ID: 1021586724

View in Genome Browser
Species Human (GRCh38)
Location 7:22216424-22216446
Sequence TGCAGTCATGTATCTTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021586722_1021586724 -5 Left 1021586722 7:22216406-22216428 CCTAGGAATCACCAGGACTGCAG 0: 1
1: 0
2: 5
3: 27
4: 257
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586715_1021586724 11 Left 1021586715 7:22216390-22216412 CCACCCCTCTCCATTCCCTAGGA 0: 1
1: 1
2: 0
3: 34
4: 385
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586713_1021586724 12 Left 1021586713 7:22216389-22216411 CCCACCCCTCTCCATTCCCTAGG 0: 1
1: 0
2: 3
3: 28
4: 455
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586711_1021586724 17 Left 1021586711 7:22216384-22216406 CCCAGCCCACCCCTCTCCATTCC 0: 1
1: 1
2: 8
3: 111
4: 1006
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586716_1021586724 8 Left 1021586716 7:22216393-22216415 CCCCTCTCCATTCCCTAGGAATC 0: 1
1: 0
2: 2
3: 21
4: 282
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586721_1021586724 -4 Left 1021586721 7:22216405-22216427 CCCTAGGAATCACCAGGACTGCA 0: 1
1: 0
2: 0
3: 14
4: 114
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586720_1021586724 1 Left 1021586720 7:22216400-22216422 CCATTCCCTAGGAATCACCAGGA 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586717_1021586724 7 Left 1021586717 7:22216394-22216416 CCCTCTCCATTCCCTAGGAATCA 0: 1
1: 0
2: 2
3: 18
4: 267
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586712_1021586724 16 Left 1021586712 7:22216385-22216407 CCAGCCCACCCCTCTCCATTCCC 0: 1
1: 0
2: 6
3: 170
4: 1656
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586718_1021586724 6 Left 1021586718 7:22216395-22216417 CCTCTCCATTCCCTAGGAATCAC 0: 1
1: 0
2: 1
3: 24
4: 251
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021586724 Original CRISPR TGCAGTCATGTATCTTCCCA TGG Intronic
No off target data available for this crispr