ID: 1021586720

View in Genome Browser
Species Human (GRCh38)
Location 7:22216400-22216422
Sequence TCCTGGTGATTCCTAGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021586720_1021586724 1 Left 1021586720 7:22216400-22216422 CCATTCCCTAGGAATCACCAGGA 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586720_1021586725 2 Left 1021586720 7:22216400-22216422 CCATTCCCTAGGAATCACCAGGA 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021586720 Original CRISPR TCCTGGTGATTCCTAGGGAA TGG (reversed) Intronic
903794784 1:25920491-25920513 TCCAGGTTGTTGCTAGGGAATGG - Intergenic
904772962 1:32891125-32891147 TCCTGAGGATGCCCAGGGAATGG - Intronic
906281129 1:44554631-44554653 TTCAGATGATTTCTAGGGAAAGG - Intronic
906825992 1:48981016-48981038 TCCTGGTAATTCCTACAGATTGG + Intronic
909364312 1:74801533-74801555 TCCTGGAAATTCCTAAGCAAAGG - Intergenic
910783449 1:90967480-90967502 TCCCTGTGATTCCAAGAGAATGG + Intronic
910820257 1:91338065-91338087 CCCTGGTGGCTCCTGGGGAAGGG + Intronic
911513402 1:98836775-98836797 TCCTGTTGCTTCCTAGAGAAAGG - Intergenic
915568701 1:156732082-156732104 TGCTGGGGATGCCTGGGGAAGGG + Exonic
919531578 1:198727753-198727775 TCCTGCCCTTTCCTAGGGAAAGG - Intronic
920056898 1:203199439-203199461 TCTTGGTGAATCCGAGGGACAGG - Intergenic
920568977 1:207002009-207002031 TGCAGGTGCTTCCTAGGTAAGGG - Intergenic
924429864 1:243987836-243987858 TCCAGGTGATTTGTAGGAAATGG + Intergenic
1063002900 10:1941339-1941361 CCCTGGAGATTCCAGGGGAATGG - Intergenic
1063152238 10:3347321-3347343 TCCTGGAGATTCCCAGGAGAGGG - Intergenic
1063758238 10:9040923-9040945 TCCCAGTGATCCCTACGGAATGG + Intergenic
1066402954 10:35092695-35092717 TCCTGGTCATTCCTGGGCATAGG + Intergenic
1067572453 10:47381424-47381446 TCCTGGGGTTTCCTAAGAAAGGG + Intronic
1069212832 10:65782962-65782984 TCCTAGTCATTCCTCAGGAAAGG + Intergenic
1069812913 10:71175706-71175728 TCCTGGGCATTTTTAGGGAAGGG - Intergenic
1072299351 10:94044258-94044280 TCAAGGTGATTCCTTGGAAAGGG - Intronic
1073084382 10:100879022-100879044 ACCTGGAGATCCCTGGGGAAAGG - Intergenic
1074973326 10:118560928-118560950 TCTTGGGGTTTCCAAGGGAAAGG - Intergenic
1077218973 11:1407038-1407060 TCCTAGGGTTTCCCAGGGAAGGG + Intronic
1077395047 11:2316505-2316527 TCCTGATGCTTCCTGGGGAGGGG + Intronic
1078458542 11:11494995-11495017 TCCTGGTTTTGCCTAGGGAAGGG + Intronic
1081715543 11:45247373-45247395 TCCTTGGGATTTCGAGGGAAGGG - Intronic
1083693988 11:64430351-64430373 CCCTGGTGATTCCAAGGTCACGG - Intergenic
1084666886 11:70581118-70581140 TCATGGTGATTTCTGGAGAAGGG - Intronic
1086027961 11:82317903-82317925 TCCTGGTGATTTTTGGGGATAGG - Intergenic
1088034530 11:105296039-105296061 TGCTGGGGATACCCAGGGAAAGG - Intergenic
1089014941 11:115157933-115157955 ACTTGGTGAGTCCTAGGGAGTGG + Intergenic
1089694638 11:120209719-120209741 TCCAGGTGATTCTTCAGGAAAGG + Intergenic
1089740175 11:120576991-120577013 TTCTGGTGACTCCTGGGGAGAGG - Intronic
1089812516 11:121143576-121143598 GCCTGGGAACTCCTAGGGAAAGG + Intronic
1090615512 11:128510794-128510816 TGCTGGTGTTTCCTTGGGAGTGG - Intronic
1091917434 12:4279942-4279964 TACTGGTGAGTTCTACGGAACGG + Intronic
1096805210 12:54136414-54136436 TCCTGGTCTTTCCTCGGGAAAGG + Intergenic
1098098509 12:66987104-66987126 TCCTGGAGCTTTCTAGGAAAGGG + Intergenic
1099718626 12:86331682-86331704 TCCTGGTGGTTGGTAGGGAGGGG + Intronic
1101156231 12:101930118-101930140 TCATGGTGAGGCCCAGGGAAAGG + Intronic
1101780030 12:107826904-107826926 TCCTGCTGGTCCCTAGGAAATGG - Intergenic
1103002559 12:117396396-117396418 ACCTGGTGTTTACTAGGGTAAGG + Intronic
1103327422 12:120130817-120130839 TCCTGGAGATTACTAGGAACTGG - Intronic
1105840309 13:24248307-24248329 ACCTGCTGTTTCCCAGGGAATGG + Intronic
1107059931 13:36148913-36148935 TCCTGGTCTTTCTTAGGCAAGGG - Intergenic
1113270582 13:108669179-108669201 TCCTGGTCATTCCTTGTGATTGG - Intronic
1114588260 14:23834853-23834875 TCCTGGTGTGTCCTAGGGGGAGG - Intergenic
1114595030 14:23904488-23904510 TCCTGGTGTGTCCTAGGGGGAGG + Intergenic
1114721850 14:24891094-24891116 TCCAGGAGTTTCCTAAGGAAGGG + Intronic
1115869039 14:37779144-37779166 TCCCAGTGACTCCTGGGGAAAGG - Intronic
1116090377 14:40296447-40296469 TCCAAGTGTCTCCTAGGGAAAGG - Intergenic
1117499293 14:56336288-56336310 TCCTGGTGAGCCCCAGGGATTGG - Intergenic
1118209639 14:63753403-63753425 TCCTGTTCATTCCTAGGCATAGG - Intergenic
1118552690 14:66973261-66973283 TCCAGGTTAATCCTAGGGCAGGG + Intronic
1119072976 14:71606432-71606454 TGCTGTTGATCCCTAGGGCAGGG + Intronic
1124607388 15:31179832-31179854 CCCTGGTGCTTCCTAGGTGAAGG - Intergenic
1124659244 15:31531947-31531969 CCCTGTTGATACCTGGGGAATGG - Intronic
1125920096 15:43520286-43520308 TCCTGGTGCTGCCTGGGGATGGG - Intronic
1126438671 15:48663568-48663590 CCAAGGTCATTCCTAGGGAAGGG + Intergenic
1126469100 15:48988046-48988068 TCCTGGGGCTACTTAGGGAAAGG + Intergenic
1130862093 15:87900267-87900289 TCCTGGCATTTCCCAGGGAAAGG - Intronic
1131293052 15:91123920-91123942 GCCAGGTGATTTCTAGGTAAGGG - Intronic
1132108881 15:99087660-99087682 GACTGGTGCTTCCCAGGGAAGGG - Intergenic
1133671279 16:8023418-8023440 TCCTGATGTTTCCTATAGAAAGG - Intergenic
1133854564 16:9537392-9537414 TCCTGCTTAGTCCTAAGGAAGGG + Intergenic
1134001524 16:10786703-10786725 TCCTGGTGATGACTGGGGATGGG + Intronic
1137818239 16:51420028-51420050 TGCTGGTGAATCCTAGGGTGAGG + Intergenic
1141431446 16:83972218-83972240 TCCTCGTGCTTCATGGGGAAGGG + Intronic
1146235985 17:31162873-31162895 AACTGGGGATTCCCAGGGAAGGG + Intronic
1146821566 17:35986927-35986949 TCATGTTCATGCCTAGGGAAAGG - Intronic
1147390386 17:40105823-40105845 TCCTGGTGTTTCCCAAGCAATGG + Intergenic
1147782536 17:42953991-42954013 TCCTGGTGAATCCTATTTAAGGG - Intronic
1148436906 17:47692519-47692541 TCTTGGGGAGTACTAGGGAAAGG + Intergenic
1149794449 17:59506363-59506385 TGCAGGTGATTCCTTGGGAGAGG + Intergenic
1151102182 17:71568581-71568603 TCCTGTTGAATACTAGGCAATGG + Intergenic
1157796326 18:50578905-50578927 ACCTGGTGTTTGCTAGGGGAAGG + Intronic
1158024045 18:52874882-52874904 TACTGGTGTTTCTTTGGGAAAGG + Intronic
1158597921 18:58832513-58832535 TACTGGAGTTTCCTCGGGAAAGG - Intergenic
1159968954 18:74625439-74625461 TCCTGCTGGTGCCTAGTGAAAGG + Intronic
1161276495 19:3421218-3421240 TCCGGGTGTTTCCCTGGGAAGGG - Intronic
1162128879 19:8513400-8513422 TGCTGGTGATTCCTTAGGATGGG - Intronic
1162305057 19:9867407-9867429 TCCTGGTGTTTCCCTGGGGACGG + Intronic
1163230429 19:15998203-15998225 TACTGGAGATTCCTAGGGCCTGG + Intergenic
1164560525 19:29288963-29288985 TCATGGTGACTCCAATGGAAAGG - Intergenic
1166746308 19:45143463-45143485 TCCGGGTGCTTCCTGGGGAGGGG - Intronic
927712664 2:25335458-25335480 TCCTGGGGAATACTTGGGAACGG - Intronic
929221109 2:39465960-39465982 TCCTTGTGGATCCTAAGGAAAGG - Intergenic
931235268 2:60407414-60407436 TCCTCTTGCTCCCTAGGGAAGGG - Intergenic
931690862 2:64833862-64833884 TTCTGGTGATTGCTTTGGAATGG + Intergenic
932088583 2:68784593-68784615 TCCTGGTGATTCCCTGGGGTAGG - Intronic
935209130 2:100923445-100923467 TCCTCGTGATGTCTAGGGAAAGG + Intronic
935359316 2:102234082-102234104 CCCTGATGATTGCTTGGGAAAGG - Intronic
937008710 2:118542558-118542580 TCCATGGGATTCTTAGGGAATGG - Intergenic
937470037 2:122166774-122166796 TCCTGGTAGTTCTAAGGGAAAGG + Intergenic
937477958 2:122231669-122231691 TCCCAGTGTTTCCAAGGGAAGGG + Intergenic
940283800 2:152013693-152013715 TCTTGCTGATTCCTTGGTAATGG - Intronic
942507879 2:176662874-176662896 TCCTGGTGCTTCCTCCAGAAAGG + Intergenic
945844932 2:214932368-214932390 TGCTGGTGATTCTTATGCAAAGG - Exonic
947793426 2:232880275-232880297 ACCTGGTGATCTCTAGGGGAGGG - Intronic
948721689 2:239904820-239904842 TCCTGGAGACTTCTAGGGGAGGG + Intronic
1169646173 20:7812462-7812484 TGCTGGTGATACCCAGGCAAAGG - Intergenic
1169993442 20:11529217-11529239 TACTGGTGATTGATTGGGAAGGG - Intergenic
1170555505 20:17511905-17511927 ACCTGGAGACTCCCAGGGAAGGG - Intronic
1171256797 20:23694809-23694831 TCCTGCTGGTCCCTAGGCAATGG - Intergenic
1173187588 20:40852837-40852859 TCCTGGTGACTCCTGGGGATGGG - Intergenic
1175261648 20:57678403-57678425 TTCTGGTGATGCCAAGGGACAGG - Intronic
1175901520 20:62361695-62361717 TCCTGGTGCTTCTTAGGTCAGGG - Intronic
1176024730 20:62980003-62980025 TCCTGGAGATGACTAGGGACAGG - Intergenic
1177752920 21:25308424-25308446 TCCTGGAGATTACAAGTGAAGGG - Intergenic
1178358169 21:31925678-31925700 TCCTGTTGTTTCCTAGGAAGGGG + Intronic
1179728109 21:43351733-43351755 TCTTGGGGTTTCCTTGGGAAAGG - Intergenic
1182281734 22:29221257-29221279 GCCTGGTGGTTCCTACTGAAGGG - Intronic
1182816302 22:33167128-33167150 TCCTGGAAATTCCTAGGATATGG - Intronic
1183566909 22:38622076-38622098 GTCTGGTCATTGCTAGGGAATGG - Intronic
1184904850 22:47474771-47474793 TCCTTCTGATACCAAGGGAATGG - Intronic
949949426 3:9216985-9217007 GACTGGTGATTGCCAGGGAATGG + Intronic
950738720 3:15032545-15032567 TCCAGGTCATTCCTAGGGAGAGG - Intronic
951860112 3:27242558-27242580 TCCTGTTGGCTCCTAGGGGAAGG + Intronic
954760222 3:52868392-52868414 TCCAGGTGATTCTTATGGCAGGG + Intronic
962270966 3:133977879-133977901 TCCTGGTGATGCCTGGTGACTGG - Intronic
964642016 3:158918537-158918559 TCCTTGTCATTCCTAGAGTAAGG - Intergenic
969600946 4:8176089-8176111 TCCTGGGGCTTCCCAGGGCATGG + Intergenic
969726328 4:8920475-8920497 TTCTGGGGATTCTTAGGGGAAGG + Intergenic
971598769 4:28567182-28567204 CCTTGGTGGCTCCTAGGGAAGGG + Intergenic
972840872 4:42928708-42928730 TACTGGTGTTTCCATGGGAAAGG + Intronic
973196177 4:47444826-47444848 TCCTGGTTTCTCCCAGGGAAAGG + Intergenic
975264839 4:72351029-72351051 TCCAGATGAATCCCAGGGAAGGG - Intronic
976102007 4:81574599-81574621 TCCTGGTGATCCCCAGGCACAGG - Intronic
977915687 4:102590132-102590154 TCCTGGTGACCACTAAGGAATGG + Intronic
979125437 4:116966744-116966766 TCCTTGTGCTTCCTAAGAAAGGG - Intergenic
981146883 4:141334093-141334115 TCCAGGATATTCCTAGGCAATGG + Intergenic
981688796 4:147483100-147483122 TCCTGGTGTTCCCTTTGGAATGG + Intronic
982092997 4:151896658-151896680 TCCTGGTCCTTCCTTGGGCAAGG - Intergenic
983516559 4:168663338-168663360 TCCTGTGGGTTCCTAGGCAAAGG - Intronic
986338673 5:6772826-6772848 TCCTGGTGATGGCAAAGGAAGGG + Intergenic
987020680 5:13867652-13867674 TCCTAGGAATTCCCAGGGAATGG - Intronic
989558989 5:42829589-42829611 TCCTGGTAATGCCTAGGGCATGG + Intronic
990917379 5:60924345-60924367 TCTGGTTGATTCCTAAGGAATGG + Intronic
997457884 5:134030975-134030997 CCCTTGGGATCCCTAGGGAAGGG - Intergenic
1000257931 5:159558574-159558596 TCCTGGTTTTTCCAAGGGAATGG - Intergenic
1003674663 6:8192246-8192268 TCCTGCTGATTCCAACAGAATGG + Intergenic
1008924642 6:56878950-56878972 TACTGGTGATTCTTAGATAATGG - Intronic
1011289698 6:85764002-85764024 TGCTGGTGGTTCCTAGGTAGAGG + Intergenic
1014788222 6:125642011-125642033 TCATGGTGATTCTTAGGAGAAGG + Intergenic
1015985189 6:138877327-138877349 TCCTGGGTGTTCCTAGGGATGGG - Intronic
1016316996 6:142801144-142801166 ACCTGGTGAGTCCCTGGGAAAGG - Intronic
1017053262 6:150413982-150414004 TCCTGGTCATTGCCATGGAAAGG + Intergenic
1018100835 6:160438244-160438266 TCCTGGTGTGTTCTAGGGTAAGG - Intronic
1018218949 6:161559697-161559719 TCTAGGTGATTCTGAGGGAAGGG + Intronic
1019266510 7:120152-120174 TCCTGGTCACTCGCAGGGAAGGG + Intergenic
1021586720 7:22216400-22216422 TCCTGGTGATTCCTAGGGAATGG - Intronic
1026667588 7:72357129-72357151 TCCTTGGCATTCATAGGGAAAGG - Intronic
1029357317 7:100061763-100061785 TCAGGGCGGTTCCTAGGGAAGGG + Intronic
1030076878 7:105744598-105744620 ACCTGGTGATTCCTTGTGATTGG - Intronic
1030100560 7:105941607-105941629 CCCAGGGGATTTCTAGGGAAAGG - Intronic
1030454968 7:109761213-109761235 CCCCAGTGATTCCTAGGGAAAGG - Intergenic
1032393241 7:131570286-131570308 TCTTGATGGTTCCTATGGAAAGG - Intergenic
1035192115 7:157179199-157179221 TCCTGGTCATTCTGAGTGAATGG + Intronic
1035996440 8:4552541-4552563 TACTAGTGCTTCCCAGGGAATGG - Intronic
1036107404 8:5855886-5855908 TCGTGGTGATTCCTTGAGATTGG - Intergenic
1038859968 8:31376092-31376114 TCCCAGTGACTCCTGGGGAAGGG - Intergenic
1043738218 8:83774615-83774637 CCCGGGTGATTCCTGGGGAATGG + Intergenic
1045723326 8:105139999-105140021 TTCTGGGGTTTCCTAGAGAACGG + Intronic
1046612857 8:116445008-116445030 TCCTGTTGACTCCAAGAGAAAGG - Intergenic
1046630049 8:116614895-116614917 TCATGGTGTTTCCTAGTGAGGGG - Intergenic
1049325887 8:142021250-142021272 TCCTGGGGGTCCCCAGGGAAGGG + Intergenic
1050298326 9:4230044-4230066 TCCTTGGCATTCCTGGGGAAAGG + Intronic
1050518591 9:6472522-6472544 TCCTGAAGATTCCTTAGGAAGGG - Intronic
1053283635 9:36837074-36837096 TCTGGGGGATTTCTAGGGAATGG + Exonic
1053428396 9:38026051-38026073 TCCTGATCCTTCCTTGGGAAGGG - Intronic
1054972537 9:71105464-71105486 TGCTGGGGTTTCCTAGGGAATGG + Intronic
1060124221 9:121026585-121026607 TACTGGTGTTTACTAGGGAGAGG - Intronic
1061825985 9:133258482-133258504 CCCTGGTTGTTCCCAGGGAAAGG + Intronic
1062594670 9:137293967-137293989 TCCTGGTTCTTCCAAGGGCATGG - Intergenic
1185954317 X:4472710-4472732 TCATGGTGACTTCTAGGAAAGGG - Intergenic
1187262651 X:17701565-17701587 TCCTGGGGGTGCCTAGGGATTGG + Intronic
1189308190 X:40003052-40003074 TCCTGCAGCCTCCTAGGGAATGG + Intergenic
1189753609 X:44248350-44248372 TGATGGTGACTCCTAGGGACAGG + Exonic
1192416827 X:70988581-70988603 TCCAGGTTATTGCTATGGAAAGG + Intergenic
1194130484 X:90074700-90074722 TCCTGTTGGCTCCTGGGGAAGGG - Intergenic
1194145390 X:90255450-90255472 TTCTGCAGATTTCTAGGGAAGGG + Intergenic
1194376285 X:93137484-93137506 TCCTGGAGATCCTTGGGGAATGG + Intergenic
1199684581 X:150254862-150254884 TCTTGGTGATGCCTAAGGGAGGG + Intergenic
1200491148 Y:3824748-3824770 TTCTGCAGATTTCTAGGGAAGGG + Intergenic