ID: 1021590466

View in Genome Browser
Species Human (GRCh38)
Location 7:22255476-22255498
Sequence ACCTCAGCCTCCCAAGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422182
Summary {0: 29, 1: 799, 2: 18240, 3: 126333, 4: 276781}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021590466_1021590472 2 Left 1021590466 7:22255476-22255498 CCAGTGACTTGGGAGGCTGAGGT 0: 29
1: 799
2: 18240
3: 126333
4: 276781
Right 1021590472 7:22255501-22255523 GAGGATCACCTGACTCTGGGAGG 0: 2
1: 61
2: 1312
3: 8183
4: 40843
1021590466_1021590470 -2 Left 1021590466 7:22255476-22255498 CCAGTGACTTGGGAGGCTGAGGT 0: 29
1: 799
2: 18240
3: 126333
4: 276781
Right 1021590470 7:22255497-22255519 GTGGGAGGATCACCTGACTCTGG 0: 4
1: 121
2: 2068
3: 7562
4: 18091
1021590466_1021590471 -1 Left 1021590466 7:22255476-22255498 CCAGTGACTTGGGAGGCTGAGGT 0: 29
1: 799
2: 18240
3: 126333
4: 276781
Right 1021590471 7:22255498-22255520 TGGGAGGATCACCTGACTCTGGG 0: 2
1: 118
2: 2021
3: 10799
4: 35336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021590466 Original CRISPR ACCTCAGCCTCCCAAGTCAC TGG (reversed) Intronic
Too many off-targets to display for this crispr