ID: 1021586715

View in Genome Browser
Species Human (GRCh38)
Location 7:22216390-22216412
Sequence TCCTAGGGAATGGAGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 1, 2: 0, 3: 34, 4: 385}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021586715_1021586725 12 Left 1021586715 7:22216390-22216412 CCACCCCTCTCCATTCCCTAGGA 0: 1
1: 1
2: 0
3: 34
4: 385
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586715_1021586724 11 Left 1021586715 7:22216390-22216412 CCACCCCTCTCCATTCCCTAGGA 0: 1
1: 1
2: 0
3: 34
4: 385
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021586715 Original CRISPR TCCTAGGGAATGGAGAGGGG TGG (reversed) Intronic
900183372 1:1322149-1322171 TCCCTGGGCATGAAGAGGGGCGG - Intronic
900868604 1:5286114-5286136 TCCTGGGCACTGGGGAGGGGTGG + Intergenic
901574960 1:10193289-10193311 CCTTAGGGAATGGAGAGAAGGGG + Intergenic
901937523 1:12636830-12636852 GCCTAGGGAATGGGATGGGGTGG + Intergenic
902099373 1:13973312-13973334 TCCTAGGGAATAAAGCAGGGTGG - Intergenic
902299814 1:15493856-15493878 TCCTCTGCAAAGGAGAGGGGAGG - Intronic
903129478 1:21269218-21269240 TCCTAGGAAATGGTGAGGCTGGG - Intronic
903145348 1:21368573-21368595 ACCGTGGGAAAGGAGAGGGGAGG - Intergenic
903172452 1:21562744-21562766 TCCTGGAGAAGGGAGAGGGAGGG - Intronic
904406969 1:30297826-30297848 TCCTGGGGCATGGTGAAGGGAGG - Intergenic
904619392 1:31766294-31766316 TCCTGGGGAAGGAGGAGGGGGGG - Intergenic
905240466 1:36577711-36577733 CCCTATGGAAAGGACAGGGGAGG - Intergenic
905291008 1:36921916-36921938 TCCTGGGGAAAGGAGAGAGGTGG - Intronic
905665538 1:39761101-39761123 GCCTGGGGAGTGGAGAGGTGCGG - Intronic
906098032 1:43237280-43237302 TGCTGAGGAATGGAGTGGGGAGG - Intronic
906133318 1:43475669-43475691 TCCTAGGAAAGCGAAAGGGGAGG - Intergenic
906642495 1:47449763-47449785 GCGAAGGGAATGGGGAGGGGCGG + Intergenic
907249097 1:53126172-53126194 TTCTAGGGCCTGCAGAGGGGTGG - Intronic
907689035 1:56644899-56644921 TCCTAGGGAATGGAAAGACTTGG - Intronic
907918213 1:58889985-58890007 TCCCAAGGAATGGAGGGGGCTGG - Intergenic
909089001 1:71202796-71202818 TACTAGGAAAGGGAAAGGGGAGG + Intergenic
909314519 1:74198385-74198407 TCCTGGGCAATGCAGAGGGAGGG + Intronic
909538597 1:76766287-76766309 TAAGATGGAATGGAGAGGGGAGG - Intergenic
909902956 1:81160858-81160880 TGCTGGGGGATGGGGAGGGGTGG - Intergenic
910210119 1:84783650-84783672 TCCCCGGGACTGGAGAGTGGTGG + Intergenic
910231743 1:84994997-84995019 TCTCAGGGAATAGAGAGGGTTGG + Intronic
910530907 1:88234514-88234536 TCGTAGAGGATGGGGAGGGGTGG - Intergenic
911093664 1:94038120-94038142 TCACAGGAAATGCAGAGGGGGGG + Intronic
911465124 1:98241963-98241985 TCCTAGGGATTTGGGATGGGTGG + Intergenic
912665579 1:111576627-111576649 TCCTCTGGAAGGGTGAGGGGAGG + Intronic
913196728 1:116462904-116462926 GCCTTGGGAATGGAGAGGCTGGG - Intergenic
915492477 1:156258870-156258892 GCCTAGGGAGAGGGGAGGGGAGG - Intronic
915646885 1:157278959-157278981 TCATAGCGAATGGAGCGTGGTGG + Intergenic
915668864 1:157470391-157470413 TGCCAGGGAGTGGAGAAGGGAGG - Intergenic
916472471 1:165137621-165137643 AACCAGGGAATGGTGAGGGGTGG + Intergenic
917031360 1:170695845-170695867 TCTCAGAGAATAGAGAGGGGGGG - Intronic
917350838 1:174076090-174076112 TGCTGGGGAATGGAGGGAGGGGG - Intergenic
918092646 1:181310704-181310726 TCCTAGGTAATGGAAAGTGAAGG + Intergenic
918400055 1:184154105-184154127 TCCCAGGGAATGGAGAGATTTGG - Intergenic
919745168 1:201004301-201004323 ACCCAGGGAAGGGACAGGGGAGG - Intronic
919751213 1:201039439-201039461 TCCTGGGGAAGGGACTGGGGAGG + Intergenic
920210961 1:204327833-204327855 TCCTAAGGAAAGGACAGGGCAGG + Intronic
920304530 1:205010077-205010099 TCCCAGAGAATGGGGAGAGGAGG + Intronic
920535479 1:206734055-206734077 TCCAAGGGAAGGGGGAGTGGGGG - Exonic
922070210 1:222184665-222184687 ACCTAGGGAGTGGAGAGTGATGG - Intergenic
923064146 1:230502816-230502838 TACTAGAGAATGGAGGGAGGGGG - Intergenic
1062889098 10:1043694-1043716 TTCTAGAGAGTGGAGAGAGGCGG - Intronic
1066767696 10:38817638-38817660 TCAAAGGGAATGGACAGGAGTGG - Intergenic
1067275374 10:44828838-44828860 TCCTGGAAAATGCAGAGGGGAGG + Intergenic
1068041651 10:51832794-51832816 AGCTATGGAATGGTGAGGGGAGG + Intronic
1069206722 10:65698609-65698631 TCCCAGGGCATGGAGAAGGATGG - Intergenic
1069555359 10:69394207-69394229 TCCTTGAGCATGGAGAGGGCAGG + Intronic
1070973994 10:80590156-80590178 TCCTGGGGAAAGGTAAGGGGAGG + Intronic
1072496707 10:95968368-95968390 GGCTTGGGAATGGGGAGGGGAGG - Intronic
1072867562 10:99079924-99079946 TCCTTGGGAATGGAAAGAGTTGG - Intronic
1073113866 10:101079939-101079961 TGCCAGGGAAGGGAGTGGGGAGG - Intergenic
1074563362 10:114554039-114554061 TTCTGGGAAATGGAGAAGGGTGG + Intronic
1075743597 10:124710897-124710919 TTTTAGGGGATGGAGAGGTGAGG - Intronic
1077325554 11:1962476-1962498 TCCTAGGGCAGGCGGAGGGGTGG - Intronic
1077358163 11:2128118-2128140 TCCAAGGGAAGGGAGAGGGTGGG - Intergenic
1079815270 11:25048650-25048672 TCCTAGAGAAATTAGAGGGGAGG + Intronic
1080593741 11:33748891-33748913 TCCTAGAGAAGGGAATGGGGTGG + Exonic
1080808460 11:35678612-35678634 TCTAAGAGAATGGGGAGGGGAGG - Intronic
1081584534 11:44375418-44375440 GCCTTGGGTATGGAAAGGGGTGG + Intergenic
1081855345 11:46299914-46299936 TGCTAGGGAAGGAAGAGGTGAGG - Exonic
1083271108 11:61573057-61573079 GCCGTGGGCATGGAGAGGGGGGG + Intronic
1083367926 11:62152652-62152674 GCCTGGGGAATGGAGAGGGTAGG - Exonic
1084568364 11:69944353-69944375 GTCTAGGGAATGGAAAGGGCTGG + Intergenic
1084967035 11:72750307-72750329 TCCCAGGGTAGGGGGAGGGGAGG - Intronic
1085333765 11:75674065-75674087 TACTTGGGCATGGAGAGGTGGGG - Intergenic
1085346192 11:75769385-75769407 ACCTGGTGAAGGGAGAGGGGAGG - Intronic
1086177389 11:83907898-83907920 GCCTTGGGAACGGAGAGTGGAGG - Intronic
1086190541 11:84073552-84073574 ACCTAGGGGATGAAGAGGTGGGG + Intronic
1088463681 11:110110588-110110610 TTCTTGAGAATGGAGAAGGGTGG + Intronic
1089184040 11:116602859-116602881 GGCTAGGGAATGGGGAGGGGTGG - Intergenic
1089536133 11:119161724-119161746 TCCTGGGGATTGGAGAGGCCTGG + Exonic
1089740398 11:120578280-120578302 GCCTAGGGAGAGGAAAGGGGAGG + Intronic
1090071594 11:123549037-123549059 TGCTGGGGAAGGGAGAGGAGAGG + Intronic
1090100968 11:123796433-123796455 TACTTGGGCATGGAGAGGTGGGG + Intergenic
1090642225 11:128739546-128739568 TCCTTGGGAATGGAGAGTAGTGG - Intronic
1202808534 11_KI270721v1_random:17655-17677 TCCTAGGGCAGGCGGAGGGGTGG - Intergenic
1091759704 12:3078511-3078533 TCATAAGTAATGGGGAGGGGAGG + Intronic
1093122885 12:15294542-15294564 TGCCAGGGAGTGGGGAGGGGTGG - Intronic
1094337911 12:29381279-29381301 GCTTAGGGAATGAAGAGGCGTGG + Intergenic
1095336502 12:41034445-41034467 ACTTAGGAAATGGAGAAGGGAGG - Intronic
1096222693 12:49842007-49842029 CCCAAGGGAATGGAGAAGGGCGG - Intronic
1096463207 12:51834255-51834277 ACCTCAGGAATGGATAGGGGAGG + Intergenic
1098481190 12:70963546-70963568 TCATAGGCAATGAAGAGGGCAGG - Intergenic
1098711423 12:73767531-73767553 TCCTTGGGTATGGAGAGTTGGGG + Intergenic
1099262484 12:80400598-80400620 GCCTTGGGAAGGGAGAGGAGTGG - Intergenic
1099468479 12:83017146-83017168 TCTTAGGGAATGGACAGCTGAGG + Intronic
1100006509 12:89901463-89901485 TCCCTGGGAAGGGAGAGGGAGGG - Intergenic
1102092417 12:110202948-110202970 TTCTGGGAAATGGTGAGGGGAGG - Intronic
1102657026 12:114490664-114490686 TTCTAGGGACTGGGGAGCGGGGG + Intergenic
1102900247 12:116630967-116630989 TCCCAGGGAGTGGGGATGGGTGG + Intergenic
1103389800 12:120563732-120563754 CCCTTGGGCATGGGGAGGGGTGG + Intronic
1104966872 12:132512263-132512285 TCCTGGGGACTGGTGAGGGAGGG + Intronic
1105898088 13:24734780-24734802 TCCCCAGGAATGGAGAGGGGTGG - Intergenic
1107937385 13:45356581-45356603 ACCTATTGAATGGAGAGAGGTGG + Intergenic
1108439574 13:50436948-50436970 TCCTTGGGGATGGTGGGGGGAGG - Intronic
1110312277 13:74064198-74064220 TTCTTGGTGATGGAGAGGGGTGG - Intronic
1111949802 13:94701652-94701674 TGCTAGGGACAGGGGAGGGGCGG + Intergenic
1112167560 13:96935882-96935904 TCCTAGGAAAGGAAGAGAGGTGG + Intergenic
1112575878 13:100636285-100636307 TCCTAGGGAAAGGGGAAGGGAGG + Intronic
1113561276 13:111283470-111283492 TCCTAGAGAACTGAGAAGGGGGG + Intronic
1113583954 13:111449831-111449853 TGCTGTGGAATAGAGAGGGGAGG - Intergenic
1114655770 14:24314797-24314819 TCCTAGTGAAGGGAGTGGGTAGG + Exonic
1114996997 14:28365811-28365833 TCCTAGGGATTTGAGCAGGGGGG + Intergenic
1115517430 14:34199871-34199893 TCCTGTGGTATGGAGAGCGGAGG + Intronic
1115535231 14:34366667-34366689 TCCCAGGGCAGGGAGTGGGGAGG + Intronic
1115684280 14:35778433-35778455 TCCAAGGGAATAGAGAGGAAAGG - Intronic
1117137179 14:52747520-52747542 TACTAGGGAAAGGATAGGGCAGG + Intronic
1117520072 14:56542530-56542552 TCCTAGGCTATGGATAGGAGTGG - Intronic
1117627098 14:57651365-57651387 TCCTAGGGAGTGAAGTGGGTCGG + Intronic
1118566092 14:67142670-67142692 TAATAGGAAATGGAGGGGGGAGG - Intronic
1119031948 14:71199736-71199758 TCCTAGGGGAGGTAGAGAGGAGG - Intergenic
1119424329 14:74526030-74526052 TCCTAGGCAAAAGAGAAGGGAGG - Intronic
1119759753 14:77141904-77141926 TCAAGGGGAATCGAGAGGGGAGG - Intronic
1119897208 14:78230429-78230451 TCCTAGGTGATGGAGAGGCTGGG + Intergenic
1120050775 14:79862958-79862980 TCCTAGGGAAGAGGAAGGGGAGG + Intronic
1121854729 14:97256799-97256821 TCCTTGGGAAGGGTGGGGGGAGG - Intergenic
1121855557 14:97266257-97266279 TCCTAGGGAAAGAAGAGGCTTGG - Intergenic
1122393984 14:101409719-101409741 TCGTAGGGAAAGAAGAGGGATGG - Intergenic
1122763832 14:104050725-104050747 TCCATGGGCAAGGAGAGGGGCGG + Intronic
1122848284 14:104512798-104512820 GCCAAGGGAATGGTGAGGTGAGG + Intronic
1124207114 15:27730522-27730544 ACCTTGGGAATGGGGAGGGGTGG - Intergenic
1125104036 15:35949845-35949867 TCCTAGGTACTTGGGAGGGGAGG + Intergenic
1126278439 15:46913816-46913838 TTCTAGGGACTGGAGGGGTGTGG + Intergenic
1128263447 15:66249232-66249254 TCTTAAGGAATTGGGAGGGGTGG - Intronic
1128281863 15:66401800-66401822 TCCATGGGAATGGAGGGGCGTGG + Intronic
1128799038 15:70485774-70485796 TACTAGAGACTGGAGAGGAGAGG + Intergenic
1129258409 15:74347860-74347882 TCCCAGGGACTGGAGGGAGGTGG - Intronic
1130407464 15:83614525-83614547 CCTTAGGGGAAGGAGAGGGGAGG + Intronic
1130559260 15:84945576-84945598 GCCTAGGAAGTGGGGAGGGGAGG - Exonic
1131524715 15:93143638-93143660 TCCTACCTAATGGAGAGGGAAGG + Intergenic
1133326095 16:4943308-4943330 TCCTAGAGAATGGAGAGGGGAGG - Intronic
1136288800 16:29259495-29259517 TCCCAGGGAATTGGGAGGCGTGG - Intergenic
1136388249 16:29944084-29944106 GCAAAGGGAATGGAGAGGAGGGG + Intronic
1137670384 16:50275001-50275023 TCCCATGGAATGCAGAGGAGTGG - Intronic
1138319290 16:56098263-56098285 TCCAAGGAAAGGGAGATGGGTGG + Intergenic
1138855004 16:60680350-60680372 TACTAGGGAAAGGAAAGGTGGGG + Intergenic
1139164723 16:64552605-64552627 TCCCAGGGACTGGAGAGAGGGGG - Intergenic
1139334681 16:66223534-66223556 TCCCAGGGGATGGAGGGTGGGGG - Intergenic
1140093638 16:71856838-71856860 TCCTAAGGAGTGGAGAAGGATGG + Exonic
1140840988 16:78838889-78838911 TGCCAGGGACTGGAGAGGAGTGG + Intronic
1141302528 16:82830530-82830552 TGCTTGTGAATGGTGAGGGGTGG + Intronic
1141920939 16:87134928-87134950 TCCTAGAGAATAGAGAGAGGGGG - Intronic
1142094526 16:88232402-88232424 TCCCAGGGAATTGGGAGGCGGGG - Intergenic
1142192030 16:88722495-88722517 TACAAGGGAATGGCGAGGGTCGG + Intronic
1143515691 17:7418227-7418249 TCCAGGGGGAGGGAGAGGGGAGG - Exonic
1144007664 17:11115690-11115712 TCTTATGGAATGGAGAGAGTAGG + Intergenic
1144630380 17:16869042-16869064 CCCTAGGGATGGGAGAGAGGAGG - Intergenic
1149730983 17:58945996-58946018 TTCTAGGGAAGGGAGAGAGATGG - Intronic
1151046214 17:70922617-70922639 TCTTAGGGAAAGCAGAGGAGTGG + Intergenic
1152163663 17:78686540-78686562 TCGTAGAGAATGGTGAGTGGTGG + Intronic
1152459077 17:80431903-80431925 TCCTTGGGGTGGGAGAGGGGTGG + Intronic
1152572204 17:81125798-81125820 GCCTAGGGGGTGGAGTGGGGTGG + Intronic
1152985996 18:321597-321619 TCCTATGAAAGGGTGAGGGGTGG - Intronic
1153261239 18:3226429-3226451 GGCAGGGGAATGGAGAGGGGCGG - Intergenic
1154141823 18:11830959-11830981 TTCTAGGGAATGGGGAGAGGGGG + Intronic
1155180406 18:23340414-23340436 TTTTAGGGAAGGGATAGGGGAGG + Intronic
1156987918 18:43371051-43371073 TCCTTGGGAATAGAGTGGGAAGG + Intergenic
1157094962 18:44679530-44679552 TCCTAGTGAAAGGAAGGGGGAGG - Intergenic
1157847567 18:51017826-51017848 GGCTAGGGAAAGGAAAGGGGAGG + Intronic
1160289248 18:77575375-77575397 ACAGAAGGAATGGAGAGGGGTGG + Intergenic
1160319510 18:77877052-77877074 CCCGAAGGAATGGAGAGGAGCGG - Intergenic
1160624425 18:80193172-80193194 TCCTAGGACCTGGAGTGGGGAGG - Intronic
1160995479 19:1880254-1880276 AGCCAGTGAATGGAGAGGGGAGG + Intronic
1161358690 19:3834093-3834115 GGCAAGGAAATGGAGAGGGGAGG + Intronic
1161471019 19:4456906-4456928 TCCTGGCGAATTGAGAGGGAGGG - Intronic
1162474640 19:10892659-10892681 TCCTAGGTAATGGAGGGAGCTGG - Intronic
1165126705 19:33603166-33603188 TCGAAGGGAATGGTGAGGTGGGG + Intergenic
1165259154 19:34597947-34597969 TCCTGGAGAATGGAGTGAGGGGG + Intronic
1165595977 19:37011536-37011558 ACCTAGGCATTGGAGAGGTGGGG + Intronic
1165776394 19:38406896-38406918 TCCTTGGGCCTGGAGTGGGGAGG - Exonic
1166178062 19:41088655-41088677 TCCTAAGGCAGGGAGATGGGTGG + Intronic
1166401725 19:42486284-42486306 TCCCAGGGGCTGGAGAGAGGAGG - Intergenic
1166929251 19:46291554-46291576 TCCAAGGGAAAGGAAAGAGGAGG + Intergenic
1167138000 19:47629335-47629357 TACTAGGGACTGGGGATGGGGGG - Intronic
1167312842 19:48747109-48747131 TCCTGGGGCAAGGGGAGGGGAGG - Intergenic
1167436281 19:49480555-49480577 TCCTGGGGACTGGGGACGGGGGG - Exonic
1167507491 19:49878477-49878499 TCCTAGGGTAAGGAGGGAGGCGG - Exonic
1168031444 19:53683032-53683054 CCTTTGGGAATGGAGTGGGGCGG + Intergenic
925112235 2:1346347-1346369 TCCTAGGGAGGGTAGAGGGCAGG + Intronic
925851580 2:8087344-8087366 TCCTAGGGAATGGTGAGCTGTGG - Intergenic
925878947 2:8334516-8334538 TCATGGGGAAAGGAGAGGGAGGG + Intergenic
927929568 2:27035502-27035524 TCCCTGGGAATGGTGAGTGGAGG - Intronic
927930356 2:27039847-27039869 TCCCAGGGAGGGGAGAGGAGAGG + Intronic
928361440 2:30665130-30665152 TCCTGGGGGATGGGGTGGGGTGG + Intergenic
928549331 2:32356568-32356590 GCCTTGGGAATGGGGAGGGCAGG + Intergenic
929457809 2:42078366-42078388 TCCTAGGAAATGGTGAGTGGAGG + Intergenic
930346198 2:50184978-50185000 TACTATGTAATGAAGAGGGGAGG - Intronic
930441371 2:51411625-51411647 GCATGGGGAATGGAGAAGGGGGG - Intergenic
930947596 2:57093464-57093486 GCCAAGGGATTGGAGAGGGGTGG + Intergenic
931582951 2:63796887-63796909 TCCTGGGGTTGGGAGAGGGGTGG - Intronic
932215284 2:69962371-69962393 TTCCTGGAAATGGAGAGGGGTGG - Intergenic
932454017 2:71834687-71834709 TCCTGGGGATTGGGCAGGGGCGG + Intergenic
932748392 2:74354484-74354506 TCCCATGGAATGGGGAGGAGGGG + Intronic
933140806 2:78791364-78791386 TCCTAGGGCATGAAGAGCAGGGG + Intergenic
933692967 2:85194033-85194055 GGCTATGGGATGGAGAGGGGTGG + Intronic
933792566 2:85894789-85894811 TACTTGGGTATGGAGAGGTGGGG + Intergenic
933973533 2:87489592-87489614 TGCCAGGGAATGGGGAAGGGAGG - Intergenic
935454717 2:103253950-103253972 TCCTGGGGAAAAGAGAGGGAAGG + Intergenic
936320193 2:111460621-111460643 TGCCAGGGAATGGGGAAGGGAGG + Intergenic
937780889 2:125835976-125835998 TTCTGGGGGATGGGGAGGGGTGG - Intergenic
937905335 2:127050227-127050249 GCCAAGGGAAGGGAGAGGAGAGG + Intronic
938262218 2:129904091-129904113 TCCCATGGAAAGGAGAGGGTGGG - Intergenic
938995273 2:136671827-136671849 TCATGGGGCATGGAGAAGGGAGG + Intergenic
939294167 2:140237173-140237195 TACTAGAGGGTGGAGAGGGGAGG - Intronic
940404314 2:153283577-153283599 TGCTAGGGCATGGAGTGGAGAGG + Intergenic
941452624 2:165677966-165677988 TCTAATGGAATGGAGAGGGAAGG + Intronic
941482154 2:166029370-166029392 GCCTTGGGAATGCAGAGAGGTGG + Intronic
942595846 2:177591283-177591305 TCCCAGGGAAGGGGAAGGGGAGG + Intergenic
942617980 2:177814426-177814448 TCCTAGGCCAGGGAGCGGGGTGG + Intronic
943678569 2:190742981-190743003 TCCTAGGGAAGGAAGAAGGATGG + Intergenic
946155142 2:217802182-217802204 TGCTAGGGAATGAGGAGAGGGGG + Exonic
946475289 2:220000940-220000962 TCCTAGTGGATGGACAAGGGAGG + Intergenic
946942765 2:224786915-224786937 TACCAGTGAATGGAGAGGTGTGG - Intronic
947872811 2:233449184-233449206 TCCTCGGCAATGGTGGGGGGCGG - Exonic
948225495 2:236306408-236306430 TCCTATGGAATGGAGATTGCCGG - Intergenic
948381514 2:237553304-237553326 TCCTCAGGCATGGAGAGGTGGGG + Intronic
948602699 2:239116339-239116361 TCCTAGAGAAGGGAGAGGCTTGG - Intronic
948855247 2:240727304-240727326 ACACAGGGAAGGGAGAGGGGAGG + Intronic
1169452974 20:5728070-5728092 TTCTAGGAAATGCAGTGGGGTGG - Intergenic
1169904366 20:10585986-10586008 TCCTAAGGTATAGAGAGGGTAGG - Intronic
1170855665 20:20052060-20052082 TGCTGGGGAGTGGAGTGGGGTGG - Intronic
1171214021 20:23339131-23339153 TCCTAGGGATGGTAGAGAGGAGG - Intergenic
1171232049 20:23494961-23494983 TCCTGGAGAATGGAGGGCGGGGG - Intronic
1171973880 20:31581575-31581597 TCCCAGGGAAGGGAGTGAGGGGG + Intergenic
1172125502 20:32623023-32623045 TCCTAGGGAAGGGAGAGGTCAGG + Intergenic
1173235302 20:41239691-41239713 TCCTATGGAAGGGACTGGGGAGG + Intronic
1173245648 20:41335708-41335730 TCTTAGAGGATGGGGAGGGGAGG - Intergenic
1173354433 20:42273886-42273908 ACCTAGAGGATGGAGTGGGGAGG - Intronic
1173439948 20:43067304-43067326 TGCCAGGGAATGGGGAGTGGGGG + Intronic
1173694351 20:44995754-44995776 ACCTCTGGAATGGAGAGGGGTGG - Intronic
1174204576 20:48828902-48828924 TCGGAAGGTATGGAGAGGGGAGG + Intergenic
1174575933 20:51537217-51537239 TGAGAGGGAGTGGAGAGGGGAGG + Intronic
1176751022 21:10691282-10691304 TCCTATGGAATGGAGTGGAATGG - Intergenic
1176753250 21:10707130-10707152 TGCTAGGGAATGGAGAGGAATGG - Intergenic
1176756046 21:10726514-10726536 TGCAATGGAATGGAGAGGAGTGG - Intergenic
1177502766 21:21979871-21979893 GCCTAGGGAATGGAGTGGAAAGG + Intergenic
1177727051 21:24983469-24983491 TTCTAGGGGATGGAGTGGGAAGG - Intergenic
1179249763 21:39663127-39663149 TCCTATGGAACCGAGAGGCGTGG - Exonic
1180532656 22:16361909-16361931 TCGAATGGAATGGAGAGGAGTGG + Intergenic
1181833571 22:25583096-25583118 TCCTAGGGAAGAGAGGGGGTAGG + Intronic
1182586476 22:31346642-31346664 ATCTGGGGAATGGGGAGGGGGGG - Intergenic
1183062997 22:35346989-35347011 CCCTGGGGAAAGGAGAGGGCGGG - Intronic
1183099747 22:35576579-35576601 TCCTAAGGAAGGGAGAGGAGAGG + Intergenic
1183300480 22:37056683-37056705 TCTTATGGGATAGAGAGGGGTGG + Intronic
1183367178 22:37412934-37412956 GTCAAGGGAAGGGAGAGGGGAGG - Intronic
1183948732 22:41340920-41340942 CCCTGGGGAGTGGAGAGGAGAGG + Intronic
1184197417 22:42939526-42939548 TCCACTGGAATGGGGAGGGGAGG - Intronic
1185054807 22:48574077-48574099 TCCTAGAGAATGTCTAGGGGTGG + Intronic
1185107756 22:48883975-48883997 TACTTGGGCATGGAGAGGTGGGG - Intergenic
1203298257 22_KI270736v1_random:59066-59088 TGCTATGGAGTGGAGAGGAGTGG + Intergenic
1203316988 22_KI270737v1_random:23887-23909 TCGAATGGAATGGAGAGGAGTGG - Intergenic
949289691 3:2449927-2449949 TGCTAGAGAATGGAGGGAGGAGG + Intronic
949935497 3:9112621-9112643 TCCTGGGGAAGGCGGAGGGGAGG + Intronic
949997325 3:9628502-9628524 TAAAAGGCAATGGAGAGGGGAGG + Intergenic
950694085 3:14684110-14684132 TCCTAGGGTATGCAGGGGTGAGG - Intronic
951464744 3:22989953-22989975 TCCCAGGGAATGAAGATGGAAGG + Intergenic
951470489 3:23051219-23051241 TCCCAAGGAGTGGAGAGGGAGGG + Intergenic
952979045 3:38720602-38720624 TCCCAGGGGAAGGAGATGGGAGG + Intronic
953239849 3:41138932-41138954 TCCAAGGGAGTGGAGGGGAGAGG + Intergenic
953373380 3:42408360-42408382 CCCTGGAGAATGGAGTGGGGAGG - Intronic
954541849 3:51398512-51398534 TCCTAGGAAATGGTGGGGGGTGG + Intronic
954994595 3:54870052-54870074 TCCTAGGTAGTGGTGAGGAGGGG + Intronic
957218762 3:77355117-77355139 TCCTAGGGTATGGGGATGGGAGG - Intronic
957575271 3:81999572-81999594 TCCTCCGGAATGGAGAGAGAGGG + Intergenic
957802734 3:85106181-85106203 GCCAAGGGAATGGAGAGCAGAGG + Intronic
959448350 3:106467714-106467736 TCCTGGGGTTTGGAGAGGGATGG + Intergenic
961202269 3:125054964-125054986 TCATTGGGAAAGGAAAGGGGAGG + Intronic
961241895 3:125418405-125418427 TGCTATGGAAGGGAGAGAGGAGG - Intergenic
961316337 3:126038285-126038307 TTCTAGGGTATGGAGGGTGGTGG - Intronic
961549393 3:127660451-127660473 TCTTGGGCAAGGGAGAGGGGAGG - Exonic
962006123 3:131351771-131351793 TCCCAGAGAAGGGAGTGGGGTGG - Intergenic
962590853 3:136888719-136888741 TCCTAGGACACGGAGAGGGGAGG - Intronic
962863353 3:139425193-139425215 TCCTAGAGAAAGGAGGGGTGGGG + Intergenic
964448172 3:156782671-156782693 TCCTAGTGAAGGAAGAGGGAAGG + Intergenic
964614010 3:158643124-158643146 TACTTGGGCATGGAGAGGTGGGG + Intergenic
964919256 3:161875840-161875862 CCCTAGGGATTGGAGAGAGAAGG + Intergenic
968524556 4:1049400-1049422 TGCTAGGGAGGGGAGAGGAGAGG - Intergenic
969244962 4:5925867-5925889 TCTTAAGGACTGGAGAGGGCTGG + Intronic
969714168 4:8860542-8860564 TCCTGGGGAGTGGGGAGGGAAGG + Intronic
970687611 4:18586555-18586577 TCCCAGGAGATGGAGAGTGGAGG + Intergenic
971324333 4:25631734-25631756 CTCTAGGGACTGGAGAGGTGAGG + Intergenic
972335676 4:38105589-38105611 TCCTGGGGGGTGGAGAGGGAGGG - Intronic
973705657 4:53577514-53577536 TCCAAGGGAGTGGAGATAGGAGG + Intronic
975592917 4:76017920-76017942 GCCAGGGGAAGGGAGAGGGGTGG + Intronic
975681727 4:76884155-76884177 TTCTGGGGAAAGGAGAGAGGAGG - Intergenic
976762906 4:88569332-88569354 ACCTGGGGATGGGAGAGGGGTGG + Intronic
977918780 4:102621636-102621658 CCCCAGGGAATGGACATGGGAGG + Intergenic
977959087 4:103064479-103064501 TACCAGGGACTGGGGAGGGGAGG + Intronic
978476053 4:109131755-109131777 TCCTGGTGAATGGGGAGGTGAGG - Intronic
980463279 4:133146152-133146174 TCCTAGGGGGTGGACGGGGGAGG + Intergenic
981007305 4:139889166-139889188 TCCTAAGAAATGGAAAAGGGTGG - Intronic
981822326 4:148900369-148900391 TCCAAGGAAATGGAGAGTGGGGG - Intergenic
982194709 4:152899301-152899323 TCATAGGGAATAGAAAGAGGAGG - Intronic
982719622 4:158846922-158846944 TCCAGGGGATTGGGGAGGGGTGG - Intronic
986470099 5:8065005-8065027 TCCTGGGGGGTGGGGAGGGGTGG - Intergenic
988354858 5:30161023-30161045 TACTTGGGCATGGAGAGGTGGGG - Intergenic
988858171 5:35249327-35249349 TCTAAGAGAATGGAGAGGGCAGG - Intergenic
991600707 5:68349039-68349061 TTCTGGGGACTGGAGAGTGGTGG - Intergenic
992298436 5:75351586-75351608 TACTTGGGAATGCAGAGGTGAGG + Exonic
992611975 5:78515809-78515831 TCCTTGGTATTGGGGAGGGGAGG + Intronic
992638688 5:78749860-78749882 TCATAGGAAATGGAGGGAGGAGG + Intronic
992858800 5:80891269-80891291 CCCTTGGGCATGGAGAGGTGGGG + Intergenic
994070246 5:95593156-95593178 TCTTTGGGAATGGGGAGGGTAGG - Intronic
995096244 5:108239337-108239359 TGCCAGGGGATGCAGAGGGGTGG - Intronic
995697924 5:114900446-114900468 GCCAGGGGAAGGGAGAGGGGTGG + Intergenic
996403305 5:123085699-123085721 TCCTAGGAAATGGATGGGGGTGG - Intergenic
996905947 5:128600035-128600057 CCCTAGGGAATGTAGAGAGTGGG + Intronic
998250643 5:140549847-140549869 TGCTTTGGAATGGATAGGGGAGG - Intronic
998461977 5:142316508-142316530 CCCCAGGGAATGGGGAGGGAGGG + Intronic
999191244 5:149748995-149749017 TCCTAGGGCCTGGGGAGGAGCGG - Intronic
999614551 5:153408141-153408163 TCATTGGGAATGGAGAGAGATGG + Intergenic
1001716890 5:173823830-173823852 TCCTAAGAAGTGGAGAGGGGAGG + Intergenic
1001776372 5:174331962-174331984 CCCTGTGGAAGGGAGAGGGGAGG + Intergenic
1002160118 5:177310035-177310057 TCCTTGGGACTGTAGAGGGTTGG - Intronic
1004026630 6:11825676-11825698 TGCTAGTGAGTGGAGAGGCGGGG + Intergenic
1004167220 6:13267356-13267378 TTCTAGGAACTCGAGAGGGGAGG + Exonic
1004179316 6:13367297-13367319 TCCTGGGGAATTGTGAGGGGTGG - Intronic
1004326137 6:14675594-14675616 TCCCATGGAAAGGAGAGAGGTGG + Intergenic
1004572647 6:16862899-16862921 TCCAAGGGAAGGCAGAGAGGAGG + Intergenic
1004676545 6:17848408-17848430 TACTAGGGGCTGGAAAGGGGAGG - Intronic
1005752384 6:28895596-28895618 GCCGAGGGAATGGAGAGAAGGGG - Intergenic
1006512525 6:34529303-34529325 TCCCAGGGAGTGGGCAGGGGAGG + Intronic
1007457547 6:41991752-41991774 TACTAGAGGATGGAAAGGGGAGG - Intronic
1008857761 6:56112501-56112523 TGCTGGGGAAGGGGGAGGGGTGG - Intronic
1010522247 6:76852044-76852066 TACCAGAGACTGGAGAGGGGAGG + Intergenic
1012545200 6:100411654-100411676 TGCTGGGGAATGGAGGGGGAGGG + Intronic
1013343482 6:109237529-109237551 TCCTAGGGAAGGAACAGAGGAGG + Intergenic
1013449826 6:110269075-110269097 TCCTAAGGAATGGAGAGGCTTGG - Intronic
1014813792 6:125913044-125913066 TTCCAGGGAATGGAATGGGGTGG - Intronic
1014962853 6:127708025-127708047 CCATAGGGGATGGAGAGGGCAGG + Intergenic
1016334236 6:142987133-142987155 TCCTAGGGAGTGGAGCTGTGGGG - Intergenic
1016448396 6:144156067-144156089 TCCTGAGGAGTGGGGAGGGGAGG - Intronic
1016563129 6:145419185-145419207 TGCTGGGGAAAGGAGCGGGGGGG - Intergenic
1017250227 6:152272315-152272337 GCCTAGGGAATGCAGAGGTTAGG + Intronic
1018328419 6:162700099-162700121 TCATAGGGAAAGGAGAGAGGAGG - Intronic
1019873622 7:3790006-3790028 TCCTCGGGAAGGGGGAGAGGTGG - Intronic
1020149528 7:5670928-5670950 TCCTAGGGAAGGGAGAGGCATGG - Intronic
1020359819 7:7316067-7316089 TCCCTTGGAATGGGGAGGGGAGG + Intergenic
1020521020 7:9187381-9187403 TCCTTGAGAATGGAGAAGGAAGG - Intergenic
1020993616 7:15233492-15233514 TACCAGGGAATGGGGAGAGGTGG + Intronic
1021586715 7:22216390-22216412 TCCTAGGGAATGGAGAGGGGTGG - Intronic
1022334240 7:29407339-29407361 TCCTAGGGGGTGGAGAGGCTTGG + Intronic
1022800238 7:33769940-33769962 TGCTAGGGAATGGCTAGGGATGG + Intergenic
1022958797 7:35405295-35405317 TCCAAAGGAAGGGAGATGGGAGG - Intergenic
1023295194 7:38707760-38707782 TGCCAGGGACTGGAGAGAGGAGG + Intergenic
1023384799 7:39645864-39645886 TCCTAAGGGGTGAAGAGGGGAGG + Intronic
1026302932 7:69114391-69114413 TCCTAGGGGAGAGAGAGGGAGGG - Intergenic
1027572078 7:79882195-79882217 TGCCAGGGAATGGAGAAGGAGGG - Intergenic
1028084418 7:86618735-86618757 TACTAGCGGATGGAGAGTGGGGG - Intergenic
1028110267 7:86932333-86932355 AACTGAGGAATGGAGAGGGGAGG - Intronic
1028440089 7:90849570-90849592 TCTTGGGGATTGGAGAGGGTGGG + Intronic
1029237482 7:99132966-99132988 TCCCAGGGACTGGGGATGGGTGG + Intronic
1030633396 7:111920106-111920128 TACCAGGGATTGGAGAGGGTGGG + Intronic
1032391264 7:131556684-131556706 TCCTGGGGGAGGGGGAGGGGCGG - Intronic
1032538579 7:132684932-132684954 TCCTGGGGAAGGGAGAGGTGTGG + Intronic
1033419312 7:141192355-141192377 ACCTGGGGAAGGGAGAGGTGGGG + Intronic
1034377453 7:150658742-150658764 TCCTTGGTAAAGGAAAGGGGAGG + Intergenic
1034501978 7:151456565-151456587 TCCTAGGGTCTGGAGGGTGGTGG + Intergenic
1034673104 7:152872279-152872301 TCACAGGGAATGGAGTGGGCGGG + Intergenic
1034947589 7:155273335-155273357 TTGTGGGGAATGGACAGGGGTGG + Intergenic
1037004377 8:13759351-13759373 TCATCGGGGATGGGGAGGGGTGG - Intergenic
1037794309 8:21978943-21978965 TCCTAGGGAATAGGGCAGGGTGG + Intronic
1037813871 8:22101955-22101977 ACCTGGGGAAAGGACAGGGGTGG - Intronic
1038103298 8:24404803-24404825 TCATAGGGAATGGATAGGCAAGG + Intronic
1038411400 8:27362273-27362295 GCCCAGGAAGTGGAGAGGGGAGG - Intronic
1038600145 8:28932211-28932233 GCCTAGGGAATGGTGAGTGAAGG + Intronic
1039928146 8:41957993-41958015 CCTTGGGGAATGGAGAGGGAAGG - Intronic
1040603943 8:48911174-48911196 TTCTAAGGAATGGAAAGGGAAGG - Intergenic
1041043141 8:53866717-53866739 ACGTGGGGAATGGAGTGGGGTGG + Intronic
1042125046 8:65529809-65529831 TCCAAGGCAGTGGGGAGGGGTGG - Intergenic
1043878556 8:85515016-85515038 TCCTAGTGAATGATGAAGGGTGG + Intergenic
1043985771 8:86693898-86693920 TTTTGTGGAATGGAGAGGGGGGG - Intronic
1045183392 8:99811255-99811277 TTCTAGGGAATGGGGAAAGGTGG - Intronic
1046208265 8:111033011-111033033 TACTAGGGAAGGGAGGGAGGGGG - Intergenic
1046375679 8:113377008-113377030 TTCTAGGGAGTGGGGTGGGGTGG + Intronic
1046409528 8:113821473-113821495 TACTAGGGACTGCTGAGGGGAGG + Intergenic
1046631010 8:116623247-116623269 TCACAGGGAATGGAGAAAGGGGG - Intergenic
1049182929 8:141232162-141232184 TGCTAGGGACTGGAGGGGGCGGG + Intronic
1050017063 9:1245266-1245288 TCCTTGGGAATAGAGTGGCGAGG + Intergenic
1051068657 9:13135867-13135889 GCCTAGGGAATAGTGAGGGTAGG - Intronic
1051174253 9:14347364-14347386 TCCTAGGGGAGGGAGAGGACGGG + Intronic
1052614943 9:30826077-30826099 TCCTAGAGATTGAAGAGTGGAGG + Intergenic
1054758352 9:68981457-68981479 CCCTAGGGAATGGCGGAGGGTGG + Intronic
1054805285 9:69391579-69391601 TCTTTGGGAAAAGAGAGGGGTGG - Exonic
1055280682 9:74670768-74670790 GCTTAGGGAAGGGAGAGGGAGGG + Intronic
1055908601 9:81321317-81321339 TCCTAGGGCAAGGAGAGAGGAGG - Intergenic
1056583734 9:87914680-87914702 TCCTAGGCGATGGTGAGGGTGGG - Intergenic
1056584226 9:87918149-87918171 TCCTAGGCGATGGTGAGGGTGGG - Intergenic
1056613140 9:88138266-88138288 TCCTAGGCGATGGTGAGGGTGGG + Intergenic
1056764190 9:89434826-89434848 TGTCAGGGAATGTAGAGGGGAGG + Intronic
1056818303 9:89817596-89817618 TGCTTGGGAATGCAGAGGGAGGG + Intergenic
1057226818 9:93296951-93296973 GCCGAGGGGATGCAGAGGGGAGG - Intronic
1057576592 9:96247351-96247373 CCCAAGTGAAAGGAGAGGGGTGG + Intronic
1058827294 9:108786582-108786604 GCTTAGGGAAGGGAGAAGGGAGG + Intergenic
1059400339 9:114065644-114065666 TCCAAGGGAATGGTGAGGGTGGG - Intronic
1059631302 9:116125701-116125723 TCTTAGTGAATGCAGAGGTGGGG - Intergenic
1060304422 9:122398074-122398096 GCCTAGGGTTGGGAGAGGGGTGG - Intergenic
1060358272 9:122931249-122931271 TCACAGGGAAGGGAAAGGGGCGG + Intronic
1061523558 9:131138243-131138265 GCCTAGGTTATGGGGAGGGGAGG - Intronic
1061685409 9:132272652-132272674 TGCCAGGGAATGGAGAGAGGAGG - Intronic
1061771033 9:132921680-132921702 GCCTAGGGATTGGAGTGGCGAGG + Intronic
1061946307 9:133910114-133910136 TTCTAGGCAATAGAGAGGGCTGG - Intronic
1062069552 9:134548184-134548206 GCCAAGGGAAGGGAGAGGGGAGG - Intergenic
1062142385 9:134966798-134966820 TTCTGGGGGATGGAGAGAGGAGG + Intergenic
1062599253 9:137312588-137312610 TCCTTGGGCCTGGAGAGGAGAGG - Intronic
1203719675 Un_GL000216v2:4250-4272 TGGAATGGAATGGAGAGGGGTGG - Intergenic
1185801691 X:3016963-3016985 TGGCAGGGAGTGGAGAGGGGAGG + Intronic
1187305663 X:18093324-18093346 TCCTGGGGAGTGGGGTGGGGAGG + Intergenic
1193802396 X:85952255-85952277 GCCTAGGGTTTGGGGAGGGGTGG - Intronic
1195095864 X:101500475-101500497 ACCTAGAGAATGAAGAGGTGTGG + Intronic
1198296550 X:135292927-135292949 TCACAGGGAATGGAGATGGATGG + Intronic
1198482639 X:137054772-137054794 TCCTAGGAAAGAGAGAGAGGAGG + Intergenic
1200118556 X:153779963-153779985 GACAAGGGAATGGAGAGGCGAGG - Intronic
1200342906 X:155417964-155417986 TGCTGGGGACTGGAGAGTGGGGG + Intergenic
1201123579 Y:10893154-10893176 TCCAATGGAATGGAGTGGAGTGG - Intergenic
1201141415 Y:11031735-11031757 TCGAAGGGAATGGAGTGGAGTGG - Intergenic