ID: 1021586725

View in Genome Browser
Species Human (GRCh38)
Location 7:22216425-22216447
Sequence GCAGTCATGTATCTTCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 111}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021586713_1021586725 13 Left 1021586713 7:22216389-22216411 CCCACCCCTCTCCATTCCCTAGG 0: 1
1: 0
2: 3
3: 28
4: 455
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586711_1021586725 18 Left 1021586711 7:22216384-22216406 CCCAGCCCACCCCTCTCCATTCC 0: 1
1: 1
2: 8
3: 111
4: 1006
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586722_1021586725 -4 Left 1021586722 7:22216406-22216428 CCTAGGAATCACCAGGACTGCAG 0: 1
1: 0
2: 5
3: 27
4: 257
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586712_1021586725 17 Left 1021586712 7:22216385-22216407 CCAGCCCACCCCTCTCCATTCCC 0: 1
1: 0
2: 6
3: 170
4: 1656
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586717_1021586725 8 Left 1021586717 7:22216394-22216416 CCCTCTCCATTCCCTAGGAATCA 0: 1
1: 0
2: 2
3: 18
4: 267
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586720_1021586725 2 Left 1021586720 7:22216400-22216422 CCATTCCCTAGGAATCACCAGGA 0: 1
1: 0
2: 0
3: 11
4: 173
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586716_1021586725 9 Left 1021586716 7:22216393-22216415 CCCCTCTCCATTCCCTAGGAATC 0: 1
1: 0
2: 2
3: 21
4: 282
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586721_1021586725 -3 Left 1021586721 7:22216405-22216427 CCCTAGGAATCACCAGGACTGCA 0: 1
1: 0
2: 0
3: 14
4: 114
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586718_1021586725 7 Left 1021586718 7:22216395-22216417 CCTCTCCATTCCCTAGGAATCAC 0: 1
1: 0
2: 1
3: 24
4: 251
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586715_1021586725 12 Left 1021586715 7:22216390-22216412 CCACCCCTCTCCATTCCCTAGGA 0: 1
1: 1
2: 0
3: 34
4: 385
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021586725 Original CRISPR GCAGTCATGTATCTTCCCAT GGG Intronic
915966711 1:160315273-160315295 GCAGTCGTGATGCTTCCCATGGG - Intronic
918768921 1:188527918-188527940 ACAGTTATGTATATTCACATGGG - Intergenic
920069502 1:203292081-203292103 GCAGGCAGGTATCCTCCCTTTGG + Intergenic
922631493 1:227118003-227118025 GAGGTCAAGTATCTTCACATGGG - Intronic
923077517 1:230623274-230623296 GCAGTCATGCCTCTCCCCACAGG + Intergenic
1066056116 10:31681673-31681695 GAAGTTACGTATCTTCCAATGGG - Intergenic
1066623485 10:37382270-37382292 GCACTCATGTTTCTTCCCAAAGG - Intronic
1071949164 10:90683218-90683240 ACATGCATGTATCTTCCCAGAGG + Intergenic
1072178217 10:92951170-92951192 AAATTCATGTATCTACCCATTGG - Intronic
1074750208 10:116578590-116578612 GAAGTCATTTAGGTTCCCATTGG - Intergenic
1076407208 10:130220530-130220552 GCAAGCATGTATCTTCACGTGGG + Intergenic
1080040819 11:27757657-27757679 GCAGCCATGTTTGTTCCCTTTGG - Intergenic
1080332222 11:31152883-31152905 ACACTCAGGAATCTTCCCATGGG + Intronic
1088157551 11:106826965-106826987 GCAGCCATATATCTTTTCATTGG + Intronic
1088826182 11:113496290-113496312 GTGATCATGTGTCTTCCCATGGG + Intergenic
1091029025 11:132167566-132167588 GCTGTCATGTATCTTGCCTGAGG + Intronic
1093635493 12:21462035-21462057 GCAGCCATATATCTTTTCATTGG - Exonic
1093699370 12:22201566-22201588 GGAGTGAGGTATCTTCACATGGG + Exonic
1099384634 12:81999475-81999497 CCAGTCATGTTTCTACCCCTTGG - Intergenic
1099698877 12:86059574-86059596 GCAGGGATGTATCTTCCAAAAGG - Intronic
1103926637 12:124427070-124427092 GGAGCCATGAATCTTCCCTTTGG + Intronic
1104578738 12:129993139-129993161 GCAGGGATGGATCTTCCCACAGG + Intergenic
1106954694 13:34923711-34923733 GCAATCATGCATCTTCTCACTGG - Intergenic
1114071710 14:19115241-19115263 GCAATCGTGCATCTTCTCATCGG - Intergenic
1114090551 14:19284723-19284745 GCAATCGTGCATCTTCTCATCGG + Intergenic
1114329512 14:21622263-21622285 ACAATCATGTATCTTGTCATAGG + Intergenic
1114331673 14:21643282-21643304 ACAGTCATGTATCTTGTCTTAGG + Intergenic
1114501714 14:23174475-23174497 ACAGTCACATGTCTTCCCATTGG - Intronic
1120255575 14:82115163-82115185 TCAGTCATCTGTCTTGCCATAGG + Intergenic
1121794102 14:96721471-96721493 GCTGTCATCTGTCATCCCATGGG + Intergenic
1125141413 15:36412263-36412285 GCAGTCATCCATCTTATCATGGG - Intergenic
1126372291 15:47960253-47960275 GCAGGCCTGTATTCTCCCATGGG + Intergenic
1127676049 15:61240160-61240182 TAAGCCATGTTTCTTCCCATAGG + Intergenic
1128502949 15:68241553-68241575 GCAATCATGATGCTTCCCATGGG - Intronic
1129960400 15:79679605-79679627 GCAGACATGTTTCTTCACAGTGG - Intergenic
1138727701 16:59158727-59158749 TCAGTCATGTATCTTCCCTTTGG - Intergenic
1141058095 16:80837381-80837403 GCAGTCATTTACATTGCCATTGG - Intergenic
1141359168 16:83378663-83378685 GCAGTCAAGTATCTTGCCTAAGG - Intronic
1143241913 17:5450835-5450857 GCTGCCATCTTTCTTCCCATTGG + Exonic
1143601610 17:7949696-7949718 GCATTCATGTCTTTTCCCACAGG - Intronic
1146534644 17:33639624-33639646 GCACCCATGTTTCTTCCCAAAGG + Intronic
1150175388 17:63049424-63049446 ACAGTTATGTATCTACCCAAAGG + Intronic
1150982528 17:70158328-70158350 GCAGTCATATATCAGCCCTTGGG + Intergenic
1155218090 18:23661196-23661218 GCAATCATGTTCATTCCCATGGG + Intronic
1161644012 19:5441979-5442001 GCATTCTTGTATCTTCCCTTTGG + Intergenic
1167326740 19:48831246-48831268 GCAGTCATTTATCTTCCTTTTGG + Intronic
927000918 2:18793540-18793562 TGAGCCATGTTTCTTCCCATGGG + Intergenic
929078178 2:38095820-38095842 GTCTTCATGTTTCTTCCCATGGG - Intronic
931954957 2:67412664-67412686 GCAGACATGTATCCTACCATGGG + Intergenic
932769651 2:74493343-74493365 GCAGTCATTCCTCTTGCCATGGG + Exonic
936262624 2:110974744-110974766 GCAGGCACATATCTTGCCATGGG - Intronic
937607811 2:123823127-123823149 TTAGTCATGTATCTTACCAGGGG - Intergenic
938485965 2:131708824-131708846 GCAATCGTGCATCTTCTCATCGG - Intergenic
940405518 2:153296898-153296920 GCAGTCATGATGTTTCCCATAGG + Intergenic
942193085 2:173490315-173490337 GGAATTATATATCTTCCCATGGG + Intergenic
944433737 2:199664735-199664757 CAAGGCATGTGTCTTCCCATTGG + Intergenic
944501279 2:200362593-200362615 GCAATTAAGTATCTTCACATAGG - Intronic
948302350 2:236917251-236917273 GCAGTCTTGTAACTGCCCAGTGG + Intergenic
1171394646 20:24824165-24824187 ACAGGCATGTCTCTTCCCACTGG + Intergenic
1181389921 22:22572920-22572942 GAAATCATGCATCATCCCATGGG + Intergenic
1182109004 22:27709730-27709752 GCACCCACGTTTCTTCCCATGGG - Intergenic
953393285 3:42546357-42546379 GCAGACATTTATTTTCTCATGGG + Intergenic
954320449 3:49829065-49829087 GCAGGCATGTGTCTGGCCATTGG + Exonic
954955103 3:54511970-54511992 GCAGTCAAGTATGTTCCAGTGGG + Intronic
955672806 3:61419343-61419365 TCAGTCAGGTGTCTGCCCATGGG - Intergenic
955795082 3:62627825-62627847 GGAATCCTGTTTCTTCCCATTGG - Intronic
957034712 3:75283100-75283122 GCAATAATGTGTCCTCCCATTGG + Intergenic
958663780 3:97107010-97107032 CCATTCTTGTATCTTCCAATCGG + Intronic
958695646 3:97524827-97524849 GAAGTCATGTATAGTCCTATGGG + Intronic
959847288 3:111048682-111048704 CCAGTCATCTATCTTCTCTTAGG + Intergenic
961078582 3:124004690-124004712 GCAATAATGTGTCCTCCCATTGG + Intergenic
961304889 3:125951757-125951779 GCAATAATGTGTCCTCCCATTGG - Intergenic
964760407 3:160130310-160130332 ACAGTTATGTATCTTCTCCTTGG - Intergenic
965028952 3:163338626-163338648 GCAGTCATATTTCTTCAGATTGG - Intergenic
965029650 3:163349001-163349023 GCAGACATGTTTCTCACCATTGG + Intergenic
965392321 3:168119953-168119975 GTAGTAATGTACCTTCGCATGGG + Intergenic
966182484 3:177199203-177199225 GCAGTTATCTAAATTCCCATCGG - Intergenic
966194680 3:177301213-177301235 GCAGTCATGTATGTTTCAAGTGG + Intergenic
978480726 4:109187434-109187456 GCAGTCAAATAACTTGCCATAGG - Intronic
979612876 4:122707873-122707895 GCAGTGATGTATCTGGCCTTTGG - Intergenic
979704140 4:123700820-123700842 AAAGTCAGCTATCTTCCCATAGG - Intergenic
980241127 4:130177027-130177049 GCATTCATTTATATTCCCACTGG - Intergenic
982374611 4:154675736-154675758 ACAGTAATGTAACTTCCCAAAGG - Intronic
982533922 4:156584718-156584740 GAAGCCATGTATCTTCCCCAAGG - Intergenic
984347888 4:178554376-178554398 GCAGTCATGTATCTGGCAATTGG - Intergenic
986550518 5:8949353-8949375 GCAGTCATTGGTATTCCCATGGG - Intergenic
989714375 5:44443634-44443656 GCAGTCATGTCTCATTCCATGGG + Intergenic
991144111 5:63281292-63281314 GTGGTCATGTATCTTCCCTAAGG - Intergenic
992845746 5:80745122-80745144 GGATTCAAGTATCTTCCCTTAGG - Intronic
993018503 5:82563672-82563694 CCAATCCTGTATCTTCCCACTGG + Intergenic
993414224 5:87605986-87606008 GCAGTCATGATCCTTCCCATGGG + Intergenic
994607944 5:101994692-101994714 GCAGTCATTTGTCATCCTATTGG - Intergenic
999590278 5:153137570-153137592 CCAGTCATGTTTCTTCCTAAAGG - Intergenic
1008227983 6:48945560-48945582 GCAGTTATGTTTCTTCCACTTGG + Intergenic
1010729165 6:79369965-79369987 ACAATCATGTTTCTTTCCATGGG + Intergenic
1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG + Intronic
1021811511 7:24406265-24406287 CCAGTCATGTACCTTCCAAGGGG - Intergenic
1021873737 7:25029287-25029309 GCAGCCATGTCTCTCCCCACTGG - Intergenic
1021969589 7:25952530-25952552 GCAATGATTTATCTTTCCATAGG - Intergenic
1022185606 7:27964744-27964766 GTAGTCATGAATCTTACCAAAGG + Intronic
1022273804 7:28836816-28836838 GCATTCATGTAACGTCTCATAGG - Intergenic
1030100970 7:105944882-105944904 TCTATCATCTATCTTCCCATTGG - Intronic
1030361327 7:108598318-108598340 GCAGTAATGCATGTTGCCATGGG + Intergenic
1036066789 8:5389756-5389778 CCAGTGCTGTTTCTTCCCATGGG - Intergenic
1036627886 8:10486879-10486901 GGATTCACGGATCTTCCCATAGG + Intergenic
1037521895 8:19688181-19688203 GAAGCCCTGTGTCTTCCCATGGG + Intronic
1039301465 8:36214006-36214028 GCAGTAATTCATCTTCCCCTAGG - Intergenic
1042951822 8:74207847-74207869 ACAGTCATGTCTATTTCCATAGG - Intergenic
1043544946 8:81304960-81304982 GCAACCATGAATCTTCCCATTGG - Intergenic
1044580004 8:93815696-93815718 GCAGTTAAGTGTCTTCCTATAGG - Intronic
1044890610 8:96831533-96831555 GCAGGCATGAATATTCCCTTTGG + Intronic
1046864239 8:119128394-119128416 TCATTAATGTCTCTTCCCATTGG - Intergenic
1050061751 9:1716815-1716837 GCAGCCATGTCTCTACCCAATGG + Intergenic
1053520402 9:38771837-38771859 GCACTCAAATAGCTTCCCATTGG + Intergenic
1055604684 9:77956515-77956537 GGATTCATGTTCCTTCCCATAGG - Intronic
1056839882 9:89990175-89990197 GCAGCCATGTCTCTCCCCTTGGG + Intergenic
1194012655 X:88582373-88582395 GCTGCAATGTCTCTTCCCATTGG - Intergenic
1194273939 X:91856935-91856957 GCAATAATGTATATTCCCTTGGG + Intronic
1195041635 X:101020251-101020273 CTAGACATGTATCTTCCCTTAGG + Intronic
1196980946 X:121213086-121213108 GCACTCATGATGCTTCCCATGGG + Intergenic
1197556616 X:127963561-127963583 GCAGTTGTGTATCTTTCAATTGG + Intergenic