ID: 1021586717

View in Genome Browser
Species Human (GRCh38)
Location 7:22216394-22216416
Sequence TGATTCCTAGGGAATGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021586717_1021586725 8 Left 1021586717 7:22216394-22216416 CCCTCTCCATTCCCTAGGAATCA 0: 1
1: 0
2: 2
3: 18
4: 267
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586717_1021586724 7 Left 1021586717 7:22216394-22216416 CCCTCTCCATTCCCTAGGAATCA 0: 1
1: 0
2: 2
3: 18
4: 267
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021586717 Original CRISPR TGATTCCTAGGGAATGGAGA GGG (reversed) Intronic
902970019 1:20041522-20041544 TGATGTCTAGGGAAGGGAGGGGG + Intronic
904161154 1:28522937-28522959 TCTTTCCTAGGGAAAGGAGGAGG + Intronic
905561805 1:38933260-38933282 TGAGTTGTAGGGAAGGGAGAGGG - Intronic
909113415 1:71506639-71506661 AGTTTCCTATGGAAAGGAGAGGG + Intronic
909224444 1:72999420-72999442 TGAGTACTAGGGAATGGTCAAGG - Intergenic
910658777 1:89647362-89647384 AGATGCCCAGGGAATTGAGAAGG + Intronic
911808724 1:102245596-102245618 TGATTCCTAGGGGCTGGATGGGG - Intergenic
913422609 1:118688829-118688851 TGATACTTAGGGAATGGTAAGGG + Intergenic
914266288 1:146040915-146040937 TGATCCTTAGGGAAAGGAGGTGG - Intergenic
914329060 1:146649117-146649139 TGATTTCAAAGGACTGGAGAGGG - Intergenic
914414834 1:147469764-147469786 TGACTCATGGAGAATGGAGAAGG - Intergenic
915470188 1:156121350-156121372 TGATTCAAAGGGAAAGAAGAAGG + Intronic
915613911 1:157019838-157019860 AGTTGCCTAGGGAAGGGAGAGGG + Intronic
916647200 1:166797637-166797659 TTTTTCCTAGGGAATGGGGCGGG + Intergenic
917302876 1:173595946-173595968 TGGTTGCTAGGGAATGGTGTTGG - Intronic
917786855 1:178468376-178468398 TGATACCTAGAGAAGGGAGGAGG - Intronic
918764036 1:188455582-188455604 TTATTCCAGGTGAATGGAGATGG - Intergenic
920061158 1:203227932-203227954 TGATGCCCAGGGAATGGGGTGGG + Intronic
920969972 1:210734753-210734775 GGCTTCCTAGGGCCTGGAGAGGG + Intronic
921271404 1:213473615-213473637 TGATTTATAGGGAAGGGAGTAGG + Intergenic
921351736 1:214242973-214242995 TGATTCCTCGGGTCTGGAGTAGG + Intergenic
922182221 1:223244300-223244322 TGCTTCCTCTGCAATGGAGATGG + Intronic
922447850 1:225712599-225712621 TGGTTGCTAGGGGATGGGGATGG - Intergenic
924848551 1:247799280-247799302 TGATTCCCAGGGACTGGAAGAGG + Intergenic
1063107398 10:3004349-3004371 TGATTGCCAGGGACTGGGGAGGG - Intergenic
1063184971 10:3642408-3642430 TGAATCATATGGAACGGAGAAGG - Intergenic
1067131519 10:43569564-43569586 TGAATCATGAGGAATGGAGAGGG - Intronic
1068381515 10:56259557-56259579 TGATTGCAAAGGACTGGAGAAGG + Intergenic
1069206723 10:65698613-65698635 GGTTTCCCAGGGCATGGAGAAGG - Intergenic
1069813840 10:71181015-71181037 TGATTCCTTGGGATTGGCTAAGG + Intergenic
1070278028 10:75026446-75026468 TGGTTCCCAGGGAAATGAGATGG - Intronic
1070756075 10:78994011-78994033 TGATTTCTGTGGGATGGAGAGGG + Intergenic
1070789128 10:79179312-79179334 GGATCCCTAGGGACTGCAGAAGG + Intronic
1071550605 10:86563665-86563687 TGTTTTTTAGGGAATGGAAAGGG + Intergenic
1073175286 10:101552537-101552559 TGAAGCCTTGGGAATAGAGAAGG - Intronic
1075054925 10:119210224-119210246 TGATGCCTTGGAAATGGAGAGGG + Intronic
1075540347 10:123307530-123307552 TGTCTGCTAGGGACTGGAGAAGG + Intergenic
1077782447 11:5346227-5346249 GGAATTCTTGGGAATGGAGAAGG - Intronic
1078056841 11:8016024-8016046 TGATGCTTAGGGAATGCAGAAGG - Intergenic
1078329646 11:10409053-10409075 AGATGCCTGGTGAATGGAGAAGG - Intronic
1078436916 11:11332923-11332945 AGATTCCTAGAGACTGGGGAAGG + Intronic
1079768803 11:24432030-24432052 TGATTTCCAGGGGAAGGAGATGG + Intergenic
1079994277 11:27279229-27279251 TGATTCAAAGGGACTGGAGTGGG + Intergenic
1080258457 11:30320335-30320357 TGATACCTATGGAATGTATAGGG - Intergenic
1080596727 11:33779782-33779804 AGCCTCCTAGGGCATGGAGAAGG - Intergenic
1080902403 11:36509073-36509095 TGATTACTAGGGAAGGGAGAGGG - Intronic
1081645032 11:44784222-44784244 TAGCTTCTAGGGAATGGAGAGGG + Intronic
1081953122 11:47063490-47063512 TGGTTTCTAGGGACTGGAGGAGG - Intronic
1083367927 11:62152656-62152678 TGGAGCCTGGGGAATGGAGAGGG - Exonic
1084008082 11:66333718-66333740 TGGTTGCTAGGGCATGGGGAGGG - Intronic
1084177832 11:67432770-67432792 TGATGCCCTGGGAGTGGAGATGG - Exonic
1087227471 11:95618327-95618349 TAATTCCCAGGAACTGGAGATGG + Intergenic
1088741782 11:112773538-112773560 TGAAACCTAGGGAGTGGAGTGGG + Intergenic
1089023820 11:115246768-115246790 TGTATCCTATGGCATGGAGATGG + Intronic
1090750690 11:129744074-129744096 TGAAGCCAAGGGAATGGGGAAGG - Intergenic
1091733829 12:2902800-2902822 GTATTTCTAGGGAATGAAGATGG - Intronic
1095778575 12:46035032-46035054 TGATGCATAGGGAAGGGAGGGGG - Intergenic
1096290289 12:50336497-50336519 TGATTCAAAAGGTATGGAGAAGG - Intronic
1096635408 12:52955495-52955517 TTACTTCTAGGGAGTGGAGAGGG - Intergenic
1096775129 12:53959152-53959174 TAATTGCTTGGGACTGGAGATGG - Intergenic
1096812442 12:54180085-54180107 TGATCCCCAGGGAGGGGAGAGGG - Intronic
1097575910 12:61392082-61392104 TACTTGCCAGGGAATGGAGAAGG + Intergenic
1098574360 12:72024246-72024268 TGATTCTTGAGGAATGGAAAGGG + Intronic
1099529201 12:83755406-83755428 TTATTTCTAGGGAATTAAGATGG + Intergenic
1100394039 12:94169258-94169280 TTATTCTTGGGGACTGGAGATGG + Exonic
1101000202 12:100349901-100349923 TGAAGCCCAGGGCATGGAGAAGG - Intergenic
1103543295 12:121681179-121681201 TGCTTGCCAGGGACTGGAGAGGG + Intergenic
1103958089 12:124590308-124590330 TGATTGCTGGGGGCTGGAGAGGG - Intergenic
1104237233 12:126950823-126950845 GGATTCCCAGGGATGGGAGAAGG - Intergenic
1105727294 13:23177200-23177222 TGATTACCAGAGAATGGGGAGGG + Intergenic
1106587476 13:31069866-31069888 TCATCCCTAGGGCATTGAGAAGG + Intergenic
1106929004 13:34643489-34643511 TGCTACCTAAGGAATGGAGCTGG - Intergenic
1107538956 13:41367220-41367242 TGATTTGTAGGGAATGGGCATGG + Intronic
1110069647 13:71158185-71158207 TGATTGCCAGGGACTGGAGGAGG + Intergenic
1110587804 13:77215239-77215261 TGATTCCTTTGGAATAGAGTGGG - Intronic
1111262984 13:85767203-85767225 TGGTTTCTGGGGAATGGGGAAGG + Intergenic
1112575876 13:100636281-100636303 TACTTCCTAGGGAAAGGGGAAGG + Intronic
1113271651 13:108681383-108681405 TGAATAGTAGGCAATGGAGAAGG - Intronic
1116770140 14:49117869-49117891 TCCTGCCTAGGAAATGGAGACGG - Intergenic
1117195573 14:53336698-53336720 TGATTCCTTGGGAAGGGAGATGG - Intergenic
1117620493 14:57581421-57581443 TCTTTCCTAGGGAATGCAGTCGG - Exonic
1117907855 14:60609265-60609287 TGATTCCTTGAGAAGGCAGAGGG + Intergenic
1119867306 14:77984573-77984595 TCATCCCTTGGGAATGAAGAGGG + Intergenic
1121656664 14:95601949-95601971 AGAGGTCTAGGGAATGGAGATGG + Intergenic
1123120064 14:105912338-105912360 AGCTTCCCAGGGAATAGAGAGGG + Intergenic
1124878173 15:33615895-33615917 TTATTCCTAAGGAGTGGAGTGGG - Intronic
1125832979 15:42729398-42729420 TGATACTTAGGGAGGGGAGAGGG - Intronic
1125908380 15:43414642-43414664 TGAATGCTAGGGACTGGAAAGGG + Intronic
1127199923 15:56634053-56634075 TGAATCAGTGGGAATGGAGAAGG + Intronic
1128020840 15:64388862-64388884 TGACTCCTATGAAATGGAGATGG + Intronic
1128414290 15:67429994-67430016 TGGTCCCTGGGAAATGGAGATGG + Intronic
1130157427 15:81363781-81363803 TGTCTCCTAGGGCATAGAGAGGG + Intronic
1130680121 15:85989317-85989339 GCATTCCTAGGGAAAGGGGAAGG + Intergenic
1131793639 15:95991244-95991266 TGATTCCAATGGAATGGATTGGG + Intergenic
1132021927 15:98370341-98370363 TGGATCCTGGGGAATGAAGATGG - Intergenic
1132346999 15:101114414-101114436 GGCTTCCTTGGGAATGGAGCTGG + Intergenic
1135025227 16:18994560-18994582 TGCTTCTTAAGGAATGGAAAGGG + Intronic
1135754537 16:25086038-25086060 TGATCCCCAGGGCATAGAGAAGG - Intergenic
1136748452 16:32612821-32612843 TGATTCTGGGAGAATGGAGATGG - Intergenic
1136984616 16:35087779-35087801 TGGTTTCTAGGGAAGGGAGGAGG + Intergenic
1140004505 16:71061822-71061844 TGATTTCAAAGGACTGGAGAGGG + Intronic
1140014634 16:71169648-71169670 TGATTCCCAGGGACTGGGGTTGG + Intronic
1140216757 16:73014945-73014967 TGGTCCCTAGGGTCTGGAGAAGG - Intronic
1203050586 16_KI270728v1_random:872026-872048 TGATTCTGGGAGAATGGAGATGG - Intergenic
1143209439 17:5173465-5173487 TGATTCTTACGGCATGGACAAGG + Exonic
1144197872 17:12912997-12913019 AGAATCCCAGGGAATGGTGAAGG + Intronic
1144467982 17:15512081-15512103 TAACTCCCAGGGAATGGTGAAGG + Intronic
1145119867 17:20248418-20248440 TGATTCCTAGTGAAGGAAAATGG + Intronic
1147980307 17:44269954-44269976 TGACTCCTAGGGCAGGCAGAGGG - Intergenic
1148496386 17:48055563-48055585 TGAGTCCTGGGGTATGGTGAGGG + Intronic
1149493706 17:57103356-57103378 AGATCCCTAGGGGATTGAGAAGG - Intronic
1149984728 17:61338764-61338786 TTCTTCCTAGGAAATGGAAAAGG - Intronic
1155174169 18:23288516-23288538 TGATGCGTAGGGAAGGGAGGGGG - Intronic
1156364202 18:36410175-36410197 TGGTTACCAGGGATTGGAGACGG - Intronic
1156863021 18:41860460-41860482 TGACTCCTAGAGTATGGAAATGG + Intergenic
1156997985 18:43491933-43491955 TGATTTCCAGGGACTGGATATGG + Intergenic
1157341596 18:46783395-46783417 TGATTTCCAGGGAATGGTGGTGG - Intergenic
1158434595 18:57427518-57427540 TGGGTCCTAGGGCAGGGAGAGGG + Intergenic
1158819634 18:61144664-61144686 AGATGCCTAGGGAAGGAAGATGG + Intergenic
1159803967 18:72932352-72932374 TGGTTCTGAGGCAATGGAGAGGG - Intergenic
1163230430 19:15998209-15998231 AGATTCCTAGGGCCTGGAGCAGG + Intergenic
1164220526 19:23188934-23188956 TGATGTGTAGGGAAGGGAGAGGG + Intergenic
1165632055 19:37309954-37309976 TGATTCTTTGGGATTGGAGAAGG + Intergenic
925540255 2:4959077-4959099 TGATAGCTAGAGAGTGGAGAGGG + Intergenic
925912135 2:8580994-8581016 TTCCTCCTAGGGAAGGGAGAAGG + Intergenic
927571467 2:24164490-24164512 TTATTCAGAGGGAATGGAGAGGG + Intronic
927662078 2:25001670-25001692 AGATTCCCAGGGAATGAAGGTGG + Intergenic
929386985 2:41420966-41420988 TGCTTGCCAGGGAATGGGGAAGG - Intergenic
929918890 2:46158269-46158291 GGAGGCCTAGGGACTGGAGAGGG + Intronic
930288954 2:49468827-49468849 CCACTGCTAGGGAATGGAGAGGG + Intergenic
930928700 2:56853557-56853579 TGGTGCCTGGGGAAGGGAGAGGG - Intergenic
931063319 2:58555714-58555736 TGATCATTAGGGGATGGAGATGG + Intergenic
932027495 2:68150101-68150123 TGATTCCTAGGCCATGGAAGAGG + Intronic
935803967 2:106728537-106728559 AAATTCCTGGGAAATGGAGATGG - Intergenic
936883613 2:117282900-117282922 TGATGTGTAGGGAAGGGAGAGGG - Intergenic
938262220 2:129904095-129904117 TGATTCCCATGGAAAGGAGAGGG - Intergenic
938760855 2:134424568-134424590 TCATTCCTATGGAAGGGTGAAGG + Intronic
940677962 2:156748213-156748235 TGCTTCCTACAGAATGGAGGAGG - Intergenic
943476170 2:188358317-188358339 TGGTTACTAGGGACTGGAAAGGG + Intronic
943774133 2:191746870-191746892 CAATTCCTGGGGAGTGGAGATGG - Intergenic
944146129 2:196509430-196509452 TGACTTCCAGGGAAAGGAGAGGG - Intronic
944265573 2:197721725-197721747 TGATTTCTGGGGAGTGGAGGCGG - Intronic
946035817 2:216741268-216741290 TGCTTCCTAGGGCAGGAAGAAGG + Intergenic
946475287 2:220000936-220000958 TCATTCCTAGTGGATGGACAAGG + Intergenic
946895568 2:224319909-224319931 TGCAGCCTTGGGAATGGAGAAGG + Intergenic
947024683 2:225723775-225723797 AGATTCATAGAGAATGGATAAGG + Intergenic
947393049 2:229659345-229659367 TGCTTGCTAGTGAATGGAGTGGG - Intronic
947958940 2:234218435-234218457 GGATTCCTAGGGAGTGGCAAAGG + Intergenic
948285156 2:236778530-236778552 TGGTTACTAGGGGAGGGAGAGGG - Intergenic
948362661 2:237433917-237433939 TGAATCCTAGGGGCTGGAGGGGG - Intergenic
1169571341 20:6909343-6909365 TGCTTGCCAGGGATTGGAGATGG - Intergenic
1171866409 20:30489512-30489534 GGACGCCTAGGGAAGGGAGAGGG + Intergenic
1175869242 20:62200052-62200074 AGATTCCTAGGGGATGGGGTGGG - Intronic
1181525504 22:23482933-23482955 TGTTTCCTTGGCAATGGAGGAGG - Intergenic
949161802 3:892213-892235 TGATGTGTAGGGAATGGAGGGGG + Intergenic
949949430 3:9216991-9217013 TGATTGCCAGGGAATGGGGGAGG + Intronic
950077800 3:10199584-10199606 TGATCCCTAGGGGCTGGAGTGGG + Intronic
951464743 3:22989949-22989971 TGTGTCCCAGGGAATGAAGATGG + Intergenic
952849435 3:37715432-37715454 AGATTCCTAGGGGATGGAACTGG - Intronic
952980266 3:38728492-38728514 TGTCTCCTGGGGAAAGGAGAAGG - Intronic
953279896 3:41544509-41544531 TTATTCCTGGGGAATACAGAAGG - Intronic
953599137 3:44346495-44346517 TGATGTGTAGGGAAGGGAGAGGG + Intronic
953797869 3:45999309-45999331 TGATTCATAGACAATGCAGAAGG + Intergenic
954495751 3:50959489-50959511 TGATTACTAGGGATTGAAAATGG - Intronic
955528561 3:59847968-59847990 TGACTCCTAGGGAATTTAAAGGG - Intronic
955677999 3:61469564-61469586 TGGTTGCTAGGGGATGGGGAAGG - Intergenic
955747744 3:62156779-62156801 TATTTCCTGGGGAAGGGAGAGGG + Intronic
955838266 3:63082422-63082444 TGATTACTAGAGGCTGGAGAGGG - Intergenic
957950244 3:87115990-87116012 TCAGTCCTAGGCAATTGAGATGG - Intergenic
959088219 3:101873959-101873981 TGTTTCCTAGAGAGGGGAGATGG - Intergenic
959500039 3:107096523-107096545 TGATTGCCAGGGATTGGGGATGG + Intergenic
960896311 3:122509342-122509364 TGATTCCTTGGGCATAGAGTGGG - Intronic
961520588 3:127465380-127465402 TGATTGCTAGGGAATGACTAAGG - Intergenic
961752980 3:129108132-129108154 AGATTCCTAGGGAAGTGAGATGG - Intronic
963013085 3:140793465-140793487 TGATTACAAGAGAATAGAGAAGG + Intergenic
963037608 3:141046076-141046098 TCATTCCAAGGAAATGGAGCTGG + Intergenic
963986024 3:151595773-151595795 TGGTTACTAGGGGAAGGAGAAGG + Intergenic
964172098 3:153783047-153783069 TGATTATTAGGGACTGGAGAAGG + Intergenic
966279681 3:178212444-178212466 TGATGTGTAGGGAAGGGAGAGGG - Intergenic
966667244 3:182485685-182485707 TGATTTCTTGGGAGTGGGGAGGG - Intergenic
966860559 3:184229311-184229333 TGATTCCTGAAGAATGGAAAGGG + Intronic
969352243 4:6604471-6604493 GGATTCCTGGGGGATGGGGAAGG + Intronic
970042353 4:11810444-11810466 TGATGTGTAGGGAAGGGAGAGGG - Intergenic
970526144 4:16934120-16934142 TGATTCACTGGGAATGGTGAAGG + Intergenic
971395873 4:26226894-26226916 TGAGTCCTTGGTAATGGGGAAGG + Intronic
974070888 4:57122424-57122446 TGATTCCAAGGGGCTGGAGTAGG + Intergenic
974601619 4:64090058-64090080 TGATTCCTTGAGGTTGGAGATGG - Intergenic
975864805 4:78715405-78715427 TGATGTGTAGGGAAGGGAGAGGG + Intergenic
976891986 4:90060221-90060243 TGTTTCCTTGGGAATGTAAAAGG - Intergenic
977336609 4:95707560-95707582 TAATTCCTTGGGAATACAGAGGG + Intergenic
977959085 4:103064475-103064497 TGATTACCAGGGACTGGGGAGGG + Intronic
979937198 4:126712673-126712695 GTATTCCTAAAGAATGGAGAGGG - Intergenic
980118985 4:128708462-128708484 TGTTTACTAGGTAATTGAGAGGG + Intergenic
981093650 4:140757085-140757107 TAATTACAATGGAATGGAGAGGG - Intergenic
981666892 4:147238557-147238579 TGTTTCCCAGGGAAAGGAAAAGG - Intergenic
981800650 4:148651913-148651935 AGATTAGTAGGGAATGCAGATGG + Intergenic
982611396 4:157578109-157578131 AGATTCCAAGGGGTTGGAGATGG - Intergenic
983430077 4:167638426-167638448 TGGTTCCCAGAGACTGGAGAAGG - Intergenic
984425553 4:179580810-179580832 GCATTCCTAGGGAAGGGGGATGG - Intergenic
985172585 4:187167792-187167814 TTATTCCTATGGATTTGAGAAGG + Intergenic
985436023 4:189930230-189930252 TGATGTGTAGGGAAGGGAGAGGG - Intergenic
986314136 5:6574863-6574885 TGATGCCTCGGGACAGGAGAGGG - Intergenic
991035384 5:62122981-62123003 TGATACCAAGGGAAGAGAGAAGG + Intergenic
992020510 5:72619340-72619362 TGATTCTTCAGAAATGGAGATGG + Intergenic
992600027 5:78390580-78390602 TGATTTCTAGGAGGTGGAGATGG + Intronic
993105792 5:83599173-83599195 TGAGTCCTAGGGAAAGAACAAGG + Intergenic
994589627 5:101757714-101757736 TGATTATCAGGGAATGGAGTTGG - Intergenic
995296951 5:110533998-110534020 TGATGTGTAGGGAAGGGAGAGGG - Intronic
995474442 5:112533710-112533732 TGACTCATAGGGATTGGAGAGGG + Intergenic
995572875 5:113499863-113499885 TGATTCCTGGGGTGAGGAGAAGG + Intergenic
995855922 5:116592193-116592215 CTATTCCTAGAGAAAGGAGATGG - Intergenic
996202977 5:120699135-120699157 TGATGTGTAGGGAAGGGAGAGGG + Intergenic
996530176 5:124520327-124520349 ACATTCCTAGGGATTGAAGATGG + Intergenic
997032403 5:130146434-130146456 TGATTACCAGAGACTGGAGAGGG + Intronic
997382895 5:133450155-133450177 TTTTTCCTTGGGCATGGAGATGG - Intronic
997389842 5:133505348-133505370 TGATGACTGGAGAATGGAGAAGG - Intronic
998646305 5:144066107-144066129 AGATCCCTAGGGTGTGGAGAGGG + Intergenic
999659606 5:153846506-153846528 TGGTTACTAGAGATTGGAGAGGG - Intergenic
999912487 5:156218891-156218913 GGCCTCCTATGGAATGGAGATGG - Intronic
1000038703 5:157468655-157468677 TTATTCGTCTGGAATGGAGATGG + Intronic
1000765467 5:165283895-165283917 TGAATAACAGGGAATGGAGAGGG + Intergenic
1001026475 5:168228374-168228396 TCAGTCCTAGGAAATGGAAATGG - Intronic
1009751655 6:67884402-67884424 TGATGCATAGGGAAAGGAGGAGG + Intergenic
1010380573 6:75219485-75219507 TGATTTTTAGGGGCTGGAGATGG + Intergenic
1010522245 6:76852040-76852062 TGATTACCAGAGACTGGAGAGGG + Intergenic
1011486381 6:87846121-87846143 TGATGCCAATGGAATGGAAAAGG - Intergenic
1011659238 6:89580015-89580037 TGATTGCTAGGGGCTGGAGATGG + Intronic
1012764618 6:103350843-103350865 AGATTTCTAGGGGAAGGAGAAGG + Intergenic
1015147303 6:130001370-130001392 TTATTGCTTGGGAATGGAGATGG + Intergenic
1016279391 6:142397933-142397955 TGAATCCAAGGGAATGAAGGAGG + Intronic
1017625212 6:156341046-156341068 TGATTCCTAGATATTGAAGATGG + Intergenic
1018366351 6:163123662-163123684 TGGTTACTAGCGGATGGAGAGGG - Intronic
1018996448 6:168714024-168714046 TGAATCCCAGGGACTGGACAGGG - Intergenic
1021586717 7:22216394-22216416 TGATTCCTAGGGAATGGAGAGGG - Intronic
1024608034 7:51038867-51038889 TCATTCAGAGGGGATGGAGAGGG + Intronic
1025030868 7:55555612-55555634 TGATACTTAGGAAAAGGAGAAGG - Intronic
1027572080 7:79882199-79882221 TAATTGCCAGGGAATGGAGAAGG - Intergenic
1029035721 7:97519030-97519052 TGGTTACTAGGGATTGAAGAAGG + Intergenic
1029035727 7:97519089-97519111 TGGTTACTAGGGGTTGGAGAAGG + Intergenic
1030136014 7:106249522-106249544 TGGTTTCTAGGGAAGGGAGGAGG - Exonic
1030633394 7:111920102-111920124 TGGTTACCAGGGATTGGAGAGGG + Intronic
1030890810 7:114996736-114996758 TGATTCATTTGGAATGGAGTGGG + Intronic
1031460406 7:122041911-122041933 TGTTTCCTAGCAAACGGAGAAGG + Intronic
1033406923 7:141078840-141078862 TGATTTCTGGGGCAAGGAGAAGG + Intronic
1034406775 7:150909206-150909228 TTATTGTTAGGGAATGGACATGG + Intergenic
1034670782 7:152856606-152856628 TTATTCCCAGGGTTTGGAGAAGG - Intergenic
1036988015 8:13558293-13558315 TGATACCAAGGGCTTGGAGAAGG + Intergenic
1037301482 8:17456186-17456208 TGATTCCTCATGAATGTAGATGG + Intergenic
1037605152 8:20432024-20432046 TGCTTCGAAGGGAATGGACAAGG - Intergenic
1040949536 8:52923114-52923136 TGATTCATAGGGGCTGGAAAAGG + Intergenic
1041224071 8:55681013-55681035 TGGTTACTAGGGGATGGAGTTGG + Intergenic
1042688725 8:71471998-71472020 TGGTTCCTAGGGAATGGCAATGG - Intronic
1043008661 8:74854416-74854438 ATATTCCTAGGCACTGGAGAAGG - Exonic
1043494183 8:80782079-80782101 TGATTGCTCGGGGATGGGGAAGG - Intronic
1044149435 8:88756143-88756165 TGGTTACTAGAGGATGGAGAAGG - Intergenic
1044757805 8:95483914-95483936 TGGTTTCTAGGGAAGGGAGATGG - Intergenic
1044973403 8:97641805-97641827 TGATTCCTTGGGGATGGGGGTGG - Intergenic
1045384621 8:101659514-101659536 AGAATCCCAGGGAATGGGGAAGG + Intronic
1045941199 8:107740147-107740169 TGATTCCTACGGAAGAAAGAGGG + Intergenic
1046087935 8:109462376-109462398 TGATTCCTATGGGATGGACTTGG - Intronic
1046544291 8:115628948-115628970 GAAGTCCTAGGGATTGGAGAGGG + Intronic
1046587755 8:116168420-116168442 TGCTTCTTAGCAAATGGAGAGGG + Intergenic
1048945551 8:139443856-139443878 TGTGACCTAGGGAATGGGGAAGG + Intergenic
1049780724 8:144427660-144427682 GGGGTCCTAGGGAATGAAGATGG + Intronic
1051082456 9:13309098-13309120 TAATTCCCAGGGTTTGGAGAGGG - Intergenic
1052102066 9:24460527-24460549 TGAGTCCAAAGGACTGGAGAAGG + Intergenic
1052103377 9:24479579-24479601 TGATTCCTAGGGAAAAGACATGG - Intergenic
1053283639 9:36837080-36837102 GGATTTCTAGGGAATGGGGGTGG + Exonic
1055347430 9:75353335-75353357 TGATGTGTAGGGAATGGAGGGGG + Intergenic
1056621217 9:88216640-88216662 TGTTTCCTCCGGAATGGATAGGG + Intergenic
1058814178 9:108668471-108668493 TGCTTCCTAATGAATGTAGATGG + Intergenic
1059131772 9:111759283-111759305 TGACATGTAGGGAATGGAGATGG + Intronic
1059652359 9:116326743-116326765 TGGTTGCTAGGGGATGGGGAAGG - Intronic
1059958395 9:119541991-119542013 TGTTTCCTTGGGATTGGAGATGG + Intergenic
1061960394 9:133985603-133985625 TGGTTCCTTGGTAGTGGAGAGGG - Intronic
1062126152 9:134864129-134864151 TGGTTCCCAGGGGAGGGAGAGGG - Intergenic
1062241359 9:135540842-135540864 TGGTTCCGAGGCAATGGAGCTGG - Intergenic
1186259487 X:7761545-7761567 GGTTTCTGAGGGAATGGAGAGGG + Intergenic
1187457256 X:19453018-19453040 TGGTTGCTAGGGACTGGGGAAGG + Intronic
1189797522 X:44659739-44659761 TCGTTCCTTGGGAATGGAAAAGG - Intergenic
1192281092 X:69686600-69686622 TGATTCCTAGGGGCTGGAAGAGG - Intronic
1193847039 X:86485353-86485375 TGATTGCCAGAGAATGGGGAGGG + Intronic
1195713565 X:107796071-107796093 TGATTCTGAGGGAGTGGAGAAGG + Intergenic
1196207039 X:112952397-112952419 TGTTTCATAGGGATTGGTGAGGG - Intergenic
1196284737 X:113865842-113865864 TGGTTGCTTGGGACTGGAGATGG + Intergenic
1197731879 X:129817640-129817662 AGATTGCTAGGGGATGGGGAAGG - Intronic
1198108424 X:133482416-133482438 TGGTGCCTATGGATTGGAGAAGG + Intergenic
1199489889 X:148386763-148386785 TGATCCCGAGGGAAAGGAGAGGG + Intergenic