ID: 1021586722

View in Genome Browser
Species Human (GRCh38)
Location 7:22216406-22216428
Sequence CTGCAGTCCTGGTGATTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 5, 3: 27, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021586722_1021586724 -5 Left 1021586722 7:22216406-22216428 CCTAGGAATCACCAGGACTGCAG 0: 1
1: 0
2: 5
3: 27
4: 257
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586722_1021586725 -4 Left 1021586722 7:22216406-22216428 CCTAGGAATCACCAGGACTGCAG 0: 1
1: 0
2: 5
3: 27
4: 257
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021586722 Original CRISPR CTGCAGTCCTGGTGATTCCT AGG (reversed) Intronic
900485917 1:2922705-2922727 CTGCAGCCCTGGAGAGGCCTGGG + Intergenic
900510020 1:3054368-3054390 CTGCAGCCCTGGAAATCCCTTGG + Intergenic
900688731 1:3966392-3966414 CAGCAGTCCTTGGCATTCCTCGG + Intergenic
901684278 1:10935032-10935054 CTGCAGTCCTGGGGATGCTTGGG + Intergenic
905253100 1:36662397-36662419 CAGCAGCCCTTGTCATTCCTTGG + Intergenic
907421066 1:54347754-54347776 CTGCAATCCTTGGCATTCCTTGG - Intronic
908010092 1:59767245-59767267 CTGCAGTCCTGGTGAACAATGGG - Intronic
911550694 1:99275941-99275963 CGTCAGTCCTTGTGATTCTTAGG - Intronic
914934265 1:151964514-151964536 CTGCAGTCCTGGTGGCTCCCTGG - Intergenic
915278034 1:154803065-154803087 CTGCAGCCCAGGTGACTCCATGG - Intronic
916280582 1:163047064-163047086 CAGCAGTCCTTGACATTCCTTGG - Intergenic
917500948 1:175584329-175584351 CTGCAATTCTTGTCATTCCTTGG - Intronic
917504475 1:175615426-175615448 CTGCAGGCCTGGAGATGCTTCGG + Intronic
918149331 1:181784603-181784625 CCTCAGTCCTGGTTATTTCTGGG + Intronic
919942966 1:202301004-202301026 CTGCCTCCCTGGTGCTTCCTAGG - Intronic
922212788 1:223498289-223498311 CTGCAGCCTGGGTGATACCTCGG - Intergenic
1064292095 10:14044577-14044599 CAGCAGTCCTTGGCATTCCTGGG - Intronic
1064536940 10:16366879-16366901 CTCCATCCCTGTTGATTCCTTGG + Intergenic
1064721910 10:18237440-18237462 CAGCAGTCCTTGACATTCCTTGG - Intronic
1065862774 10:29885740-29885762 CTGCAGAGCTGGGGATGCCTGGG + Intergenic
1066159413 10:32713046-32713068 CTGCAGTCCAGGTATTTCGTGGG - Intronic
1066394063 10:35002195-35002217 CTGCATCCCAGGAGATTCCTCGG + Intergenic
1066652960 10:37677124-37677146 CTCCACTTCTGGTGGTTCCTTGG + Intergenic
1073160145 10:101386372-101386394 CTGCAGTTCTGGGGAGGCCTGGG + Intronic
1073429441 10:103476715-103476737 CTCCAGTCCTGGGGATCCCAGGG - Intronic
1073578793 10:104645234-104645256 CTGGAATCCTGGTGATTAATGGG + Intronic
1075733119 10:124648056-124648078 CTGCATTCTTGGTTCTTCCTAGG + Intronic
1075766964 10:124900701-124900723 CTGGAGCCCTGATGATTCCCTGG - Intergenic
1075847405 10:125555794-125555816 CTGCTGGCCTGGTGATTTATGGG + Intergenic
1076330089 10:129657739-129657761 CCGCAGTCCTTGTGGGTCCTTGG - Intronic
1076629699 10:131844878-131844900 CTGCTGTCCTGGAGAAGCCTTGG + Intergenic
1076865804 10:133165776-133165798 CTGGAGTCCTGAGGAGTCCTGGG + Intronic
1077296042 11:1826712-1826734 CTCCTGTCCTGGGGATTCCTGGG - Intergenic
1077880908 11:6349285-6349307 CAGCAATCCTTGTCATTCCTTGG + Intergenic
1078555931 11:12326125-12326147 CTGCTGTACTTGTGATTCCAGGG + Intronic
1078946196 11:16071113-16071135 CTGCTGTCTGGGTGTTTCCTGGG - Intronic
1078946219 11:16071255-16071277 CTGCTGTCTGGGTGTTTCCTGGG - Intronic
1079890143 11:26042244-26042266 TTGCTGTCCGGGTGCTTCCTGGG + Intergenic
1080931757 11:36818566-36818588 CAGCAGTCCTGGTGCTTCAGGGG + Intergenic
1085517926 11:77122155-77122177 CTGCAGGCCTGGCCATTTCTGGG + Intronic
1089199558 11:116715600-116715622 CTGCAGGCCTCCTGATTCCTGGG - Intergenic
1090401552 11:126452651-126452673 CAGCAGTTCTGCTGATTACTTGG - Intronic
1093482916 12:19623702-19623724 CTGCAAACTTGGTGAGTCCTGGG + Intronic
1094069794 12:26400761-26400783 CTGCAGTCCTTTTGCCTCCTGGG - Intronic
1094092448 12:26665678-26665700 CTGCAGTCAAGGTGTTTGCTGGG - Intronic
1095193741 12:39288214-39288236 CTAGAGTCCTCCTGATTCCTTGG + Intergenic
1096635030 12:52952716-52952738 TTACAGTCTTGGTGATGCCTTGG + Exonic
1097950147 12:65418826-65418848 CTTCAGTCTTGGTGATGCCTTGG - Intronic
1098012644 12:66071200-66071222 CTGGAGTCCAGGTCATTTCTAGG + Intergenic
1098336332 12:69408684-69408706 CTGCAGTTCTGGAGACTACTTGG - Intergenic
1098464674 12:70773020-70773042 CAGCAATCCTTGGGATTCCTTGG + Intronic
1100029988 12:90174907-90174929 CTGCAGTCCTGATGAAGCTTGGG - Intergenic
1101809052 12:108092007-108092029 CTGCAGCCTTGGGGATCCCTGGG - Intergenic
1102385322 12:112504163-112504185 CTCAAGTCCTGGTGCTCCCTGGG - Intronic
1102472708 12:113168522-113168544 CTGCAGTCCTGCTGGTTCCCGGG - Intronic
1102898064 12:116614536-116614558 CTGCAGTCCAGGTGAATTCCCGG + Intergenic
1103952586 12:124559051-124559073 CTGCAGGCCGGGTGGCTCCTGGG - Intronic
1104438741 12:128778055-128778077 CTGCATTCCAGGTGGTCCCTGGG + Intergenic
1106722186 13:32446575-32446597 CTGCAGCACTGGTGATTCTGTGG + Intronic
1107360354 13:39611029-39611051 CTGCACTTCTGCAGATTCCTTGG + Intergenic
1107714998 13:43191239-43191261 CAGCAGTCGTGATGATTCCTAGG - Intergenic
1108941803 13:55964309-55964331 CTGCCATCCTGGTGTTTCCTGGG - Intergenic
1111775212 13:92653055-92653077 CTCCAGTGTTGGTGAGTCCTAGG - Intronic
1112756390 13:102639050-102639072 GTGCATTCCTGGTCATCCCTGGG + Intronic
1112965743 13:105190989-105191011 CTGCAGTGCTGGAGAGGCCTCGG - Intergenic
1113920794 13:113908254-113908276 CTGAAGTCCAGGTGGTTTCTGGG + Intergenic
1114621636 14:24099560-24099582 CTGCAGGGCTGGTGATGCCCAGG - Exonic
1116799636 14:49429399-49429421 CTGCTGTCCAGGTACTTCCTGGG - Intergenic
1117486008 14:56197826-56197848 CTGCAGTCTTGGTTCTTTCTGGG + Intronic
1118496585 14:66313664-66313686 CCGAGGTCCTGGTGGTTCCTTGG + Intergenic
1118927142 14:70202330-70202352 CTGCCGTCCTGGTAGTACCTTGG - Intergenic
1119423629 14:74522570-74522592 CTGGAGTCCTGGAGACTCATCGG + Intronic
1119968631 14:78944635-78944657 CTGCAATCCTTGATATTCCTTGG - Intronic
1120833868 14:89022976-89022998 CAGCTGTCCTGGTTATTTCTTGG - Intergenic
1121711903 14:96044708-96044730 CTGCAGTCCTTGGCATTCCTTGG + Intronic
1121929879 14:97962832-97962854 CGGCAGTCCTTGGTATTCCTTGG + Intronic
1121972714 14:98373325-98373347 CTGCAGTCCTTGGCATCCCTTGG + Intergenic
1122200151 14:100117478-100117500 CTGCAGTCTTGGTGACTCTGTGG + Intronic
1122882569 14:104696682-104696704 GTGCAGTCCTGGAGATCCATGGG + Intronic
1122984070 14:105204124-105204146 GGGCAGGCCTGGTGACTCCTGGG + Intergenic
1124968973 15:34465771-34465793 CTCCAGTGTTGTTGATTCCTAGG - Intergenic
1126869470 15:52972064-52972086 CTGCCTTCCTGGAGATCCCTGGG - Intergenic
1130650156 15:85757916-85757938 TTGGAGTCCTGGAGTTTCCTCGG + Intergenic
1131113403 15:89779044-89779066 GTGCATTCCTGGTGACTGCTGGG + Intergenic
1131825728 15:96321721-96321743 CTGACGTCCTGGGGCTTCCTCGG + Intergenic
1132190311 15:99849653-99849675 CTCCAGTGTTGGCGATTCCTAGG + Intergenic
1132415089 15:101613841-101613863 CTGCAGTCCCTGATATTCCTGGG - Intergenic
1132985910 16:2767532-2767554 CTGCAAACCTGGTGGGTCCTCGG + Exonic
1136671890 16:31865904-31865926 CTTCAGGCCTGCTGATGCCTGGG + Intergenic
1137631355 16:49948062-49948084 CAGCAGTCCTTGGTATTCCTGGG - Intergenic
1139750806 16:69107736-69107758 ATGCAGGCCTGGGGACTCCTGGG + Intronic
1139954079 16:70685174-70685196 TTGGAGTCCTGGAGCTTCCTGGG + Intronic
1141240738 16:82262780-82262802 CTTCCTTCCTGGTGATTCCCTGG + Intergenic
1141833379 16:86522330-86522352 CTGCAAGCCAGGTGCTTCCTGGG + Intergenic
1143408032 17:6690940-6690962 CTGCCCTCCTGGTGCTTCCCAGG - Exonic
1149324431 17:55515652-55515674 CTGCAGTCCTTGGCATTCCATGG - Intergenic
1151351655 17:73535455-73535477 CTGCAGTCCGGCTGCCTCCTGGG + Intronic
1151364386 17:73607615-73607637 CTGCACCCCAGGTGACTCCTTGG - Intronic
1152557179 17:81059180-81059202 CTGCAGGTCTGGTGATGCCCGGG + Intronic
1153907774 18:9678347-9678369 CTTCAGTCTTGGTGATGCCCTGG - Intergenic
1154092460 18:11378345-11378367 GTGCAGTCCTGGGGAGGCCTGGG + Intergenic
1157003868 18:43559251-43559273 CTGCCATCCAGGTGCTTCCTGGG + Intergenic
1159177099 18:64851726-64851748 CTGCAGGCCTGCTGAGTCTTTGG + Intergenic
1159366703 18:67475564-67475586 CTCCAGTCCTGATGTTTCTTGGG + Intergenic
1159935458 18:74363394-74363416 CTGCAGTTCTGATGATGCCGAGG + Intergenic
1161140220 19:2642838-2642860 ATGCATTCCCGGTGCTTCCTGGG - Intronic
1161251746 19:3284563-3284585 CTGAAGTCCTGGTGAATCCAGGG + Intronic
1164804187 19:31103548-31103570 CTGCAAACCTGTTAATTCCTGGG - Intergenic
1166746312 19:45143469-45143491 CTGGGGTCCGGGTGCTTCCTGGG - Intronic
1166955245 19:46459854-46459876 CTGCAGTCCTGTTTATTGTTGGG + Intergenic
1167331413 19:48858879-48858901 CTCCAGTGCTGGGGACTCCTGGG + Exonic
1167792460 19:51690420-51690442 CTGCAGTTCTGGGGATCCCCAGG + Intergenic
926858016 2:17278689-17278711 TTGCATCCCTGGTGTTTCCTTGG - Intergenic
927457048 2:23261858-23261880 CTGCAGACATGGTGATGCCCTGG + Intergenic
927504326 2:23603321-23603343 CAGCAGTCAAGGTGTTTCCTGGG + Intronic
928469379 2:31558481-31558503 TTGCAGTCCTTGGCATTCCTTGG + Intronic
928609429 2:32977191-32977213 CTGCTGTCCAGGTGTTTCCCAGG + Intronic
929551150 2:42893072-42893094 CTGCTGTCCTTGTGTTCCCTGGG + Intergenic
932769361 2:74491999-74492021 CAGCAGTCCCGGAGATGCCTGGG - Exonic
933207026 2:79518578-79518600 CTGGAGTCCTTGTGGTTTCTGGG - Intronic
936233232 2:110722585-110722607 CTGCAGTTCTTGGCATTCCTTGG - Intergenic
936289155 2:111206223-111206245 CTGCAGCCATGCTGATTCCAGGG - Intergenic
936450099 2:112627401-112627423 CTGTAGTGCTGTTTATTCCTTGG + Intergenic
937062265 2:118989475-118989497 CTCCAGGCCTGGTGCTGCCTGGG - Intronic
938684725 2:133727231-133727253 GTGCAGTCCTGATGATTTGTGGG - Intergenic
942990545 2:182195861-182195883 CTGCAGTCCTGCTAATTTCTAGG + Intronic
943092666 2:183393003-183393025 CTGCAGTTCTTGGCATTCCTTGG - Intergenic
945514922 2:210751435-210751457 GTGCAGTTCTTCTGATTCCTAGG + Intergenic
945729816 2:213520157-213520179 CAATAGTCCTGGTCATTCCTTGG - Intronic
945761772 2:213923352-213923374 CTGCTGTCTGGGTGTTTCCTGGG + Intronic
946515941 2:220411905-220411927 CTGCTGTCCATGTGCTTCCTGGG + Intergenic
947152793 2:227131869-227131891 CAGCAGTCCTTGGCATTCCTTGG - Intronic
948098875 2:235358148-235358170 TGGCAGTCCTGGTGTTTCCATGG + Intergenic
1169576379 20:6966534-6966556 CTGCAACCCTTGTCATTCCTTGG - Intergenic
1170569545 20:17625135-17625157 CTGCTGTCCTGGTGTGGCCTCGG - Intronic
1171880222 20:30613184-30613206 CTTCAATCCTGGTGAATCCATGG + Intergenic
1173058580 20:39639865-39639887 CTGCAGTCTTTGGCATTCCTTGG - Intergenic
1173190950 20:40875262-40875284 CTGCAGTTCTGGTCATCCCATGG + Intergenic
1173616148 20:44404039-44404061 CTGCACTCCTGGGGACACCTGGG + Intronic
1174229903 20:49038010-49038032 CTGAAGTCTTAGTGATTCATAGG + Intergenic
1175759193 20:61549939-61549961 CTGGAGTCCTGGCCACTCCTTGG + Intronic
1175831434 20:61967114-61967136 CTGGAGCCCTGGTGGTCCCTGGG - Intronic
1176132179 20:63500767-63500789 CCAGAGTCCTGGTGATCCCTTGG - Intergenic
1177320409 21:19513123-19513145 CTGCAATTCAGGTGTTTCCTGGG - Intergenic
1177348268 21:19900810-19900832 CTGCTGTCCGGGTGCTTCCCAGG - Intergenic
1177785353 21:25665589-25665611 CTGCAGCCTTGGCAATTCCTGGG - Intronic
1178048453 21:28722561-28722583 CTCCTGTGCTGGTTATTCCTGGG + Intergenic
1178599145 21:33980970-33980992 CTGCACTCCTTGGCATTCCTTGG + Intergenic
1179158904 21:38875732-38875754 CTGCAGTCCTTGGCATTCCTCGG - Intergenic
1179282105 21:39942557-39942579 CAGCAGTCCTTGGCATTCCTTGG + Intergenic
1181055654 22:20259467-20259489 CTGCAGCTCTGGTGCTCCCTCGG - Intronic
1181092393 22:20482919-20482941 CTTCAGTCTTGGTGATGCCCTGG - Intronic
1182083244 22:27543721-27543743 CTGGTGTCCAGGTGGTTCCTTGG + Intergenic
1183856038 22:40636066-40636088 GTGCAGTCCTTGGGATTCCCAGG - Intronic
1184805442 22:46792414-46792436 CTTCAGTCCTGTGGGTTCCTGGG + Intronic
1185280130 22:49966396-49966418 CTGCAGCCCTGGAGGCTCCTAGG - Intergenic
949564059 3:5228948-5228970 AAGCACTCCAGGTGATTCCTCGG + Intergenic
952629896 3:35453551-35453573 CTGCTGTCCGTGTGCTTCCTGGG - Intergenic
953469148 3:43152114-43152136 CTGCATCCCTGGTGAGTTCTGGG - Intergenic
953558713 3:43967682-43967704 CTCCACTCCTGATGTTTCCTGGG + Intergenic
954280585 3:49574322-49574344 CTCTAGTCCTGATGACTCCTGGG - Intronic
954785602 3:53090143-53090165 TTGCAATCCAGGTGATTCCGAGG + Exonic
956787654 3:72655873-72655895 CTGCAGTCCTAGAGAGGCCTGGG - Intergenic
957445414 3:80308998-80309020 CCGCACTCCTGGTTATTCCTGGG - Intergenic
960119037 3:113927722-113927744 CTGCTGTCAAGGTGTTTCCTGGG + Intronic
961064984 3:123867569-123867591 CAGCAGTCCTTGGCATTCCTTGG - Intronic
962510702 3:136097655-136097677 CTTCAGTCCTGTTAAATCCTTGG + Intronic
962888209 3:139647748-139647770 ATGCAGCCCTGCTGATGCCTTGG + Intronic
963618418 3:147572792-147572814 CTGCACTCGTGGTGTTTCTTGGG + Intergenic
963968006 3:151395277-151395299 CTGAAGCCCTGATGTTTCCTAGG + Intronic
965781903 3:172294927-172294949 CTGAAGTCCTGCAGATTCCCAGG - Intronic
971060788 4:22966867-22966889 CTGCAGACTTTGGGATTCCTGGG + Intergenic
971093633 4:23373301-23373323 CTGCAGCCATGGTGATTACATGG - Intergenic
972142788 4:35982359-35982381 CTGCTGTCCAGGTGCTTCCCAGG - Intronic
972177753 4:36428267-36428289 CTGCCATCCGGGTGTTTCCTGGG - Intergenic
972324022 4:37998374-37998396 CAGCAGCCCTGGTGATCCGTTGG + Intronic
972822959 4:42723387-42723409 CTGTAGTCCTTGGGGTTCCTTGG + Intergenic
973057317 4:45677712-45677734 CTCCAGTGCAGGTGATCCCTTGG + Intergenic
973704909 4:53571781-53571803 CTGCAGTCTTAGTGATTCAGGGG - Intronic
974968922 4:68801942-68801964 CCGCAATCCTGGTTAGTCCTGGG - Intergenic
974990323 4:69079043-69079065 CTGCTGTTCAGGTGTTTCCTGGG + Intronic
975012881 4:69377920-69377942 CCGCACCCCTGGTTATTCCTGGG - Intronic
975643362 4:76523144-76523166 CAGCACTCCTTGTCATTCCTCGG + Intronic
976102009 4:81574605-81574627 TTCCAGTCCTGGTGATCCCCAGG - Intronic
979276617 4:118821985-118822007 CTGCTTTTGTGGTGATTCCTAGG - Intronic
980199787 4:129641380-129641402 CTGCAGTACTGCAGATTCTTCGG + Intergenic
980539741 4:134177840-134177862 CTGCACTCTGGGTGTTTCCTGGG - Intergenic
981240788 4:142474014-142474036 CTGCAGCCCGGATGTTTCCTGGG - Intronic
981472201 4:145149246-145149268 CTGCAGTCCTTGAGGTTCCTTGG - Intronic
981475322 4:145180959-145180981 CTGCTCTCCTGGTGTTTCCATGG + Intergenic
983569369 4:169188023-169188045 CAGCAGTCCTTGGCATTCCTAGG - Intronic
983711730 4:170725558-170725580 CTGCTGTCCAGGGGATTCCTCGG + Intergenic
984166036 4:176304176-176304198 CTCCAGTCCTCCTGATACCTTGG + Intergenic
985349124 4:189038915-189038937 CTGCAGTCCTAGAAATTCCTGGG + Intergenic
986219560 5:5755535-5755557 CCTGAGTCCTGGTGTTTCCTTGG + Intergenic
986877858 5:12132618-12132640 CTGTAGTCCAGATGCTTCCTGGG - Intergenic
987631081 5:20472651-20472673 TTTCAGTTCTGGTGATTCCCAGG - Intronic
990101013 5:52187196-52187218 CATCAGTCCTTCTGATTCCTAGG - Intergenic
991560397 5:67945305-67945327 CAGCAGTCCTTGGCATTCCTTGG - Intergenic
991668335 5:69022371-69022393 CAGCAGTCCTTGGCATTCCTTGG - Intergenic
992616579 5:78551424-78551446 CTACTGTCCTGGGGGTTCCTAGG + Intronic
992800294 5:80289578-80289600 CTTCAATCCTGGTGATGCCCTGG + Intergenic
995067355 5:107877255-107877277 CTGCAACATTGGTGATTCCTGGG - Intronic
995265424 5:110153344-110153366 CAGCAGCTCTGGTGATTCCTGGG + Intergenic
996142429 5:119928889-119928911 CTGCTGTCCAAGTGCTTCCTGGG + Intergenic
997436282 5:133877972-133877994 GTGGAGGCCTGGGGATTCCTGGG - Intergenic
997693712 5:135845185-135845207 CTGCAGTGCTCGGCATTCCTTGG + Intronic
998776537 5:145609815-145609837 CTGCAGTCCAGGTGCTTCCCAGG + Intronic
999424518 5:151475684-151475706 CTGCAGGCCTGGTGCTCCCAGGG - Intronic
999874877 5:155793095-155793117 CTGCATTCCTGTTGTTTCCAAGG - Intergenic
1000744720 5:165018597-165018619 CTGCAGTCCTGCAGTGTCCTGGG - Intergenic
1001772078 5:174304164-174304186 CTGAAATCCTGGGGGTTCCTTGG + Intergenic
1006339161 6:33436968-33436990 CAGCAGTCCTTGGCATTCCTGGG + Intronic
1006822496 6:36908844-36908866 CAGCAGTCCTTGGCATTCCTTGG + Intronic
1007372878 6:41438279-41438301 CTGCAGTCTTGGAGAGACCTAGG + Intergenic
1008516354 6:52323112-52323134 CTTCAGGCCTGCTGATTTCTTGG + Intergenic
1011545681 6:88479378-88479400 CTGCAGTGATGGCGATTGCTGGG - Intergenic
1015216833 6:130759937-130759959 AGGCACTCCTGTTGATTCCTGGG - Intergenic
1016340353 6:143055388-143055410 CAGCAGTCCTTGGGATTCCTGGG + Intergenic
1017284981 6:152664037-152664059 TTGCACTCCCTGTGATTCCTTGG + Intergenic
1018800708 6:167220037-167220059 CTGCAGACCTGGTGATGCCTGGG - Intergenic
1018809444 6:167287274-167287296 CTGCAGACCTGGTGATGCTTGGG + Intronic
1018976478 6:168571478-168571500 CAGCAATCCGGGTGATTCTTCGG + Intronic
1019031607 6:169018481-169018503 CTGCCATCTGGGTGATTCCTGGG + Intergenic
1019163246 6:170082846-170082868 GAGCAGTCCTGGTGAATTCTTGG - Intergenic
1020473894 7:8571837-8571859 AAGGAGTCCTAGTGATTCCTTGG + Intronic
1021586722 7:22216406-22216428 CTGCAGTCCTGGTGATTCCTAGG - Intronic
1023223726 7:37947817-37947839 CTGCATGGCTGGTGACTCCTGGG + Intronic
1024201250 7:47108803-47108825 CTGCAGTCTTGTTGAATACTTGG - Intergenic
1028142960 7:87291793-87291815 CTGCTGTCCAGGTGTTTACTGGG - Intergenic
1028215109 7:88122060-88122082 CTGCAGTCAAGGTGTTTTCTAGG + Intronic
1028221614 7:88203717-88203739 CTAGAGACCTGGTGCTTCCTGGG - Intergenic
1029807173 7:103009892-103009914 CTACTGTCCAGGTGTTTCCTAGG - Intronic
1029807198 7:103010023-103010045 CTGCCATCCAGGTGTTTCCTGGG - Intronic
1030124193 7:106139033-106139055 CTGCACTCCTGGAGATTTCTGGG - Intergenic
1031926352 7:127642344-127642366 ATCCACTCCTGGTGATTCCAGGG + Intergenic
1031992499 7:128207427-128207449 CTGCAGCCGTGGTGCTTCCTTGG - Intergenic
1034334223 7:150310135-150310157 CTGCTTCCCTGGTTATTCCTGGG + Intronic
1035044841 7:155956998-155957020 CTGCAAGCCTGGTGACTCCCAGG + Intergenic
1035334042 7:158114237-158114259 CTGCATTCCTGGTGAGTCCTTGG - Intronic
1036570560 8:9976590-9976612 CTGCAGTCCCTGTGAAACCTGGG + Intergenic
1036657702 8:10688536-10688558 CTTCAGTCCAGGTGTTCCCTAGG + Intronic
1037289879 8:17339105-17339127 ATGCAGTTCTCGTGATTTCTGGG + Intronic
1037755682 8:21708732-21708754 CTGCAGCCCTGGGCATTCCTTGG - Intronic
1039227164 8:35400965-35400987 CGTCAGTCCTGCTGATTTCTTGG + Intronic
1041220687 8:55648354-55648376 CTGCAGTCCAGGTGCTTCCTGGG + Intergenic
1041220715 8:55648491-55648513 CTGCAATCTGGGTGCTTCCTGGG + Intergenic
1041291138 8:56310007-56310029 CTTCAGTGCTGGTGTTTCCCTGG - Intronic
1042274174 8:66985900-66985922 CTTTACTCCTGATGATTCCTTGG + Intronic
1042383889 8:68150913-68150935 CAGCAGTCCTTGGCATTCCTTGG + Intronic
1045478521 8:102574374-102574396 CTGCATTCCTCGTGACCCCTTGG - Intergenic
1045676500 8:104614071-104614093 CTGCTGTCCTTGTGCTTCCTGGG + Intronic
1048581379 8:135732109-135732131 AGGCAGTCCTGGGCATTCCTAGG + Intergenic
1049108511 8:140628327-140628349 CTGCCGTCCTCCTCATTCCTGGG - Intronic
1049619116 8:143589840-143589862 CTGCTGTCCTGGCTCTTCCTGGG + Exonic
1049828737 8:144686520-144686542 CTTCAGTCCTGGACATTCCCTGG + Intergenic
1050179928 9:2910555-2910577 TTGCAGTCCCTGGGATTCCTTGG - Intergenic
1050924072 9:11241332-11241354 CTGCTCTCCTGGTGTTTCCTGGG + Intergenic
1052612907 9:30799566-30799588 CTTCAATCTTGGTGATTCCCTGG - Intergenic
1053154908 9:35770728-35770750 CTGCACTCCTGGAGATGCTTAGG + Intergenic
1053270356 9:36745379-36745401 CTGAGGCCCTGGTGACTCCTGGG + Intergenic
1053411871 9:37921016-37921038 CTGCAGCCCTGGTGAGAGCTGGG - Intronic
1055498032 9:76875269-76875291 CTTCAGTACTGGAGATTTCTGGG + Intronic
1055563516 9:77545662-77545684 CTGTAGACCTGCTGATTCCCTGG + Intronic
1055913508 9:81376756-81376778 CTGCAGACCTGGAAATTCCCAGG - Intergenic
1056107502 9:83361856-83361878 CTGCAGTCCTTGGCCTTCCTTGG - Intronic
1056166069 9:83941992-83942014 CAGCAGTCCTTGACATTCCTTGG - Intronic
1056413386 9:86354200-86354222 CTGCCGGCCTGGGGGTTCCTCGG + Intronic
1056877615 9:90349684-90349706 CTGCCATCCAGGTGCTTCCTGGG - Intergenic
1058103110 9:100938249-100938271 CTGCTGTCCAGGTGGTTCCTGGG + Intergenic
1061673757 9:132203856-132203878 CTGCCTTCCTGGAGCTTCCTGGG - Intronic
1062130103 9:134887930-134887952 CTGCTGTCCTGGGTATTCGTGGG + Intergenic
1186834277 X:13421742-13421764 CAACAGTCCTTGTGATTTCTAGG - Intergenic
1188974949 X:36662022-36662044 CTACAATCCTTGTCATTCCTTGG - Intergenic
1189783564 X:44539503-44539525 CAGCAATCCTTGTCATTCCTTGG - Intronic
1190460145 X:50665064-50665086 CTGCATTCCTCCTGTTTCCTTGG - Intronic
1191039984 X:56068663-56068685 CTGCAATCCAGGTGTTTCCTGGG - Intergenic
1192849722 X:74942315-74942337 CTGCTGTCCAGGTGTTTCCCAGG + Intergenic
1193044127 X:77034019-77034041 CTGCTGTCTGGGTGTTTCCTGGG - Intergenic
1193406257 X:81105981-81106003 CTGCTGTCCAGGTGTTTTCTGGG + Intergenic
1194322083 X:92460826-92460848 CTTCACTCTTGGTGATGCCTTGG + Intronic
1194981942 X:100450112-100450134 CTGCTGTCCAGTTGTTTCCTGGG - Intergenic
1195155223 X:102116037-102116059 CTGCAGTCCAGGTGCTTCCTGGG - Intergenic
1198221638 X:134607918-134607940 CTGCAGTCCAGGTGTTGTCTAGG - Intronic
1199138092 X:144277480-144277502 CTTCAGTCTTTGTGCTTCCTAGG + Intergenic
1199726088 X:150582688-150582710 CTGCAATCCTTGGCATTCCTTGG - Intronic
1200053876 X:153448691-153448713 CTGCCATCCTGGTGGTGCCTGGG - Intronic
1200377512 X:155799245-155799267 CAGCACTCCTGGTAATCCCTAGG - Intergenic
1200630246 Y:5574305-5574327 CTTCATTCTTGGTGATGCCTTGG + Intronic
1201393302 Y:13521981-13522003 CTGCAGTTCAGGTGATTCCTAGG - Intergenic