ID: 1021586721

View in Genome Browser
Species Human (GRCh38)
Location 7:22216405-22216427
Sequence TGCAGTCCTGGTGATTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021586721_1021586725 -3 Left 1021586721 7:22216405-22216427 CCCTAGGAATCACCAGGACTGCA 0: 1
1: 0
2: 0
3: 14
4: 114
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586721_1021586724 -4 Left 1021586721 7:22216405-22216427 CCCTAGGAATCACCAGGACTGCA 0: 1
1: 0
2: 0
3: 14
4: 114
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021586721 Original CRISPR TGCAGTCCTGGTGATTCCTA GGG (reversed) Intronic
901684279 1:10935033-10935055 TGCAGTCCTGGGGATGCTTGGGG + Intergenic
901754416 1:11432693-11432715 TGCAGCCCTGCTGATGCCAAGGG - Intergenic
903069690 1:20720998-20721020 GGGTGCCCTGGTGATTCCTAGGG + Intronic
904212848 1:28897257-28897279 ACCAGGCCTGGTGATTCCTGAGG - Intronic
910724251 1:90322083-90322105 TGCAGTCCTGGTGATTTGGAAGG + Intergenic
911550693 1:99275940-99275962 GTCAGTCCTTGTGATTCTTAGGG - Intronic
911753033 1:101520704-101520726 GGCACTCCTGATGATTCCTGTGG + Intergenic
919942965 1:202301003-202301025 TGCCTCCCTGGTGCTTCCTAGGG - Intronic
923989317 1:239417381-239417403 TGCAGATCTGGTGATTCAGAAGG - Intronic
924120514 1:240793154-240793176 TACAGCCCTGGGGGTTCCTAAGG - Intronic
924255681 1:242180601-242180623 AGCCGTCCAGGTGATTCCTATGG - Intronic
1066117581 10:32254011-32254033 TGCAGTCCTGGAGGTTGCCAAGG - Intergenic
1066490468 10:35889179-35889201 TCCAGTCCTAGTGTTTCCAAAGG + Intergenic
1068466102 10:57394451-57394473 TGCTTTCCTGGTGATTCTTATGG - Intergenic
1070195534 10:74152809-74152831 TGCAGTCCTGGTGCTTTGTGAGG + Intronic
1070287598 10:75095096-75095118 TCCAGTCCAGGTGCTTCCTCAGG + Intronic
1076485865 10:130816600-130816622 TGCAGACCTGGTGATGACTGAGG - Intergenic
1076674760 10:132142175-132142197 TGCAGTCCTGGTGGTGCCCATGG + Intronic
1077173973 11:1180507-1180529 GCCAGTCCTGGTGAGTCCTTTGG + Intronic
1077263676 11:1637708-1637730 TGTAGACCTGGTGATTCTTGTGG - Intergenic
1077296041 11:1826711-1826733 TCCTGTCCTGGGGATTCCTGGGG - Intergenic
1079890144 11:26042245-26042267 TGCTGTCCGGGTGCTTCCTGGGG + Intergenic
1081915158 11:46726031-46726053 TGAAGTCCTGGTGCTTGCTCAGG - Exonic
1082193498 11:49274295-49274317 GGCGGTCATGGGGATTCCTATGG + Intergenic
1084555437 11:69872924-69872946 TGCAGTGCAGGGGATTTCTAGGG + Intergenic
1085888670 11:80551687-80551709 AGCAGTAGTGTTGATTCCTAAGG - Intergenic
1088147664 11:106702287-106702309 TGCAGTTCTCTTAATTCCTAGGG + Intronic
1094358389 12:29602899-29602921 TGTAGTACTGATGATTCCAATGG - Intronic
1096208010 12:49739661-49739683 TCCAGCCCTGTCGATTCCTAAGG - Intronic
1106755929 13:32822457-32822479 TGCTGGCCTGGAGCTTCCTAGGG - Intergenic
1108443648 13:50483512-50483534 TGGAGTCCTGGTTCTTTCTATGG - Intronic
1112151866 13:96773168-96773190 TGCAGACCAGGAGATTCCTTTGG + Intronic
1113131613 13:107043070-107043092 TGCAGACCAGGAGATTCCTTTGG - Intergenic
1118983991 14:70738002-70738024 TTTAGGCCTTGTGATTCCTATGG - Intronic
1119711564 14:76826308-76826330 TGCAGTCATTGTGATTCACATGG - Intergenic
1122533065 14:102442585-102442607 CACTGTCCTGGTGATTCCTCTGG - Intronic
1124432737 15:29621034-29621056 TGCAGTAATGGTGGTGCCTAAGG - Intergenic
1125429494 15:39581018-39581040 CGCATTCCTGGGGATTCCTCCGG - Intergenic
1129513616 15:76142944-76142966 TGCAGTCCTGGTTAGTCCCAAGG + Intronic
1130650157 15:85757917-85757939 TGGAGTCCTGGAGTTTCCTCGGG + Intergenic
1131113404 15:89779045-89779067 TGCATTCCTGGTGACTGCTGGGG + Intergenic
1135174058 16:20212524-20212546 CTCAGTCCTGATGATGCCTAAGG - Intergenic
1135693715 16:24567393-24567415 TGCACTCCTGATGATACCCAAGG - Exonic
1139954080 16:70685175-70685197 TGGAGTCCTGGAGCTTCCTGGGG + Intronic
1142006183 16:87690578-87690600 TGCTGACCTGGTGTTTCCTGAGG + Intronic
1143496129 17:7313636-7313658 GGCAGTCCTGGTGGTGCCTATGG - Exonic
1149182369 17:53954705-53954727 TTCAGCCCTGGTAATTCATAAGG + Intergenic
1149680578 17:58504290-58504312 AGCATTCCTGGTAAGTCCTAAGG - Exonic
1155348158 18:24878954-24878976 TGGAAACCTGGTGATTCTTAAGG + Intergenic
1155843806 18:30680100-30680122 TGCAGGCCTCGTAATTCCTTTGG + Intergenic
1159868044 18:73729120-73729142 TGCAGACTTGGTGAATCCTGAGG + Intergenic
1161140219 19:2642837-2642859 TGCATTCCCGGTGCTTCCTGGGG - Intronic
1164868596 19:31625409-31625431 TGCTCTGCTGGTGATTCCCAGGG + Intergenic
1167932800 19:52881249-52881271 TTCAGTCCTCGTAATTCATAAGG - Exonic
926858015 2:17278688-17278710 TGCATCCCTGGTGTTTCCTTGGG - Intergenic
929126787 2:38529610-38529632 TGCAGTGCTGGGGATTACCAGGG - Intergenic
930209198 2:48617233-48617255 TGCTCTCCAGGTGATTCCAATGG - Intronic
933862389 2:86482950-86482972 TCCAGGCTTGGTGATTCCTATGG + Intronic
938684724 2:133727230-133727252 TGCAGTCCTGATGATTTGTGGGG - Intergenic
944217793 2:197273147-197273169 TGCAGGCCTGGTGAATACTGAGG - Intronic
1169320103 20:4625459-4625481 TGCAGACCAGGAGATTCCTCAGG - Intergenic
1171844002 20:30252487-30252509 AGCAGTCCTGGAGATTGTTAAGG - Intergenic
1177708177 21:24736562-24736584 TCCAGTTGTGGTGATTCCTCAGG + Intergenic
1181702723 22:24629845-24629867 CGAAGACCTGGTGATTCCAAAGG + Intergenic
1183511763 22:38239526-38239548 TGCAGTGCTGATTTTTCCTAGGG - Intronic
1183954230 22:41369531-41369553 TGCAGTCATTGTGAGTCCTGTGG - Intronic
949564060 3:5228949-5228971 AGCACTCCAGGTGATTCCTCGGG + Intergenic
951118188 3:18890492-18890514 AGCACTCCTGCTGATCCCTAAGG - Intergenic
954133767 3:48572723-48572745 GGCAGACCTGGTGACCCCTATGG + Exonic
958091015 3:88875983-88876005 TGAAGATCTGGTCATTCCTAAGG + Intergenic
959448368 3:106467841-106467863 TGCAGTCCTGGTGACCCAGATGG + Intergenic
959641733 3:108645745-108645767 TTCAGTCCTGGTATTTACTAAGG + Intronic
962363089 3:134757802-134757824 TGCAGACCTAATGACTCCTATGG - Intronic
962607040 3:137041101-137041123 TGAAGTCATGGTGATCCGTATGG + Intergenic
964904784 3:161707092-161707114 TGCAGACCAGGAGATTCCTTTGG + Intergenic
969909238 4:10428212-10428234 TGCAGTCCAGGAGATTCCCTTGG - Intergenic
971546172 4:27890241-27890263 TGCAGGGCTGGGGATTCCTCAGG - Intergenic
972387353 4:38580236-38580258 TGCAGTGTTGCTGATTCCAATGG - Intergenic
977427943 4:96892774-96892796 TGCAGTCCTGGTTATTCTGGAGG - Intergenic
979276616 4:118821984-118822006 TGCTTTTGTGGTGATTCCTAGGG - Intronic
981061343 4:140428010-140428032 TGCAGTCATGGTGATTAATAAGG + Intergenic
981688795 4:147483095-147483117 TGGAGTCCTGGTGTTCCCTTTGG + Intronic
983711731 4:170725559-170725581 TGCTGTCCAGGGGATTCCTCGGG + Intergenic
986317402 5:6599758-6599780 AGCAGTCCTGGTCATTCAGAAGG + Exonic
994142912 5:96361469-96361491 TGCAGTCCAGGAGATTCCCTTGG - Intergenic
994584719 5:101692297-101692319 TGTTGCCCTGGTGATTCCCAGGG + Intergenic
994739295 5:103597686-103597708 TGCAGTCCATGTGATTCACATGG + Intergenic
995265425 5:110153345-110153367 AGCAGCTCTGGTGATTCCTGGGG + Intergenic
1000917380 5:167098929-167098951 TGCAGAGCTGCTGATTCCTCAGG - Intergenic
1001228166 5:169963441-169963463 TGCATTCATGGTGACTCCTCTGG + Intronic
1002319582 5:178366949-178366971 TGCATTCCAGGTGTCTCCTACGG + Intronic
1007116879 6:39349202-39349224 GGCATTCCTGGAGATTCCTTAGG - Intronic
1007372879 6:41438280-41438302 TGCAGTCTTGGAGAGACCTAGGG + Intergenic
1013691240 6:112647343-112647365 TTCAGTACTGGTGATACTTAAGG + Intergenic
1015216832 6:130759936-130759958 GGCACTCCTGTTGATTCCTGGGG - Intergenic
1015682047 6:135819111-135819133 TGCTGTCATGGTGATACCTGAGG + Intergenic
1019012479 6:168852936-168852958 TGCAGAAAAGGTGATTCCTATGG - Intergenic
1020641196 7:10755847-10755869 GGCAGTCCTGATGATTCTGATGG - Intergenic
1021586721 7:22216405-22216427 TGCAGTCCTGGTGATTCCTAGGG - Intronic
1022095233 7:27136574-27136596 TGCTCTGCTGGCGATTCCTAGGG + Intronic
1028472895 7:91224035-91224057 AGCAGTCTTGCTGAATCCTAGGG + Intergenic
1029486371 7:100844752-100844774 TCCAGCCCCGTTGATTCCTAAGG - Intronic
1041515746 8:58697015-58697037 TCCAGCCCCGTTGATTCCTAAGG - Intergenic
1043668782 8:82853852-82853874 TTAAATTCTGGTGATTCCTACGG - Intergenic
1044940311 8:97335276-97335298 TGCAGACCAGGAGATTCCTTTGG - Intergenic
1044959758 8:97518650-97518672 AGCACTCCTGGTGATTCTTGTGG + Intergenic
1045676501 8:104614072-104614094 TGCTGTCCTTGTGCTTCCTGGGG + Intronic
1046804596 8:118465844-118465866 GGCAGTCCTGGGGATACCTTAGG + Intronic
1048418057 8:134249217-134249239 TCCACTCCTGGTGATTATTATGG - Intergenic
1049983131 9:923080-923102 TGCAGTCCTGGTCATCCTGAAGG - Intronic
1050176656 9:2875860-2875882 GGCAGTCCTGGTGGTGCCTATGG - Intergenic
1052392240 9:27893632-27893654 TGCATTCCAGGTTATCCCTATGG - Intergenic
1052745237 9:32434055-32434077 TTAAGTCCAGGTGATTACTAGGG - Intronic
1053052610 9:34974257-34974279 TGCAGAACTGTTGCTTCCTAAGG + Intronic
1054164096 9:61703342-61703364 AGCAGTCCTGGGGATTGTTAAGG + Intergenic
1057073769 9:92123187-92123209 AGCAGTCCTGGTCATTCAGAAGG - Intergenic
1057556172 9:96089595-96089617 TACAGTCCTGGTGATCCCCATGG - Intergenic
1058702664 9:107613758-107613780 TGCAGTTCTGGTGATACCCATGG + Intergenic
1189292544 X:39896354-39896376 TGGAGTCCTGCTGGTTCCCAAGG + Intergenic
1191799968 X:65067279-65067301 TGCAGACCAGGAGATTCCTTTGG - Intergenic
1194849635 X:98855360-98855382 TTCAGTCCTGATGTTTCCTATGG + Intergenic
1195155222 X:102116036-102116058 TGCAGTCCAGGTGCTTCCTGGGG - Intergenic
1196193105 X:112814396-112814418 TTCACTCCTGGTGTTTCCTAAGG + Intronic
1196363881 X:114900531-114900553 TGCAGTCATTGTCATTCATATGG - Intronic
1199138093 X:144277481-144277503 TTCAGTCTTTGTGCTTCCTAGGG + Intergenic
1199725441 X:150575439-150575461 CGAAGTCCAGGTGATTCATAAGG - Intronic
1200377511 X:155799244-155799266 AGCACTCCTGGTAATCCCTAGGG - Intergenic
1201790405 Y:17833693-17833715 TGCAGCCATGGTGAGTTCTATGG - Intergenic
1201811149 Y:18072296-18072318 TGCAGCCATGGTGAGTTCTATGG + Intergenic