1014813791 6:125913043-125913065 TCCAGGGAATGGAATGGGGTGGG - Intronic
1014888379 6:126810808-126810830 ACTAGAGACTGGGGAGGGGTAGG + Intergenic
1014962854 6:127708026-127708048 CATAGGGGATGGAGAGGGCAGGG + Intergenic
1015587924 6:134795154-134795176 CCCTGGGAATGGAGTGGGGGAGG + Intergenic
1016170918 6:141015551-141015573 CCTTGGGCATGGAGAGGAATAGG + Intergenic
1017117751 6:150995146-150995168 CTTAGGGATGGGGGAGGGGTGGG + Intronic
1017414468 6:154205110-154205132 GCTAGGGAGTGGCCAGGGGTTGG - Intronic
1018027444 6:159817220-159817242 CCCTGGGACTGGAGAGGTGTTGG - Intronic
1018293533 6:162318076-162318098 ACCAGGGCCTGGAGAGGGGTAGG - Intronic
1018328418 6:162700098-162700120 CATAGGGAAAGGAGAGAGGAGGG - Intronic
1018670570 6:166173441-166173463 GCTGGGGAGAGGAGAGGGGTGGG + Intergenic
1018769622 6:166959191-166959213 CCTAGGTAATGGGTAGGGGGTGG + Intergenic
1019254584 7:41106-41128 CTTAGGGAATGGGGAGCAGTGGG - Intergenic
1019525999 7:1480817-1480839 CCGAGGTACTGGGGAGGGGTGGG - Exonic
1020135349 7:5584908-5584930 CCACAGGAATGGAGTGGGGTTGG + Intergenic
1020943245 7:14566712-14566734 CCTGGAGCATGGAGAGGGATAGG - Intronic
1021586713 7:22216389-22216411 CCTAGGGAATGGAGAGGGGTGGG - Intronic
1021622435 7:22562117-22562139 CCGAGGGTATGGAGAGTTGTTGG + Intronic
1022107346 7:27205956-27205978 GAGAGGGAATGGTGAGGGGTCGG - Intergenic
1022797808 7:33746067-33746089 CTTAGGGAATGGGATGGGGTGGG + Intergenic
1022800239 7:33769941-33769963 GCTAGGGAATGGCTAGGGATGGG + Intergenic
1023766584 7:43517358-43517380 GCTTGGGAAGGGAGAGAGGTCGG - Intronic
1023895038 7:44426279-44426301 CCTGGGGAAAGGAGAATGGTTGG + Intronic
1025006896 7:55362579-55362601 CCTAGGGGATAGTGAGGGATAGG + Intergenic
1025757610 7:64359527-64359549 CCTATGGAAGGGAGATGAGTAGG + Intergenic
1026319897 7:69259197-69259219 TCTAGAGTATGGAAAGGGGTGGG + Intergenic
1026329132 7:69336893-69336915 CCCAGGGAATGCAGTGGGGATGG - Intergenic
1028775332 7:94669728-94669750 TCAAGGGAATGGGGTGGGGTAGG + Intergenic
1029117204 7:98243438-98243460 GCCAGGGCAGGGAGAGGGGTTGG + Intronic
1029356727 7:100057567-100057589 CCTTGGGAATGGAATGGGATGGG + Intronic
1030161164 7:106509895-106509917 CCTAGTCTATGGAGAGGGGCTGG + Intergenic
1030845246 7:114401060-114401082 CCTAGGGAATGTAGAGGGTGAGG + Intronic
1031449863 7:121901987-121902009 AGTCGGGAATGGAGAGGGATTGG - Intronic
1032476636 7:132215643-132215665 TCTGGGGAAGGGAGAGGGGCTGG + Intronic
1032538581 7:132684933-132684955 CCTGGGGAAGGGAGAGGTGTGGG + Intronic
1033419314 7:141192356-141192378 CCTGGGGAAGGGAGAGGTGGGGG + Intronic
1034683552 7:152949808-152949830 CCTAGAGGATGGATGGGGGTCGG - Intergenic
1034778836 7:153858515-153858537 TCTAGGGAATGCAGAGTGGGAGG - Intergenic
1036071950 8:5450529-5450551 CTTAGGGAATGGAGAATGGGTGG - Intergenic
1036134519 8:6148019-6148041 CCTTGGGAAAGGAGAGGGGTTGG + Intergenic
1037004376 8:13759350-13759372 CATCGGGGATGGGGAGGGGTGGG - Intergenic
1037076812 8:14730712-14730734 CCTAGGGAATGGAGGTGCCTTGG - Intronic
1037332426 8:17756638-17756660 CATATGAATTGGAGAGGGGTGGG - Intronic
1037488674 8:19375620-19375642 CATAGGGGATGGGGAGGGTTAGG + Intronic
1037797355 8:22007536-22007558 CCCAGGGAAGGGAGAGGTCTGGG - Intergenic
1038600147 8:28932212-28932234 CCTAGGGAATGGTGAGTGAAGGG + Intronic
1039928145 8:41957992-41958014 CTTGGGGAATGGAGAGGGAAGGG - Intronic
1040894894 8:52355699-52355721 CCTAAGGATTGGAGAATGGTAGG - Intronic
1041043142 8:53866718-53866740 CGTGGGGAATGGAGTGGGGTGGG + Intronic
1041445772 8:57949474-57949496 CCTGGGGAACGGAGGGGGCTGGG + Intergenic
1041968976 8:63715053-63715075 CCTTGTGAATGGAGCTGGGTAGG - Intergenic
1044408431 8:91857502-91857524 CCCAGGAAATGAAGAAGGGTTGG - Intergenic
1046375680 8:113377009-113377031 TCTAGGGAGTGGGGTGGGGTGGG + Intronic
1047214198 8:122863586-122863608 ACAAGGGAAAGGAGAGGGATGGG + Intronic
1047493381 8:125391899-125391921 CCCAGGGAAAGGAGAGGGACTGG - Intergenic
1049401598 8:142430038-142430060 CCAAGGAAATGGAGAGGGACAGG - Intergenic
1049533168 8:143166602-143166624 TCTAGGAAGTGGAGAGGGGAAGG + Intergenic
1049593578 8:143473428-143473450 CCTAGTGCAGGGAGAGGCGTGGG - Intronic
1049780726 8:144427665-144427687 CCTAGGGAATGAAGATGGAGAGG + Intronic
1050795750 9:9539318-9539340 CATAGGGAATGAAAGGGGGTAGG + Intronic
1052176082 9:25464377-25464399 ACTGGGTAATGGAGAGAGGTTGG - Intergenic
1052741902 9:32401563-32401585 CCTAGGGAATGGTGACAGGTTGG + Intronic
1052851000 9:33378352-33378374 CTTGGGGAATGGCGAGGGTTGGG + Intergenic
1052877426 9:33577661-33577683 ACTAGGTAATGGACAGAGGTTGG + Intergenic
1053040584 9:34867395-34867417 CAGAGGTAATGGAGAGAGGTGGG + Intergenic
1053498561 9:38566548-38566570 ACTAGGTAATGGACAGAGGTTGG - Intronic
1053737118 9:41108678-41108700 CCGAGGGAGGGGAGAGGGGCTGG - Intergenic
1053862495 9:42401235-42401257 CCTAGGCAATGGGGAGGGCCAGG + Intergenic
1054461640 9:65468451-65468473 CCTAGGGAGAGGAGAGCTGTCGG - Intergenic
1054691229 9:68322639-68322661 CCCAGGGAGGGGAGAGGGGCTGG + Intergenic
1054758354 9:68981458-68981480 CCTAGGGAATGGCGGAGGGTGGG + Intronic
1054760371 9:68999324-68999346 CCTCGGTAAGGTAGAGGGGTGGG - Intronic
1054805284 9:69391578-69391600 CTTTGGGAAAAGAGAGGGGTGGG - Intronic
1055280683 9:74670769-74670791 CTTAGGGAAGGGAGAGGGAGGGG + Intronic
1055922832 9:81479630-81479652 CCTAGGCAAGGGAGATGTGTAGG - Intergenic
1056167992 9:83956971-83956993 CTGCGGGAAAGGAGAGGGGTGGG - Intronic
1057161624 9:92892836-92892858 ACTAGGTAATGGACAGAGGTTGG - Intergenic
1057678009 9:97151041-97151063 ACTAGGTAATGGACAGAGGTTGG - Intergenic
1057791537 9:98128087-98128109 CCCAAGCAATTGAGAGGGGTTGG - Intronic
1058827295 9:108786583-108786605 CTTAGGGAAGGGAGAAGGGAGGG + Intergenic
1058990854 9:110254884-110254906 CCTGGGGAAGGGAGTGGGGCTGG - Intronic
1059140817 9:111851654-111851676 CTTAGGCAAAGGGGAGGGGTGGG + Intergenic
1059400337 9:114065643-114065665 CCAAGGGAATGGTGAGGGTGGGG - Intronic
1059958398 9:119541996-119542018 CCTTGGGATTGGAGATGGGTAGG + Intergenic
1060479367 9:124009009-124009031 CCAAGGGAAAGGCAAGGGGTGGG - Intronic
1060804426 9:126565463-126565485 CCCAGTGCATGGAGTGGGGTGGG + Intergenic
1060818934 9:126650666-126650688 CCTCAGGAAGGGAGAGGGGCTGG - Intronic
1061393628 9:130331601-130331623 CCCAGGGAGGGGAGAGGGGAAGG - Intronic
1061523556 9:131138242-131138264 CCTAGGTTATGGGGAGGGGAGGG - Intronic
1061536256 9:131252187-131252209 CCTAGGACATGGAGTGGGGACGG - Intergenic
1061615900 9:131778709-131778731 ACCAGTGAGTGGAGAGGGGTGGG - Intergenic
1061946306 9:133910113-133910135 TCTAGGCAATAGAGAGGGCTGGG - Intronic
1061999557 9:134209083-134209105 CCTCGAGAATGGAGTGGGTTTGG - Intergenic
1062019018 9:134307473-134307495 CACAGGCAGTGGAGAGGGGTCGG + Intergenic
1186326382 X:8482021-8482043 CCTAGGGAAAGGAAAGGAGAAGG - Intergenic
1186539165 X:10382616-10382638 CCTTGGGGATGGAGGGGGTTTGG + Intergenic
1187332615 X:18354548-18354570 CGTAAGGAATGGAGAGGCGGAGG - Intronic
1187374672 X:18741123-18741145 CCTAAGGAATGGGGAGTGGGTGG + Intronic
1188976686 X:36683809-36683831 GCTAGGGAATGGGGAATGGTAGG + Intergenic
1189121067 X:38395499-38395521 CCTCAGGAAAGCAGAGGGGTTGG + Intronic
1189173062 X:38927697-38927719 GCCAGGGATTGGAGTGGGGTTGG - Intergenic
1190180233 X:48185498-48185520 TCTGGGGAATGCAGAGGGATGGG - Intergenic
1190440308 X:50469865-50469887 CCGGGGGAATGGGAAGGGGTTGG - Intronic
1190870871 X:54423644-54423666 CCTAGGGAATGGAAAGAGGGAGG - Intergenic
1191007210 X:55722362-55722384 CCTTGGGGATGCAGAGAGGTTGG + Intronic
1191975262 X:66864438-66864460 CCTGGGGAATTGGGAGGGGTTGG - Intergenic
1192027952 X:67475235-67475257 TCTAGGGACTGTTGAGGGGTTGG + Intergenic
1193703984 X:84798060-84798082 CAAAGGGAAAGGAGAGGGGAAGG - Intergenic
1194905055 X:99565609-99565631 GCTAGGGCATAGAGAGTGGTAGG - Intergenic
1194999218 X:100625703-100625725 TTTAGGTATTGGAGAGGGGTAGG + Intergenic
1195743707 X:108092080-108092102 CCTAGGGAGTGGAAAGAAGTGGG + Intronic
1196819791 X:119693301-119693323 AGTAGGGTATGGAGAGGGGGCGG + Exonic
1196871317 X:120116003-120116025 GAGAGGGAATGGAGAGGAGTGGG + Intergenic
1198181416 X:134213403-134213425 CCTAGGGCTGGGGGAGGGGTTGG + Intergenic
1198337364 X:135679656-135679678 GGTAGGGAATGGAGTGGGGATGG + Intergenic
1198361830 X:135903158-135903180 GGTAGGGAATGGAGTGGGGATGG - Intronic
1198804461 X:140480573-140480595 ACTAGGTAATGGTGACGGGTGGG + Intergenic
1199346690 X:146748717-146748739 ACTAGGTAATGGACAGAGGTTGG - Intergenic
1200118555 X:153779962-153779984 ACAAGGGAATGGAGAGGCGAGGG - Intronic
1200169133 X:154059613-154059635 CCAAGGGAATGGGAAGGGGCAGG - Intronic
1201363116 Y:13175009-13175031 ATGAGGGAATGGAGAAGGGTAGG + Intergenic