ID: 1021590472

View in Genome Browser
Species Human (GRCh38)
Location 7:22255501-22255523
Sequence GAGGATCACCTGACTCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50401
Summary {0: 2, 1: 61, 2: 1312, 3: 8183, 4: 40843}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021590466_1021590472 2 Left 1021590466 7:22255476-22255498 CCAGTGACTTGGGAGGCTGAGGT 0: 29
1: 799
2: 18240
3: 126333
4: 276781
Right 1021590472 7:22255501-22255523 GAGGATCACCTGACTCTGGGAGG 0: 2
1: 61
2: 1312
3: 8183
4: 40843
1021590464_1021590472 3 Left 1021590464 7:22255475-22255497 CCCAGTGACTTGGGAGGCTGAGG 0: 121
1: 3448
2: 105765
3: 224220
4: 366136
Right 1021590472 7:22255501-22255523 GAGGATCACCTGACTCTGGGAGG 0: 2
1: 61
2: 1312
3: 8183
4: 40843

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021590472 Original CRISPR GAGGATCACCTGACTCTGGG AGG Intronic
Too many off-targets to display for this crispr