ID: 1021586718

View in Genome Browser
Species Human (GRCh38)
Location 7:22216395-22216417
Sequence GTGATTCCTAGGGAATGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021586718_1021586724 6 Left 1021586718 7:22216395-22216417 CCTCTCCATTCCCTAGGAATCAC 0: 1
1: 0
2: 1
3: 24
4: 251
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586718_1021586725 7 Left 1021586718 7:22216395-22216417 CCTCTCCATTCCCTAGGAATCAC 0: 1
1: 0
2: 1
3: 24
4: 251
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021586718 Original CRISPR GTGATTCCTAGGGAATGGAG AGG (reversed) Intronic
901780970 1:11594232-11594254 GTGGTTGCTGGGGAAGGGAGAGG + Intergenic
902687226 1:18086223-18086245 GTCATTCCTTCAGAATGGAGAGG - Intergenic
902970018 1:20041521-20041543 TTGATGTCTAGGGAAGGGAGGGG + Intronic
903003858 1:20285458-20285480 CTGATGCCAGGGGAATGGAGAGG + Intergenic
903129480 1:21269223-21269245 GTATTTCCTAGGAAATGGTGAGG - Intronic
904654040 1:32029087-32029109 GTGCTTCCTATAGTATGGAGAGG - Intronic
905966255 1:42098937-42098959 GTGATTACAAGGGGCTGGAGGGG + Intergenic
906998127 1:50820111-50820133 GTGGTTACTAGGGGATGGGGTGG + Intronic
907874679 1:58474056-58474078 GTGATTCCTAGGCTCTGGATTGG - Intronic
908697045 1:66855238-66855260 GTGGTTACTAGGGAAAGGAATGG - Intronic
909380742 1:74995729-74995751 GTGTTTGCTAGAGAAGGGAGTGG - Intergenic
910941504 1:92539876-92539898 GTGGTTCCTTGGGGTTGGAGGGG - Intronic
911801385 1:102142884-102142906 GTGCTTCATAGTGAATGTAGAGG + Intergenic
911808725 1:102245597-102245619 GTGATTCCTAGGGGCTGGATGGG - Intergenic
913196730 1:116462909-116462931 GTGCTGCCTTGGGAATGGAGAGG - Intergenic
914234561 1:145796818-145796840 GTGGTTACCAGGGAATGAAGGGG - Intronic
915492854 1:156261091-156261113 GTGCTCCCTAGGGAATGCAAGGG - Intronic
916647199 1:166797636-166797658 TTTTTTCCTAGGGAATGGGGCGG + Intergenic
917135095 1:171781802-171781824 GTCATTCCTGGGGTTTGGAGTGG + Exonic
917460621 1:175225896-175225918 GTGATTCCTAGGCCAGTGAGTGG - Intergenic
918185902 1:182127657-182127679 GTGCTGCCTAGGGAATAGAGGGG - Intergenic
920061157 1:203227931-203227953 CTGATGCCCAGGGAATGGGGTGG + Intronic
920568974 1:207002004-207002026 GTGCTTCCTAGGTAAGGGGGTGG - Intergenic
920969971 1:210734752-210734774 GGGCTTCCTAGGGCCTGGAGAGG + Intronic
921467151 1:215502436-215502458 CTGATTCTTAGAGAATGGAGTGG + Intergenic
922192495 1:223331834-223331856 GTGATTTCTAGGGGAGGCAGAGG - Intronic
1062799683 10:369836-369858 GGGATTCCCTGGGAATGTAGAGG - Intronic
1063107399 10:3004350-3004372 GTGATTGCCAGGGACTGGGGAGG - Intergenic
1066742060 10:38526888-38526910 GGGATTCGAATGGAATGGAGTGG + Intergenic
1066776771 10:38893191-38893213 ATGATTCAAATGGAATGGAGTGG + Intergenic
1071286800 10:84156137-84156159 GGGATTCCTAGAGGAAGGAGTGG + Intergenic
1075054924 10:119210223-119210245 ATGATGCCTTGGAAATGGAGAGG + Intronic
1075713754 10:124544259-124544281 GTGTCTTCTGGGGAATGGAGCGG + Intronic
1076111539 10:127863413-127863435 GTGATTCGTAAGGCAGGGAGGGG - Intergenic
1077883674 11:6370168-6370190 GTGATGTGTAGGGAAGGGAGGGG - Intergenic
1079994276 11:27279228-27279250 CTGATTCAAAGGGACTGGAGTGG + Intergenic
1080902404 11:36509074-36509096 TTGATTACTAGGGAAGGGAGAGG - Intronic
1083051081 11:59777288-59777310 CTGATTCTTAGGGACTGGAATGG + Intronic
1083053148 11:59794730-59794752 GTGATTGCTAGGAAATGGTTGGG + Intronic
1083367928 11:62152657-62152679 GTGGAGCCTGGGGAATGGAGAGG - Exonic
1084896233 11:72271727-72271749 GTGATTTCTAGGGACTTAAGTGG - Intergenic
1085880643 11:80463303-80463325 GAGGTGCCTAGGGACTGGAGTGG + Intergenic
1086837878 11:91648210-91648232 GTCATTGCTATGGAAAGGAGTGG - Intergenic
1088741781 11:112773537-112773559 CTGAAACCTAGGGAGTGGAGTGG + Intergenic
1088831901 11:113544044-113544066 GTGATTCCTGTGGAAAGGAATGG + Intergenic
1089106543 11:116011139-116011161 GTGGTTCCTAGGGGTTAGAGAGG - Intergenic
1089404034 11:118182692-118182714 AAAATTCCTAGGGAGTGGAGGGG - Intergenic
1090196094 11:124817801-124817823 GTGAGTCTGAGGGAATGGAAGGG - Intergenic
1090886350 11:130880407-130880429 CTGATGCCAAGGGAATGGAAAGG - Intronic
1091265175 11:134265027-134265049 ATGATTCCTTTGGAATAGAGCGG - Exonic
1091289228 11:134428073-134428095 ATGAGACCCAGGGAATGGAGGGG - Intergenic
1093287096 12:17277211-17277233 GTGTTTCCTAGGCAATGTTGGGG + Intergenic
1093343377 12:18007498-18007520 GTGAATCCCATGGATTGGAGGGG + Intergenic
1095168673 12:39006676-39006698 GTGATTCCCAGGGGCTGGTGGGG + Intergenic
1095275989 12:40282763-40282785 GTGTTTCCAAGGGATTTGAGGGG - Intronic
1095778576 12:46035033-46035055 TTGATGCATAGGGAAGGGAGGGG - Intergenic
1096635409 12:52955496-52955518 GTTACTTCTAGGGAGTGGAGAGG - Intergenic
1097583041 12:61481552-61481574 GAGATGACTAGGGACTGGAGTGG + Intergenic
1100053266 12:90477098-90477120 GTGGTTGCTAGGGGATGCAGGGG - Intergenic
1101082650 12:101204867-101204889 GTGATTGCTAGGGTTTGGCGGGG - Intronic
1103543294 12:121681178-121681200 GTGCTTGCCAGGGACTGGAGAGG + Intergenic
1103677223 12:122665406-122665428 GTGGTTACTAGGGACTGGCGGGG - Intergenic
1103958090 12:124590309-124590331 GTGATTGCTGGGGGCTGGAGAGG - Intergenic
1105017426 12:132794205-132794227 TAGATGCCTAGGGAATGCAGTGG + Intronic
1106154351 13:27138936-27138958 GTGACACCTTGGGAATGGAAAGG - Intronic
1109622436 13:64927368-64927390 GTGATACCTATGGAAGGGAAAGG - Intergenic
1110587805 13:77215240-77215262 GTGATTCCTTTGGAATAGAGTGG - Intronic
1112288390 13:98124040-98124062 GAGATGACTAGGGAAAGGAGCGG - Intergenic
1113246104 13:108397464-108397486 GTGATTCCTGGGGGCTAGAGGGG + Intergenic
1113881601 13:113629878-113629900 GGGATTCCTGGGGAAGGGAGTGG + Intronic
1115535228 14:34366662-34366684 GTGAATCCCAGGGCAGGGAGTGG + Intronic
1115643848 14:35352975-35352997 GTGGTTCCTGGGGAGGGGAGAGG - Intergenic
1119940761 14:78638845-78638867 CTCATTCCTGGGGGATGGAGGGG - Intronic
1123120063 14:105912337-105912359 GAGCTTCCCAGGGAATAGAGAGG + Intergenic
1123196032 14:106617501-106617523 GTGGTACTTAGGGAAGGGAGGGG + Intergenic
1123208256 14:106734915-106734937 GGGATGCTCAGGGAATGGAGAGG + Intergenic
1123780983 15:23628171-23628193 CTGGTTTCTAGTGAATGGAGAGG + Intronic
1124878174 15:33615896-33615918 TTTATTCCTAAGGAGTGGAGTGG - Intronic
1126278438 15:46913811-46913833 GTGGTTTCTAGGGACTGGAGGGG + Intergenic
1126901015 15:53314278-53314300 TTGATACCTATGGAAGGGAGGGG - Intergenic
1127002341 15:54523979-54524001 ATGATTCCTTAGGATTGGAGTGG + Intronic
1127648689 15:60985013-60985035 GAGATTACTAGGGACTAGAGTGG + Intronic
1128208432 15:65873013-65873035 TTGATTAATAGGGGATGGAGTGG + Intronic
1128281862 15:66401795-66401817 AGGATTCCATGGGAATGGAGGGG + Intronic
1128304340 15:66588265-66588287 GTGAGTCCTGGGGAATGGTGAGG + Intronic
1128445268 15:67754119-67754141 GTGATTGCCAGGGACTGGAGGGG + Intronic
1128603642 15:69018206-69018228 GGGATTCCTAGGGATTGGCAGGG + Intronic
1128652802 15:69431658-69431680 ATAATTCATAGCGAATGGAGAGG + Intronic
1128799037 15:70485769-70485791 GTGGTTACTAGAGACTGGAGAGG + Intergenic
1129262824 15:74378351-74378373 GAGAAGCCTAGAGAATGGAGTGG - Intergenic
1131793638 15:95991243-95991265 CTGATTCCAATGGAATGGATTGG + Intergenic
1133385309 16:5365045-5365067 GTGATTCCTCAGGGAGGGAGTGG + Intergenic
1133669005 16:7999196-7999218 GCAATTCCTCGGGAAGGGAGAGG - Intergenic
1133820499 16:9232068-9232090 GTTATACCTAGGCAAGGGAGGGG + Intergenic
1136872245 16:33817943-33817965 GTGGTACTTAGGGAAAGGAGGGG - Intergenic
1138112933 16:54338861-54338883 GTGATTGCCAGGGGTTGGAGTGG - Intergenic
1138460589 16:57145527-57145549 GTGTTGAGTAGGGAATGGAGGGG + Intronic
1138796123 16:59971428-59971450 GTCATTCCTATGGAAGGGACTGG - Intergenic
1139138757 16:64235530-64235552 GTGATTGGTAGGGAATTAAGTGG + Intergenic
1139442909 16:66977682-66977704 CTGGGTCCTAGGGCATGGAGGGG - Intergenic
1140074683 16:71686598-71686620 GTGATTGCCAGGGCATGGTGGGG - Intronic
1140840987 16:78838884-78838906 GTGATTGCCAGGGACTGGAGAGG + Intronic
1140988026 16:80177676-80177698 CTGCTTCCCAGGGAATGTAGAGG - Intergenic
1203099927 16_KI270728v1_random:1298125-1298147 GTGGTACTTAGGGAAAGGAGGGG + Intergenic
1146067949 17:29652359-29652381 GTGATTTCTAGGGATTGTTGGGG + Intronic
1146454570 17:32998881-32998903 GTGACTCTTAGGGAGAGGAGGGG + Intergenic
1147325045 17:39666076-39666098 GTGCTTCCTGGGACATGGAGCGG - Exonic
1148496385 17:48055562-48055584 GTGAGTCCTGGGGTATGGTGAGG + Intronic
1148838735 17:50480597-50480619 GTCATTCCTTGTGATTGGAGAGG + Intronic
1149393714 17:56218099-56218121 GTGATGCCTGGAGAATGGGGTGG - Intronic
1149827479 17:59842807-59842829 AGCATTCGTAGGGAATGGAGAGG - Intergenic
1150382149 17:64729305-64729327 GTGATTCGTGGAGAGTGGAGAGG + Intergenic
1150774117 17:68065546-68065568 GTGATTCGTGGGGAGTGGAGAGG - Intergenic
1151116357 17:71739868-71739890 GTCATTGCTATGGAAAGGAGTGG - Intergenic
1203165678 17_GL000205v2_random:91256-91278 GTGGTTCCTAGGAGCTGGAGGGG - Intergenic
1203194692 17_KI270729v1_random:220709-220731 GGGACTCCTATGGAATGGACTGG + Intergenic
1203204047 17_KI270730v1_random:20105-20127 GGGACTCCTATGGAATGGACTGG + Intergenic
1153149935 18:2080822-2080844 GTGATTTCTAGGGATTGAGGTGG + Intergenic
1155174170 18:23288517-23288539 TTGATGCGTAGGGAAGGGAGGGG - Intronic
1157887654 18:51384268-51384290 GTGATTCCTTGTGTATGGACAGG + Intergenic
1159482514 18:69008489-69008511 TTGACTCCTATGGAATGAAGGGG + Intronic
1162424617 19:10587058-10587080 GGGATTCCCAGGGATTGCAGGGG + Intronic
1162539954 19:11289092-11289114 GTGGGTACCAGGGAATGGAGAGG - Intergenic
1167202729 19:48077646-48077668 GTGCTCCTTTGGGAATGGAGAGG - Intronic
1167703854 19:51066577-51066599 GTTAATCCTAGGGGGTGGAGGGG + Intergenic
1168424233 19:56225860-56225882 GTGATTGCTAGGGGCTGGGGTGG - Intronic
1168437704 19:56334700-56334722 GAGATGACTAGGGACTGGAGAGG + Intronic
925792811 2:7510113-7510135 ATGTTTCCTAGGACATGGAGGGG + Intergenic
927571466 2:24164489-24164511 TTTATTCAGAGGGAATGGAGAGG + Intronic
927799707 2:26086947-26086969 GTGGTTTCCAGGGACTGGAGGGG + Intronic
929323208 2:40571880-40571902 GTTGTTCTCAGGGAATGGAGAGG - Intronic
930288952 2:49468826-49468848 GCCACTGCTAGGGAATGGAGAGG + Intergenic
930783519 2:55247777-55247799 ATGATTCCAAGGGAAGGGAGGGG - Intronic
930883507 2:56298321-56298343 TTGCTTCCTAGGCAATGCAGGGG - Intronic
931674587 2:64681856-64681878 GTGTTTCCTAGAGGAGGGAGTGG - Intronic
932830000 2:74980192-74980214 GTCATTCCTAGAGAATGAGGGGG - Intergenic
935853666 2:107250268-107250290 GTGGTTGCTAGGAATTGGAGTGG - Intergenic
938262221 2:129904096-129904118 CTGATTCCCATGGAAAGGAGAGG - Intergenic
938816307 2:134908114-134908136 ATGATTACTAGAGACTGGAGTGG + Intergenic
938833222 2:135073838-135073860 GTGAGTCTGAGGGAATTGAGGGG + Intronic
941702843 2:168623235-168623257 GTGATTACCAGGGATAGGAGTGG + Intronic
942656773 2:178222015-178222037 GTTATGCATTGGGAATGGAGAGG + Intronic
943476169 2:188358316-188358338 GTGGTTACTAGGGACTGGAAAGG + Intronic
947393050 2:229659346-229659368 TTGCTTGCTAGTGAATGGAGTGG - Intronic
948279696 2:236737728-236737750 CTGAAGCCTAGGGTATGGAGTGG + Intergenic
948285157 2:236778531-236778553 GTGGTTACTAGGGGAGGGAGAGG - Intergenic
948358881 2:237403846-237403868 GGGATTCCTAGAGAGTGAAGGGG - Intronic
948362662 2:237433918-237433940 ATGAATCCTAGGGGCTGGAGGGG - Intergenic
948402821 2:237696295-237696317 GATTTTCCTAGGGAAAGGAGTGG + Intronic
949039531 2:241841382-241841404 GTGGTTGCCAGGGAAGGGAGGGG + Intergenic
1171768262 20:29301677-29301699 GGGATGCCTGGGGAAGGGAGGGG + Intergenic
1171866408 20:30489511-30489533 GGGACGCCTAGGGAAGGGAGAGG + Intergenic
1171915065 20:31056566-31056588 GGGATTCCAATGGAATGGAAAGG + Intergenic
1172741428 20:37170958-37170980 GTGATTCCTAGGCATTAGGGTGG - Intronic
1172889108 20:38251482-38251504 GTTATACCTGGGCAATGGAGTGG + Intronic
1173316330 20:41947909-41947931 GTGATTTCTAGGGACAGAAGGGG + Intergenic
1174491217 20:50897395-50897417 GTGATTCCTGAGGAATTGACTGG - Intronic
1175869243 20:62200053-62200075 CAGATTCCTAGGGGATGGGGTGG - Intronic
1176335861 21:5599269-5599291 GTGGTTCCTAGGAGCTGGAGGGG + Intergenic
1176391896 21:6221679-6221701 GTGGTTCCTAGGAGCTGGAGGGG - Intergenic
1176406075 21:6367823-6367845 GTGGTTCCTAGGAGCTGGAGGGG + Intergenic
1176469523 21:7094495-7094517 GTGGTTCCTAGGAGCTGGAGGGG + Intergenic
1176493084 21:7476273-7476295 GTGGTTCCTAGGAGCTGGAGGGG + Intergenic
1176507558 21:7662110-7662132 GTGGTTCCTAGGAGCTGGAGGGG - Intergenic
1176747269 21:10662896-10662918 GGGACTCGTATGGAATGGAGTGG - Intergenic
1176751023 21:10691287-10691309 TGGACTCCTATGGAATGGAGTGG - Intergenic
1176753251 21:10707135-10707157 TGGAGTGCTAGGGAATGGAGAGG - Intergenic
1177502765 21:21979866-21979888 TTGGGGCCTAGGGAATGGAGTGG + Intergenic
1178221217 21:30662245-30662267 GAGGTTCCAAGGGAAGGGAGTGG - Intergenic
1178265187 21:31136541-31136563 GTGTTTCTTTGGGAATGGAGAGG - Intronic
1182717362 22:32368365-32368387 ATGTTTCCTTGGGGATGGAGGGG - Intronic
949161801 3:892212-892234 TTGATGTGTAGGGAATGGAGGGG + Intergenic
950077799 3:10199583-10199605 TTGATCCCTAGGGGCTGGAGTGG + Intronic
950692499 3:14671288-14671310 GTGCCTCCTAGGGAAAGGACAGG - Exonic
950694086 3:14684115-14684137 GCTATTCCTAGGGTATGCAGGGG - Intronic
951183049 3:19681734-19681756 GTGATTCTTTGGGAGTGAAGAGG + Intergenic
951535340 3:23735658-23735680 GTGTTTTCTAGGAATTGGAGGGG - Intergenic
951879809 3:27469380-27469402 GTGATTAGTAGGGGATGGGGTGG - Intronic
954039201 3:47871408-47871430 GTTAGTCCCTGGGAATGGAGTGG + Intronic
954210474 3:49094204-49094226 GTGGATCCTAGGGTATGGAGCGG + Exonic
954400361 3:50316439-50316461 GTGATGGGTAGAGAATGGAGAGG - Intergenic
955077670 3:55629227-55629249 GGGATGCCTAGGGAGTGGGGTGG + Intronic
955528562 3:59847969-59847991 GTGACTCCTAGGGAATTTAAAGG - Intronic
959175290 3:102901545-102901567 GTTTTTCCTTGGGTATGGAGTGG + Intergenic
960896312 3:122509343-122509365 GTGATTCCTTGGGCATAGAGTGG - Intronic
960994402 3:123331393-123331415 GTGACTCCTGGGGTGTGGAGGGG - Intronic
966128848 3:176611962-176611984 GTGGTTCCCAGGGATTGAAGTGG + Intergenic
967379776 3:188844563-188844585 GTGATTCCAAGGGAATTGAGAGG + Intronic
968907376 4:3460875-3460897 GTGATTCCAAGGGGATGATGGGG - Intergenic
970396695 4:15675011-15675033 GTGATTCCTAGTGAACTGATGGG - Intronic
974775934 4:66480998-66481020 GTGAGACATAGGGAAAGGAGTGG + Intergenic
975895605 4:79086326-79086348 TTGTTTCCTAGGGAATAGAGTGG + Intergenic
977959084 4:103064474-103064496 GTGATTACCAGGGACTGGGGAGG + Intronic
977990766 4:103438698-103438720 GTGATTACTAGGGTCTGGGGAGG - Intergenic
978920034 4:114173076-114173098 TTGAGTCCTAGGGGAAGGAGGGG + Intergenic
980529474 4:134033330-134033352 TTGTTTCTTAGGGAATGGGGAGG - Intergenic
980702935 4:136456155-136456177 GTGATTACTAGGGGCAGGAGTGG + Intergenic
980733115 4:136848182-136848204 GTGATACCCAGGGTCTGGAGTGG - Intergenic
980776313 4:137440994-137441016 GTGATTTCTAGGGGTTGGAGGGG + Intergenic
981155028 4:141424813-141424835 ATGATTCCATTGGAATGGAGAGG + Intergenic
984104312 4:175526073-175526095 GTGTTTTCCAGGGAATGGTGGGG - Intergenic
984366009 4:178801208-178801230 GTCAATCCCATGGAATGGAGTGG + Intergenic
986002328 5:3640038-3640060 GTGATTGCCAGGGCAGGGAGGGG - Intergenic
986609420 5:9551832-9551854 GTGATTCCTTACCAATGGAGGGG + Intergenic
988865748 5:35332573-35332595 GTGATTCCGAGGTAATGGGAGGG - Intergenic
991280180 5:64904554-64904576 GTGATTCCTTTGGTATGGTGGGG + Intronic
991469879 5:66956538-66956560 GTAACTCATAGGGAATGCAGGGG + Intronic
991772083 5:70049907-70049929 GTGGTTCGCAGGGAACGGAGTGG - Intronic
991851376 5:70925325-70925347 GTGGTTCGCAGGGAACGGAGTGG - Intronic
995474441 5:112533709-112533731 CTGACTCATAGGGATTGGAGAGG + Intergenic
996150287 5:120026450-120026472 GTGCTTGCTAGGGACTGGGGTGG - Intergenic
997032402 5:130146433-130146455 GTGATTACCAGAGACTGGAGAGG + Intronic
999132798 5:149297338-149297360 GTGATCCCTAGGGATCAGAGTGG - Intronic
999659607 5:153846507-153846529 GTGGTTACTAGAGATTGGAGAGG - Intergenic
1000535593 5:162474237-162474259 GTAATTCATAGGGATTGGATGGG - Intergenic
1000765466 5:165283894-165283916 GTGAATAACAGGGAATGGAGAGG + Intergenic
1001241677 5:170076091-170076113 GTGGTTCCTATGGCTTGGAGGGG + Intronic
1006435039 6:34021670-34021692 GTGAGGCCTTGGGCATGGAGGGG - Intronic
1007402533 6:41611750-41611772 GTGGTTGCCAGGGACTGGAGGGG + Intergenic
1010522244 6:76852039-76852061 GTGATTACCAGAGACTGGAGAGG + Intergenic
1013086375 6:106861347-106861369 GCCAGTCCTGGGGAATGGAGGGG - Intergenic
1015373662 6:132485195-132485217 GTGATTGCTTGGTGATGGAGGGG - Intronic
1017250225 6:152272310-152272332 GCCATGCCTAGGGAATGCAGAGG + Intronic
1018619412 6:165715536-165715558 TAGATTCCAAGGGAATGAAGGGG + Intronic
1021586718 7:22216395-22216417 GTGATTCCTAGGGAATGGAGAGG - Intronic
1024608033 7:51038866-51038888 GTCATTCAGAGGGGATGGAGAGG + Intronic
1024998417 7:55294211-55294233 GTGATACCCAGGGTCTGGAGGGG - Intergenic
1025008218 7:55372028-55372050 GTGGTTCCTTGGGTTTGGAGTGG - Intronic
1026329136 7:69336899-69336921 GGAATTCCCAGGGAATGCAGTGG - Intergenic
1026351239 7:69517201-69517223 GTGATCCCTAAGGGATGGGGAGG + Intergenic
1026926553 7:74198089-74198111 GTGATTTCTAGGGAATAGCCTGG + Intergenic
1029277160 7:99413174-99413196 GTAATTCCTAGGTAATAGAATGG + Intronic
1029485307 7:100836483-100836505 GTCAGCCTTAGGGAATGGAGCGG - Intronic
1030314044 7:108096171-108096193 GTGGTTGCTAGGGATTAGAGGGG - Intronic
1030890809 7:114996735-114996757 ATGATTCATTTGGAATGGAGTGG + Intronic
1032751661 7:134847432-134847454 GAGACTCCCAGGGAAGGGAGTGG - Intronic
1034580658 7:152039188-152039210 GTGATTCCTATGGAATTGATTGG - Intronic
1035554434 8:555620-555642 GTGATTCCTGGGGGATGGTGGGG + Intergenic
1042934306 8:74043279-74043301 GTGATTCTCAGTGAATGAAGAGG + Intergenic
1043675430 8:82946562-82946584 GTGGTTGCTAGGGATTAGAGAGG + Intergenic
1046587754 8:116168419-116168441 GTGCTTCTTAGCAAATGGAGAGG + Intergenic
1046687531 8:117244077-117244099 GTGAGTCCTCTGGTATGGAGAGG + Intergenic
1048021259 8:130541509-130541531 TGGATTCCCAGGGGATGGAGTGG + Intergenic
1049581745 8:143414895-143414917 GTGCTTCAGAGGGAATGGGGAGG + Intergenic
1050771425 9:9206190-9206212 GTGAGTGATAGGGAAGGGAGTGG + Intronic
1051082457 9:13309099-13309121 GTAATTCCCAGGGTTTGGAGAGG - Intergenic
1051251923 9:15168298-15168320 GTGATTCCTTGGGCCTGGAATGG - Exonic
1051510340 9:17870632-17870654 GTGATTCCCCTGGGATGGAGAGG - Intergenic
1051936328 9:22447052-22447074 GAAATTTCTCGGGAATGGAGCGG + Exonic
1052282771 9:26752226-26752248 GTGGTTGCTAGGGACCGGAGAGG + Intergenic
1052405387 9:28053214-28053236 CTGAGTCCTGGAGAATGGAGAGG + Intronic
1054972538 9:71105469-71105491 GGGTTTCCTAGGGAATGGCAAGG + Intronic
1055347429 9:75353334-75353356 TTGATGTGTAGGGAATGGAGGGG + Intergenic
1056805167 9:89722840-89722862 GTGATTACTGGGGAAGGGAGGGG - Intergenic
1056993681 9:91434924-91434946 GGGTTTCCTAGGGAATGTGGAGG + Intergenic
1057047192 9:91895232-91895254 GTGATTGCCAGGGATTGGGGAGG + Intronic
1057471985 9:95366201-95366223 CTGTTTCCTGGGGACTGGAGGGG - Intergenic
1057506877 9:95641835-95641857 ATGATTCCTCCGGAAAGGAGGGG + Intergenic
1058609098 9:106755695-106755717 GAAACTCCTAAGGAATGGAGAGG + Intergenic
1058775232 9:108276809-108276831 ATGGTTCCTAGAGAATGGAATGG + Intergenic
1062126153 9:134864130-134864152 GTGGTTCCCAGGGGAGGGAGAGG - Intergenic
1062147776 9:134999565-134999587 GTGAGTCTGAGGGAATGGAGGGG - Intergenic
1203425777 Un_GL000195v1:35633-35655 GTGGTTCCTAGGAGCTGGAGGGG - Intergenic
1203723692 Un_GL000216v2:32444-32466 GTTATTCTAATGGAATGGAGTGG - Intergenic
1203675758 Un_KI270756v1:20946-20968 ATGATTCAAATGGAATGGAGTGG - Intergenic
1186303479 X:8227503-8227525 GTGTATCCTATGGAAGGGAGGGG + Intergenic
1188123994 X:26345304-26345326 GTGATTCCTAGACAATGAATTGG + Intergenic
1189576492 X:42359206-42359228 GTGAATCCCAGGGAATGAAGTGG - Intergenic
1193646396 X:84074339-84074361 GTGGTTACTAGGGAATGAGGAGG + Intronic
1193847038 X:86485352-86485374 GTGATTGCCAGAGAATGGGGAGG + Intronic
1194001264 X:88432379-88432401 GTGGTTACTAGGGACTGGGGTGG - Intergenic
1194047243 X:89023830-89023852 GTGTTTCATAAAGAATGGAGTGG + Intergenic
1194652662 X:96534024-96534046 GTGATTACCAGGGACTGGGGCGG + Intergenic
1195027558 X:100893156-100893178 GTGACTACTAGGGACTGGGGTGG + Intergenic
1197892652 X:131281616-131281638 GGGATCCCTGGGGTATGGAGGGG + Intronic
1199489888 X:148386762-148386784 GTGATCCCGAGGGAAAGGAGAGG + Intergenic
1201121302 Y:10875580-10875602 GAGATTCCATTGGAATGGAGGGG - Intergenic