ID: 1021586716

View in Genome Browser
Species Human (GRCh38)
Location 7:22216393-22216415
Sequence GATTCCTAGGGAATGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021586716_1021586724 8 Left 1021586716 7:22216393-22216415 CCCCTCTCCATTCCCTAGGAATC 0: 1
1: 0
2: 2
3: 21
4: 282
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586716_1021586725 9 Left 1021586716 7:22216393-22216415 CCCCTCTCCATTCCCTAGGAATC 0: 1
1: 0
2: 2
3: 21
4: 282
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021586716 Original CRISPR GATTCCTAGGGAATGGAGAG GGG (reversed) Intronic
901305807 1:8232010-8232032 CATCACTAAGGAATGGAGAGTGG + Intergenic
902662698 1:17916282-17916304 GATTCATAGGCAAAGGTGAGAGG - Intergenic
903108635 1:21108413-21108435 GATTACTAGACAATGGAGAAAGG + Intronic
903976726 1:27154917-27154939 GATTCCGGGGAAATGGAAAGAGG + Intronic
904883228 1:33716164-33716186 ACTTCCCAGGGACTGGAGAGTGG + Intronic
905182033 1:36173249-36173271 GACTCCAAGGGAAGGGAGTGGGG + Intronic
905291009 1:36921919-36921941 CACTCCTGGGGAAAGGAGAGAGG - Intronic
905761828 1:40565034-40565056 GGTTGCCAGGGACTGGAGAGAGG + Intergenic
905988541 1:42311461-42311483 GAGTCCTAGGGATTCTAGAGAGG + Intronic
906209933 1:44007134-44007156 GCTTCCCAGAGAAGGGAGAGAGG - Intronic
906599567 1:47113370-47113392 GATGCTTGGGGAATTGAGAGGGG - Intronic
909113416 1:71506640-71506662 GTTTCCTATGGAAAGGAGAGGGG + Intronic
910210118 1:84783647-84783669 GGTTCCCCGGGACTGGAGAGTGG + Intergenic
913116945 1:115705897-115705919 GATTCCTAAGAAAAGCAGAGAGG + Intronic
913301963 1:117380847-117380869 GATTCATAAGGAATGGTCAGTGG - Intronic
914329059 1:146649116-146649138 GATTTCAAAGGACTGGAGAGGGG - Intergenic
914422142 1:147539107-147539129 GATTGCTAGGCAATAGAGAAAGG - Intergenic
915492478 1:156258873-156258895 GATGCCTAGGGAGAGGGGAGGGG - Intronic
915613912 1:157019839-157019861 GTTGCCTAGGGAAGGGAGAGGGG + Intronic
916495130 1:165339794-165339816 GAAGCCTAGGGAAGGGTGAGGGG - Intronic
916647201 1:166797638-166797660 TTTTCCTAGGGAATGGGGCGGGG + Intergenic
917350841 1:174076093-174076115 GATTGCTGGGGAATGGAGGGAGG - Intergenic
919394317 1:197025136-197025158 GATTACTAGGGAGGGGAGAAAGG - Intergenic
919432293 1:197510840-197510862 GCTTCCTAGGAGATGGAGGGAGG + Intronic
920281774 1:204848981-204849003 GATTCCTAGGGCTTGGAGGCAGG + Intronic
920340654 1:205273238-205273260 GATTTCTTGGAAAAGGAGAGAGG + Exonic
921101581 1:211933394-211933416 GATCCCTGGGGAAGTGAGAGAGG - Intergenic
923064149 1:230502819-230502841 GACTACTAGAGAATGGAGGGAGG - Intergenic
923177139 1:231477707-231477729 GATTGCCAGGGACTGGGGAGAGG + Intergenic
923319438 1:232816070-232816092 GATTCTGTGGAAATGGAGAGAGG - Intergenic
924945931 1:248846995-248847017 AGCTCCTAAGGAATGGAGAGGGG - Intronic
1062889099 10:1043697-1043719 TATTTCTAGAGAGTGGAGAGAGG - Intronic
1062952064 10:1511484-1511506 GATTCCTGTGGAATGGGGGGTGG + Intronic
1063134321 10:3203004-3203026 GACTCCAAGAGAAAGGAGAGAGG - Intergenic
1063247646 10:4238775-4238797 CCTTCCTGGGGAATGGAGGGAGG - Intergenic
1065508701 10:26456077-26456099 GATTGCTAAGGGATGGGGAGAGG + Intronic
1068077927 10:52280848-52280870 GATTCCTTTGGAATGCAGATAGG - Exonic
1068642114 10:59421506-59421528 GTTTTCCAGGGATTGGAGAGAGG + Intergenic
1071286802 10:84156139-84156161 GATTCCTAGAGGAAGGAGTGGGG + Intergenic
1071550606 10:86563666-86563688 GTTTTTTAGGGAATGGAAAGGGG + Intergenic
1074200634 10:111231782-111231804 GATTCCTAGGGAAGAGTCAGGGG + Intergenic
1075455407 10:122581835-122581857 GAGTCCTAGGGAGGGGTGAGAGG - Intronic
1075457530 10:122594538-122594560 GAGTCCTAGGGAGGGGTGAGAGG - Intronic
1078329645 11:10409052-10409074 GATGCCTGGTGAATGGAGAAGGG - Intronic
1078436917 11:11332924-11332946 GATTCCTAGAGACTGGGGAAGGG + Intronic
1078503130 11:11903793-11903815 GATTCTTATGTAATGGAAAGAGG + Intronic
1078883381 11:15475717-15475739 GATACACAGGGAATGGAGGGTGG + Intergenic
1080239680 11:30112314-30112336 GAGTCCTAGGGCAAAGAGAGGGG - Intergenic
1080249542 11:30217685-30217707 GATTACTAGAGAAAGGAGAATGG - Intergenic
1080596726 11:33779781-33779803 GCCTCCTAGGGCATGGAGAAGGG - Intergenic
1080902402 11:36509072-36509094 GATTACTAGGGAAGGGAGAGGGG - Intronic
1081649239 11:44812601-44812623 GGTTCCTAGAGAATGAATAGTGG + Intronic
1082969519 11:59004982-59005004 GCTTCCTAGAGAATGGAGAATGG - Intronic
1083713920 11:64565070-64565092 GATCCCTAGGGGAAGGGGAGGGG - Intronic
1083968418 11:66057391-66057413 TATTCCTAGGGATAAGAGAGTGG + Intronic
1084008081 11:66333717-66333739 GGTTGCTAGGGCATGGGGAGGGG - Intronic
1084233336 11:67769251-67769273 GCTACCTGGGGAATGCAGAGAGG + Intergenic
1086177390 11:83907901-83907923 GGTGCCTTGGGAACGGAGAGTGG - Intronic
1089403857 11:118181376-118181398 GATTCCTTGGGACTGGGGTGGGG - Intergenic
1092994271 12:13933558-13933580 GCATCCTAGGGAATGGCTAGTGG - Intronic
1093030561 12:14284735-14284757 GCTTCCTGGGGATGGGAGAGAGG + Intergenic
1093637471 12:21488587-21488609 GAACTCTTGGGAATGGAGAGGGG - Intronic
1096483706 12:51961193-51961215 AATTCTTTGGGCATGGAGAGTGG - Intronic
1096635407 12:52955494-52955516 TACTTCTAGGGAGTGGAGAGGGG - Intergenic
1096772698 12:53946123-53946145 TCTTCCAAGGGGATGGAGAGTGG + Exonic
1096812441 12:54180084-54180106 GATCCCCAGGGAGGGGAGAGGGG - Intronic
1100010870 12:89951716-89951738 GATGGATAGGGAAAGGAGAGAGG + Intergenic
1100297025 12:93272632-93272654 GATTGCCAGGGACTGGGGAGAGG + Intergenic
1102044783 12:109822975-109822997 GACTCCTAGAGAAGGCAGAGCGG + Intronic
1103728035 12:123008560-123008582 GAGCCCTGGGTAATGGAGAGAGG + Intronic
1103958088 12:124590307-124590329 GATTGCTGGGGGCTGGAGAGGGG - Intergenic
1104722488 12:131052614-131052636 TAGACCTAGGGAATGGGGAGTGG + Intronic
1105347779 13:19589624-19589646 GATTCTTAGTGAATGGAATGAGG + Intergenic
1105382135 13:19897132-19897154 GATTGCTAGGGATTGGGGATAGG + Intergenic
1105727295 13:23177201-23177223 GATTACCAGAGAATGGGGAGGGG + Intergenic
1107396166 13:40020109-40020131 GTTCCCTAGGGCATGGGGAGCGG - Intergenic
1107480146 13:40779419-40779441 GATTCTTAGTGAATGGAATGAGG + Intergenic
1107835686 13:44410831-44410853 GAACCCTAGGGAATGGAGAGCGG + Intergenic
1108029304 13:46212065-46212087 GATTCCGAGGAAAAGGAGATAGG + Intronic
1109620753 13:64901375-64901397 CATCCCTAGGGACAGGAGAGGGG + Intergenic
1110587803 13:77215238-77215260 GATTCCTTTGGAATAGAGTGGGG - Intronic
1113001873 13:105648519-105648541 GGTTCCCAGGGAATGTAAAGAGG + Intergenic
1113152788 13:107283205-107283227 TATTCCTTGGGAATAGGGAGAGG + Intronic
1115517429 14:34199868-34199890 GATTCCTGTGGTATGGAGAGCGG + Intronic
1115710453 14:36044865-36044887 TATTCCTAGGCATGGGAGAGTGG - Intergenic
1116133167 14:40886483-40886505 GATTCCTCGTGAATGGATTGTGG + Intergenic
1121114317 14:91332722-91332744 GACTCCTTGGGATTGGAGACAGG - Intronic
1121983694 14:98478006-98478028 GATTCCTTGGGAATTGGTAGGGG - Intergenic
1122215422 14:100200468-100200490 GCTTCCCAGGGGATGGGGAGTGG - Intergenic
1124878172 15:33615894-33615916 TATTCCTAAGGAGTGGAGTGGGG - Intronic
1125908381 15:43414643-43414665 GAATGCTAGGGACTGGAAAGGGG + Intronic
1126243054 15:46467500-46467522 GAATCATAGGGAAAGAAGAGAGG + Intergenic
1126534540 15:49747040-49747062 GACTCCTTGAGAAAGGAGAGAGG + Intergenic
1127688919 15:61375813-61375835 GATTCCTATCCCATGGAGAGGGG - Intergenic
1129297649 15:74608739-74608761 GATACCTGGGGAAGGGAGACTGG + Intronic
1132591279 16:727413-727435 CCTTCCTAGGGTGTGGAGAGCGG + Exonic
1133326096 16:4943311-4943333 AGCTCCTAGAGAATGGAGAGGGG - Intronic
1135025228 16:18994561-18994583 GCTTCTTAAGGAATGGAAAGGGG + Intronic
1137558608 16:49489004-49489026 GATGCCTTGGGTAAGGAGAGAGG - Exonic
1139164726 16:64552608-64552630 GGCTCCCAGGGACTGGAGAGAGG - Intergenic
1139210713 16:65073903-65073925 GATGCTTGGAGAATGGAGAGGGG + Intronic
1139334684 16:66223537-66223559 GCTTCCCAGGGGATGGAGGGTGG - Intergenic
1140004506 16:71061823-71061845 GATTTCAAAGGACTGGAGAGGGG + Intronic
1140286762 16:73610226-73610248 GATTAATGGGAAATGGAGAGCGG + Intergenic
1141359773 16:83384648-83384670 GGATCCGAGGGTATGGAGAGGGG + Intronic
1141920942 16:87134931-87134953 GTGTCCTAGAGAATAGAGAGAGG - Intronic
1141986171 16:87581772-87581794 GATTCCTTGAGAATAGAAAGGGG + Intergenic
1143407888 17:6690219-6690241 GGATCCTGGGGAGTGGAGAGAGG - Intronic
1144572223 17:16407350-16407372 GATTCGTGGGGAAGCGAGAGGGG + Intergenic
1146593552 17:34150218-34150240 GATTACTGGGGACTGGGGAGTGG + Intronic
1146787638 17:35732798-35732820 GAGTCCTAGGGGAGGAAGAGAGG - Intronic
1147980306 17:44269953-44269975 GACTCCTAGGGCAGGCAGAGGGG - Intergenic
1148085631 17:44992129-44992151 GATGCCTAGAGAAGGGGGAGTGG + Intergenic
1149244915 17:54694572-54694594 AATTACTATGGACTGGAGAGAGG + Intergenic
1150251091 17:63704858-63704880 GATGCCTTGGAAAGGGAGAGCGG - Intronic
1151407825 17:73900908-73900930 CATTCCTGGAGACTGGAGAGGGG - Intergenic
1203197426 17_KI270729v1_random:245006-245028 GATTCGAATGGAATGGACAGAGG + Intergenic
1203207031 17_KI270730v1_random:45777-45799 GATTCGAATGGAATGGACAGAGG + Intergenic
1154141820 18:11830956-11830978 GGTTTCTAGGGAATGGGGAGAGG + Intronic
1156508617 18:37616182-37616204 GAATCCAAGGGAATGGACATTGG - Intergenic
1157196479 18:45624115-45624137 TGTTCCTAGGGAAGGGAAAGAGG + Intronic
1158193709 18:54860461-54860483 GTTTGATAGGGAAAGGAGAGAGG - Intronic
1158434596 18:57427519-57427541 GGGTCCTAGGGCAGGGAGAGGGG + Intergenic
1159803966 18:72932351-72932373 GGTTCTGAGGCAATGGAGAGGGG - Intergenic
1161672990 19:5624439-5624461 GATCCCTAGGAAAAGCAGAGAGG + Intronic
1162972252 19:14187752-14187774 GTTACCTTGGGAATGGGGAGTGG + Intronic
1165259151 19:34597944-34597966 GAGTCCTGGAGAATGGAGTGAGG + Intronic
1166401726 19:42486287-42486309 GGTTCCCAGGGGCTGGAGAGAGG - Intergenic
1167740195 19:51320156-51320178 GATTTAAAGAGAATGGAGAGAGG - Intronic
1168202360 19:54825380-54825402 AATTCCTGGGGACTTGAGAGAGG + Intronic
925601889 2:5616676-5616698 GAATCCAAGGGAGGGGAGAGAGG + Intergenic
928100671 2:28435727-28435749 GGTCCCTAGGGCCTGGAGAGAGG + Intergenic
929453257 2:42049980-42050002 CACTCCTAAGGAAAGGAGAGAGG - Intronic
929457808 2:42078363-42078385 GAGTCCTAGGAAATGGTGAGTGG + Intergenic
930288955 2:49468828-49468850 CACTGCTAGGGAATGGAGAGGGG + Intergenic
932553929 2:72801726-72801748 GATAGGTATGGAATGGAGAGAGG - Intronic
934018612 2:87918980-87919002 AATTACTAGGGAAAAGAGAGAGG + Intergenic
934136055 2:88997483-88997505 GATGCCCAGGAAATGGATAGTGG + Intergenic
934234264 2:90216289-90216311 GATGCCCAGGAAATGGATAGTGG - Intergenic
937477961 2:122231676-122231698 GTTTCCAAGGGAAGGGAAAGCGG + Intergenic
939715087 2:145573897-145573919 TATTTCAAGGGAATGAAGAGTGG - Intergenic
939974728 2:148704340-148704362 GGTTGCTAGGGACTGGGGAGAGG + Intronic
940237057 2:151522977-151522999 GAATCCTATGGTATGGAGAATGG - Intronic
941182635 2:162278856-162278878 GATTCCTGGGGCATGGTGACTGG + Intronic
941211250 2:162642790-162642812 TATTCCTGTAGAATGGAGAGTGG + Intronic
941307451 2:163888882-163888904 GTTTCATAAGGAATGGAGTGCGG + Intergenic
942203233 2:173592981-173593003 AATTTCTAGGCAATGCAGAGTGG - Intergenic
942473658 2:176290985-176291007 GAGTCATAGGAAATGGAAAGGGG - Intronic
942605486 2:177686055-177686077 TATTCCTAGGGAACAGTGAGAGG + Intronic
942617979 2:177814423-177814445 GATTCCTAGGCCAGGGAGCGGGG + Intronic
943409030 2:187522385-187522407 GGTTGCTAGGGCCTGGAGAGTGG + Intronic
944146128 2:196509429-196509451 GACTTCCAGGGAAAGGAGAGGGG - Intronic
944888562 2:204091550-204091572 GATTTCCAGGGGCTGGAGAGTGG - Intergenic
945678929 2:212889520-212889542 GATTACTGGGGAAGTGAGAGAGG - Intergenic
946155139 2:217802179-217802201 GTTTGCTAGGGAATGAGGAGAGG + Exonic
946249788 2:218405197-218405219 GATTTTTAGGGGAAGGAGAGAGG + Exonic
946947126 2:224832775-224832797 GAGTGCTAAGGGATGGAGAGGGG - Intronic
947393048 2:229659344-229659366 GCTTGCTAGTGAATGGAGTGGGG - Intronic
947958941 2:234218436-234218458 GATTCCTAGGGAGTGGCAAAGGG + Intergenic
948285155 2:236778529-236778551 GGTTACTAGGGGAGGGAGAGGGG - Intergenic
1169939078 20:10917609-10917631 GGTTGCCAGGGACTGGAGAGAGG + Intergenic
1172337275 20:34127790-34127812 GATTAATAGAGAATGGAGAATGG - Intergenic
1173333208 20:42092819-42092841 GATTCCCATGGAAGTGAGAGAGG - Intronic
1173439945 20:43067301-43067323 GGTTGCCAGGGAATGGGGAGTGG + Intronic
1174552900 20:51374452-51374474 GATCCCTATGGAATGGAGGCAGG - Intergenic
1175150900 20:56933215-56933237 GATTGCTAGACAATTGAGAGCGG - Intergenic
1178757666 21:35367789-35367811 GAGTCCTCTGGAAAGGAGAGAGG + Intronic
1180925489 22:19551035-19551057 GATACCTAGGGCATGGGGTGGGG - Intergenic
1182080115 22:27522733-27522755 GATTTCTAGGGGAAGGTGAGTGG + Intergenic
1183660450 22:39217213-39217235 GATTCCTAGGGAATTGTGAATGG - Intergenic
1183704715 22:39469539-39469561 GAGTCCTAGGCAGTGGGGAGCGG - Intronic
1183716956 22:39538714-39538736 GATACCTAGAAAATGGGGAGGGG + Intergenic
1184484132 22:44765929-44765951 GCTTGCTAGGGCCTGGAGAGGGG - Intronic
1184712383 22:46259974-46259996 GATCCAGAGTGAATGGAGAGAGG - Exonic
949924651 3:9031541-9031563 GAGTTCTGGGGAAGGGAGAGTGG - Intronic
950271717 3:11621335-11621357 GGTTGCTAGGCATTGGAGAGAGG - Intronic
952849434 3:37715431-37715453 GATTCCTAGGGGATGGAACTGGG - Intronic
953022812 3:39126707-39126729 GCTTACTAGGGAATGGAGGCTGG - Intronic
954468692 3:50674198-50674220 GATTCTTAGGGAGGAGAGAGAGG + Intergenic
956331293 3:68112544-68112566 GACTCTAAGGGAATGGGGAGGGG - Intronic
956358708 3:68422318-68422340 TATTCCTAGGGAACTGAGATTGG - Intronic
959249307 3:103920909-103920931 GATTACTAGGGTGGGGAGAGAGG + Intergenic
960085989 3:113592120-113592142 GTTTTCTAGGGGATGGGGAGTGG + Intronic
960296621 3:115952558-115952580 GATTCAGGGGGAATGGTGAGAGG + Intronic
960648363 3:119916121-119916143 GATTCCAAAGGAATGGATATAGG + Exonic
961752979 3:129108131-129108153 GATTCCTAGGGAAGTGAGATGGG - Intronic
962340357 3:134577071-134577093 GATTCCCAGGAAAGGGAGTGGGG + Intergenic
962590854 3:136888722-136888744 GTTTCCTAGGACACGGAGAGGGG - Intronic
963771575 3:149391402-149391424 GCTTCCTATGGAATGCAGACAGG + Intergenic
963960316 3:151302716-151302738 GATTCCCAAGGTAGGGAGAGAGG - Intronic
964172099 3:153783048-153783070 GATTATTAGGGACTGGAGAAGGG + Intergenic
964775693 3:160274223-160274245 GGATCCTAAGGAATGTAGAGTGG + Intronic
965011381 3:163096625-163096647 GGTTCCTAGGGATTTGAGGGAGG - Intergenic
965674224 3:171177864-171177886 GTTGCCTAGGGACAGGAGAGTGG - Intronic
966279680 3:178212443-178212465 GATGTGTAGGGAAGGGAGAGGGG - Intergenic
966636141 3:182135955-182135977 GATTCTCTGGGAAGGGAGAGAGG - Intergenic
967186202 3:186946802-186946824 GGTTCCTGGGGAGTGAAGAGTGG + Intronic
967756225 3:193172611-193172633 GATTGCCAGGGTCTGGAGAGAGG + Intergenic
967956591 3:194881900-194881922 GGTTCCAAGGGAATGCAGGGAGG - Intergenic
969352244 4:6604472-6604494 GATTCCTGGGGGATGGGGAAGGG + Intronic
969932455 4:10644042-10644064 GATACCTAGTGAAGGGAGAAAGG + Intronic
971516016 4:27487336-27487358 GAGTCCTAGAAAAGGGAGAGAGG + Intergenic
971884874 4:32431399-32431421 GATTTCTAGGGGATGCAGAGAGG + Intergenic
972110157 4:35547873-35547895 GACTACTAGGGTAGGGAGAGAGG + Intergenic
973317425 4:48776958-48776980 GATTCTTAGGAAAAGGACAGTGG - Intronic
974039448 4:56845231-56845253 AATGCCGAGGGGATGGAGAGGGG - Intergenic
975049177 4:69838684-69838706 CATGCCTGGGGAATGGAAAGTGG + Intronic
975226112 4:71874627-71874649 GGTTAGTTGGGAATGGAGAGAGG - Intergenic
975684115 4:76902769-76902791 GATTCCCTGGGACAGGAGAGAGG + Intergenic
975780158 4:77830622-77830644 GATTCTTAGGGTATGTGGAGAGG + Intergenic
976962714 4:90998884-90998906 GACTACTAGGGCATGGAGGGAGG - Intronic
977959086 4:103064476-103064498 GATTACCAGGGACTGGGGAGGGG + Intronic
981093649 4:140757084-140757106 AATTACAATGGAATGGAGAGGGG - Intergenic
981822329 4:148900372-148900394 GCATCCAAGGAAATGGAGAGTGG - Intergenic
985360125 4:189166042-189166064 AACTACTAGGGAATGGTGAGTGG + Intergenic
986314135 5:6574862-6574884 GATGCCTCGGGACAGGAGAGGGG - Intergenic
990635669 5:57723582-57723604 AATTACTAGGGAAAGGGGAGTGG + Intergenic
990837663 5:60040740-60040762 AATACTTAGGGAATGGACAGAGG - Intronic
991357403 5:65783128-65783150 GGTTACCAGGGAATGGGGAGAGG + Intronic
991982578 5:72248590-72248612 GAGTCATAGGGGAAGGAGAGAGG + Intronic
992349504 5:75914542-75914564 GTTACAGAGGGAATGGAGAGTGG + Intergenic
994078645 5:95681623-95681645 TATTGCTTGGGACTGGAGAGAGG - Intronic
995517669 5:112970039-112970061 CATTTCCAGGGAATGGAGTGTGG + Intergenic
996783429 5:127213242-127213264 GACTACTAGAGAATGGAGAGAGG - Intergenic
997580112 5:135011819-135011841 CAGACCTAGGGAATGGGGAGAGG + Intergenic
997678450 5:135732512-135732534 GATGTGTAGGGAATGGAGGGAGG + Intergenic
997759404 5:136430708-136430730 GATCCCTAGGAAATGAAGATTGG + Intergenic
998646306 5:144066108-144066130 GATCCCTAGGGTGTGGAGAGGGG + Intergenic
998811512 5:145971311-145971333 GATCCAGAGGGAAGGGAGAGAGG - Intronic
1002887191 6:1308252-1308274 GGGTCCTGGGGAGTGGAGAGAGG - Intergenic
1003463656 6:6355883-6355905 GACTCGTAGGGAAGGGAGAAAGG + Intergenic
1004326136 6:14675591-14675613 CATTCCCATGGAAAGGAGAGAGG + Intergenic
1006184788 6:32175686-32175708 GGTTGCTGGGGAAAGGAGAGGGG - Intronic
1007125856 6:39425050-39425072 GATCCCTAGTGAATGGTGTGTGG - Intronic
1010166633 6:72922568-72922590 GGTTACTAGGGACTGGTGAGAGG - Intronic
1010522246 6:76852041-76852063 GATTACCAGAGACTGGAGAGGGG + Intergenic
1012411145 6:98958616-98958638 ATTTCCTTGGGAATGGAGAGAGG + Intergenic
1012768760 6:103402234-103402256 GACTACTAGAGAAGGGAGAGAGG - Intergenic
1013233345 6:108175952-108175974 GATTGCTAGGGAATGGAACGAGG - Intronic
1013643588 6:112112622-112112644 GAGGACTGGGGAATGGAGAGGGG + Intronic
1013698047 6:112727831-112727853 TATTCCTAGGAAATGGATGGTGG + Intergenic
1014269224 6:119317397-119317419 AATTACTGGGGATTGGAGAGAGG - Intronic
1015147304 6:130001371-130001393 TATTGCTTGGGAATGGAGATGGG + Intergenic
1017511947 6:155122337-155122359 GATTGGGAGGGAATGGAGAATGG + Intronic
1017511967 6:155122415-155122437 GATTAGGAGGGAATGGAGAATGG + Intronic
1017511988 6:155122493-155122515 GATTGGGAGGGAATGGAGAATGG + Intronic
1018328420 6:162700102-162700124 TCTTCATAGGGAAAGGAGAGAGG - Intronic
1018366350 6:163123661-163123683 GGTTACTAGCGGATGGAGAGGGG - Intronic
1018639358 6:165892325-165892347 GAGTGCTGGGGAATGAAGAGGGG - Intronic
1021586716 7:22216393-22216415 GATTCCTAGGGAATGGAGAGGGG - Intronic
1022198060 7:28088667-28088689 CAGTCCTTGGGAATGGAGACAGG - Intronic
1022406998 7:30099726-30099748 GAATTCTGGGAAATGGAGAGTGG + Intronic
1022573412 7:31474998-31475020 CATTCCTGGGGACTTGAGAGTGG + Intergenic
1023295193 7:38707757-38707779 GGTTGCCAGGGACTGGAGAGAGG + Intergenic
1026329134 7:69336897-69336919 AATTCCCAGGGAATGCAGTGGGG - Intergenic
1027261504 7:76468053-76468075 GATCCGGGGGGAATGGAGAGAGG + Intronic
1027797326 7:82711613-82711635 GTTCCCTAGGGAATTGGGAGTGG + Intergenic
1028084421 7:86618738-86618760 GGTTACTAGCGGATGGAGAGTGG - Intergenic
1028233267 7:88330411-88330433 GGTGCCTGGGGAGTGGAGAGAGG - Intergenic
1028432068 7:90759108-90759130 GTTTCAAAGGGAATGAAGAGAGG + Intronic
1028540223 7:91934961-91934983 AAATCCTAGGGAATGAAGACAGG + Intergenic
1031069704 7:117148897-117148919 GATTTCTAGGGTAAGCAGAGAGG + Intronic
1032833671 7:135653534-135653556 GTTACCTGGGGCATGGAGAGAGG + Intergenic
1035643445 8:1200796-1200818 GACTCTGAGAGAATGGAGAGTGG + Intergenic
1036071952 8:5450533-5450555 TATGCTTAGGGAATGGAGAATGG - Intergenic
1036134517 8:6148015-6148037 GTGTCCTTGGGAAAGGAGAGGGG + Intergenic
1036572071 8:9989150-9989172 GGTTGCTAGGGGCTGGAGAGAGG + Intergenic
1040855318 8:51942968-51942990 GATTCGCAGTGAGTGGAGAGGGG - Intergenic
1044757804 8:95483913-95483935 GGTTTCTAGGGAAGGGAGATGGG - Intergenic
1046208268 8:111033014-111033036 GACTACTAGGGAAGGGAGGGAGG - Intergenic
1046587756 8:116168421-116168443 GCTTCTTAGCAAATGGAGAGGGG + Intergenic
1046702017 8:117411960-117411982 GACCCCTAGAGAGTGGAGAGAGG + Intergenic
1047494795 8:125401910-125401932 GATTCCCAGGTAGAGGAGAGGGG - Intergenic
1048830384 8:138471099-138471121 GATTCCTAGAGAAAGGTGAGAGG + Intronic
1048830403 8:138471263-138471285 GGTTCCTAGGGAAAGGTGAGAGG + Intronic
1051189355 9:14494810-14494832 GAGACCTAGGCAATTGAGAGTGG - Intergenic
1051739460 9:20237491-20237513 GATTGCTAGGGAAAGAAGAAAGG + Intergenic
1053283640 9:36837081-36837103 GATTTCTAGGGAATGGGGGTGGG + Exonic
1055908602 9:81321320-81321342 AGTTCCTAGGGCAAGGAGAGAGG - Intergenic
1057758859 9:97857048-97857070 GATTCTTAGGGAGAGGAGGGCGG - Intergenic
1058566471 9:106290471-106290493 GATTTCCAGGGACTGGAGACAGG + Intergenic
1058884598 9:109313733-109313755 GAGTCCCAGGAAATGTAGAGAGG + Intronic
1058990856 9:110254888-110254910 CATTCCTGGGGAAGGGAGTGGGG - Intronic
1059958396 9:119541992-119542014 GTTTCCTTGGGATTGGAGATGGG + Intergenic
1060017096 9:120096312-120096334 GATTCTCAGGGAATAGAGAATGG - Intergenic
1060025945 9:120171653-120171675 GCTTCCAAGAGAAAGGAGAGAGG - Intergenic
1061380927 9:130256843-130256865 GGTTGCTAGGGGATGGAGATAGG - Intergenic
1061536258 9:131252191-131252213 GTTTCCTAGGACATGGAGTGGGG - Intergenic
1061622678 9:131821889-131821911 GGTTGCTAGGGGATGGGGAGGGG + Intergenic
1061685410 9:132272655-132272677 GGTTGCCAGGGAATGGAGAGAGG - Intronic
1061960393 9:133985602-133985624 GGTTCCTTGGTAGTGGAGAGGGG - Intronic
1186259488 X:7761546-7761568 GTTTCTGAGGGAATGGAGAGGGG + Intergenic
1190870875 X:54423648-54423670 AATCCCTAGGGAATGGAAAGAGG - Intergenic
1190888418 X:54548947-54548969 GATTGGTGGGGAATGGAAAGAGG + Intronic
1191816640 X:65253189-65253211 GAGTCATTGAGAATGGAGAGAGG + Intergenic
1191975264 X:66864442-66864464 GAATCCTGGGGAATTGGGAGGGG - Intergenic
1192359453 X:70429848-70429870 GATTCCAAGGGCAGGGACAGGGG - Intronic
1192780999 X:74293633-74293655 GACTCCTAGAGGCTGGAGAGCGG - Intergenic
1194376287 X:93137491-93137513 GATCCTTGGGGAATGGACAGAGG + Intergenic
1195513633 X:105746138-105746160 GAAGCCAAGGGACTGGAGAGAGG - Intronic
1195867687 X:109451015-109451037 GATTGGTAGGGAATGGAGTGAGG - Intronic
1196207038 X:112952396-112952418 GTTTCATAGGGATTGGTGAGGGG - Intergenic
1197419008 X:126214300-126214322 GGTTGCCAGGGAATGGAGTGAGG - Intergenic
1197731878 X:129817639-129817661 GATTGCTAGGGGATGGGGAAGGG - Intronic
1199125919 X:144120158-144120180 AATTACTAGGGAAAAGAGAGAGG - Intergenic
1200342903 X:155417961-155417983 GTTTGCTGGGGACTGGAGAGTGG + Intergenic