ID: 1021590464

View in Genome Browser
Species Human (GRCh38)
Location 7:22255475-22255497
Sequence CCTCAGCCTCCCAAGTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699690
Summary {0: 121, 1: 3448, 2: 105765, 3: 224220, 4: 366136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021590464_1021590472 3 Left 1021590464 7:22255475-22255497 CCCAGTGACTTGGGAGGCTGAGG 0: 121
1: 3448
2: 105765
3: 224220
4: 366136
Right 1021590472 7:22255501-22255523 GAGGATCACCTGACTCTGGGAGG 0: 2
1: 61
2: 1312
3: 8183
4: 40843
1021590464_1021590471 0 Left 1021590464 7:22255475-22255497 CCCAGTGACTTGGGAGGCTGAGG 0: 121
1: 3448
2: 105765
3: 224220
4: 366136
Right 1021590471 7:22255498-22255520 TGGGAGGATCACCTGACTCTGGG 0: 2
1: 118
2: 2021
3: 10799
4: 35336
1021590464_1021590470 -1 Left 1021590464 7:22255475-22255497 CCCAGTGACTTGGGAGGCTGAGG 0: 121
1: 3448
2: 105765
3: 224220
4: 366136
Right 1021590470 7:22255497-22255519 GTGGGAGGATCACCTGACTCTGG 0: 4
1: 121
2: 2068
3: 7562
4: 18091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021590464 Original CRISPR CCTCAGCCTCCCAAGTCACT GGG (reversed) Intronic
Too many off-targets to display for this crispr