ID: 1021594660

View in Genome Browser
Species Human (GRCh38)
Location 7:22302298-22302320
Sequence CTGTTTCAGCAGAAGCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021594659_1021594660 -2 Left 1021594659 7:22302277-22302299 CCAGTCAGGACAGAGAGGGGGCT 0: 1
1: 0
2: 0
3: 21
4: 229
Right 1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG 0: 1
1: 0
2: 0
3: 22
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021594660 Original CRISPR CTGTTTCAGCAGAAGCCATG TGG Intronic
901953570 1:12768670-12768692 CTGGCTCAGCAGGAGCCCTGTGG - Intergenic
910124689 1:83827537-83827559 TAGTTTGAGCAGATGCCATGTGG + Intergenic
910395815 1:86792857-86792879 CTGTTTGAACAGTTGCCATGGGG - Intergenic
911233828 1:95388172-95388194 CTGCTACAGCAGAACCCATATGG + Intergenic
912823404 1:112885142-112885164 CTGTTTCAGTAGGAGCCCAGAGG + Intergenic
912871583 1:113311516-113311538 CTGGGGCAGCAGTAGCCATGGGG + Intergenic
912961664 1:114201456-114201478 CTGGTTCAGTAGCAGCAATGGGG + Intergenic
912965697 1:114235350-114235372 CTTTTTCTCCAGAAGCCCTGAGG + Intergenic
913498827 1:119452094-119452116 CTACTTCAGCAGAAACCTTGAGG + Intergenic
915182717 1:154077027-154077049 ATCTTTCATCAGAAACCATGAGG + Intronic
917350735 1:174074952-174074974 CTGTTTCAGCAGAGGGCACTAGG - Intergenic
919083095 1:192890150-192890172 CAGATTCAGCATAAGCCATTTGG - Intergenic
919764758 1:201119800-201119822 CTCTTTCAGCAGTCACCATGGGG - Intronic
919961335 1:202472819-202472841 CAGTTGCAACAGAAACCATGTGG - Intronic
921298668 1:213728649-213728671 CTTTTTCAGCAGAGCCAATGAGG - Intergenic
922728935 1:227940129-227940151 CTGTGTCTGCAGCATCCATGGGG + Intronic
923624217 1:235601024-235601046 CTGAAACAGCAGCAGCCATGGGG - Intronic
924705754 1:246500625-246500647 CTGTACCAGCAGAAGCCACATGG + Intronic
1063576540 10:7266656-7266678 CAGTTTCAACAGAAGCCCTCTGG + Intronic
1064035831 10:11912734-11912756 TTGTTGCAGCAGAAGCCCAGAGG - Intergenic
1064218822 10:13422057-13422079 TTGGTTCTGCAGAAGCCAGGAGG - Intergenic
1067792762 10:49300340-49300362 CTATATCAGCAGAAACCATATGG + Intronic
1068175862 10:53457385-53457407 CTGTTTCATCTGAAGAGATGAGG - Intergenic
1069610010 10:69766648-69766670 CAGTGGGAGCAGAAGCCATGGGG - Intergenic
1070950647 10:80428320-80428342 CAGTGTCAGCAGAGGCCAGGAGG + Intronic
1073561685 10:104502450-104502472 TTGTCTCAGCTGATGCCATGTGG - Intergenic
1073946594 10:108757760-108757782 CTCTTTCTGCAGTAGCAATGGGG + Intergenic
1075006996 10:118838316-118838338 TTGTTTCAACAGAGACCATGTGG + Intergenic
1075454049 10:122573475-122573497 CTGTGGCAGCAGAGGACATGGGG + Intronic
1075717021 10:124561649-124561671 CAGTGTCAGCAGAGGCCAAGTGG + Intronic
1075873601 10:125788863-125788885 CTGACTCAGCAGCAGCCATGGGG + Exonic
1075878213 10:125825209-125825231 CTGTTCCTGCTGAAGCCATGTGG + Intronic
1076874239 10:133208104-133208126 CTCTCTGAGCAGAGGCCATGGGG + Intronic
1078529380 11:12125136-12125158 CTGTATCAGCAGCAGCCCAGTGG + Intronic
1078562715 11:12387328-12387350 TTTTTTCTGCAGATGCCATGAGG + Intronic
1080640663 11:34156459-34156481 CTGATACTGCAGAAACCATGTGG + Intronic
1081594028 11:44446872-44446894 CCCTCTCAGCAGAAGCCCTGGGG + Intergenic
1081744752 11:45464993-45465015 GTGTTTTAGTAGAAGCCATCTGG - Intergenic
1082146561 11:48677797-48677819 CTGTTCTGGCAGAATCCATGAGG + Intergenic
1082285652 11:50315406-50315428 TTTTTTCAGCTGAAGCCTTGGGG + Intergenic
1082591257 11:55013591-55013613 CTGTTTTGGCAGAATCCATGAGG + Intergenic
1082862442 11:57868811-57868833 CATTTTCAGGAGAAGCCAAGAGG - Intergenic
1083126261 11:60569086-60569108 CTGTTTCTGGGGGAGCCATGAGG + Intergenic
1086824151 11:91475150-91475172 CTCTTTCACCAGAAGCCACTGGG - Intergenic
1087362553 11:97178920-97178942 CTGTTTCATTATAAGCAATGTGG - Intergenic
1088711083 11:112509454-112509476 CTGCTGAGGCAGAAGCCATGGGG - Intergenic
1089077414 11:115749423-115749445 ATGTTTCACCAGAAGACATAGGG - Intergenic
1089957720 11:122587467-122587489 ATTTTTCATCAGAAACCATGGGG - Intergenic
1090232675 11:125119870-125119892 CTGTATCAGCAGATGTCTTGAGG + Intergenic
1091402055 12:187100-187122 TTTTTGCAGCAGAAGCCCTGAGG - Intergenic
1091650704 12:2307038-2307060 TGGTCTCAGCTGAAGCCATGAGG + Intronic
1091896946 12:4113170-4113192 CTGTTTAAGCAGCAGGCAGGGGG - Intergenic
1092081550 12:5720642-5720664 GTGTTTTCCCAGAAGCCATGAGG + Intronic
1094075723 12:26471881-26471903 CTGCTTCAGAAGTGGCCATGTGG - Intronic
1094307692 12:29039109-29039131 TGGTTTCAGTAGAACCCATGGGG - Intergenic
1095071267 12:37851564-37851586 CTGTTTTTGCAAAATCCATGTGG - Intergenic
1096753081 12:53775667-53775689 GTTGTTCAGCAGGAGCCATGAGG + Intergenic
1096802981 12:54123780-54123802 CTGTTTCAGCAGGAGTTGTGGGG - Intergenic
1097245007 12:57603044-57603066 CTGTCTCACAAGAAGCCATGAGG + Exonic
1097280143 12:57840202-57840224 CTGATTCAGCAGATCCCAGGTGG + Intronic
1097688050 12:62709467-62709489 CTGTGCCAGCAGAAGCCCAGAGG - Intronic
1098655669 12:73026755-73026777 CTGTTTAAGCAGAAGCATTTAGG + Intergenic
1102754585 12:115327078-115327100 CTGCTGCATCAGAAGCCGTGGGG - Intergenic
1102783233 12:115583674-115583696 GTGTTTCAGCAGAAGGAAAGTGG - Intergenic
1102882050 12:116493077-116493099 ATGAGTCAGCAGAAGCCATGAGG + Intergenic
1103180917 12:118910607-118910629 GTTTTTCAGCAGAAGGCAGGTGG + Intergenic
1104197863 12:126558401-126558423 CTGATTCTGCACAAGCCATCAGG - Intergenic
1104216279 12:126736870-126736892 CGGTTCCAGCAGAAGTCCTGGGG + Intergenic
1104928771 12:132327642-132327664 CTGATTCAGCTGGAGCCACGAGG - Intronic
1107632736 13:42358694-42358716 CAGTACTAGCAGAAGCCATGTGG - Intergenic
1107708887 13:43133253-43133275 CTGTTTCTCCAGCAGACATGGGG - Intergenic
1108026843 13:46186875-46186897 GTGTTTCATGAGAAGCCTTGAGG - Intronic
1108558698 13:51621784-51621806 CTGGTTCTGGAGCAGCCATGTGG + Intronic
1110633410 13:77736646-77736668 CAGATTCAGCAGAAGACATAAGG - Intronic
1110888473 13:80668944-80668966 CTTGTTGAGAAGAAGCCATGGGG - Intergenic
1113699974 13:112377167-112377189 CTGATTCAGCAAAGGCCAAGAGG + Intronic
1115793392 14:36905212-36905234 ATGCTTCAGCAAAAGCTATGTGG + Intronic
1116863169 14:50010553-50010575 GTTGTTCAGCAGAGGCCATGGGG + Intergenic
1118149366 14:63173169-63173191 CAGCTTCAGAAGAAGCCGTGAGG + Intergenic
1121927709 14:97944063-97944085 GTGTTTCACCAGAAGCCAGTTGG - Intronic
1123472268 15:20564251-20564273 GTGTTCCAGCAGGAGCCAAGAGG + Intergenic
1123645735 15:22436102-22436124 GTGTTCCAGCAGGAGCCAAGAGG - Intergenic
1123732573 15:23159242-23159264 GTGTTCCAGCAGGAGCCAAGAGG + Intergenic
1123750706 15:23356622-23356644 GTGTTCCAGCAGGAGCCAAGAGG + Exonic
1124283077 15:28380538-28380560 GTGTTCCAGCAGGAGCCAAGAGG + Exonic
1124299622 15:28531075-28531097 GTGTTCCAGCAGGAGCCAAGAGG - Exonic
1124415711 15:29471797-29471819 CTTTTTCAGAAGAAGGCATGAGG - Intronic
1125589176 15:40844047-40844069 CAGTTTCACCAGAAACCAGGGGG + Exonic
1126282153 15:46966167-46966189 ATGTTTCATCAGAACCCCTGGGG + Intergenic
1130041379 15:80407505-80407527 CTGTCATAGCAGAAGTCATGAGG - Intronic
1131014933 15:89050327-89050349 ATGTCTCAGCAGCAACCATGTGG + Intergenic
1132413078 15:101600205-101600227 CAGTGTCAGCAGAGGCCACGTGG - Intergenic
1132590994 16:726422-726444 CAGTGGCAGCAGCAGCCATGGGG - Exonic
1132793850 16:1708613-1708635 TTGGTTCAGCAGGAGCCCTGGGG - Intronic
1133689881 16:8203237-8203259 CTGTTCCTGCAGAAGCCATTAGG - Intergenic
1133863935 16:9624009-9624031 CTGTATCAGCTGAAGCCAGTGGG - Intergenic
1134348942 16:13418425-13418447 CGGTTTCAGCAGATGCCACATGG - Intergenic
1135037391 16:19089608-19089630 CTGCTGCAGGAGTAGCCATGTGG - Intergenic
1135996864 16:27256763-27256785 CTGTGTCAGCTGAAGGCATTTGG - Intronic
1138880094 16:61002734-61002756 TTGTTTCAACAAAAGCCCTGGGG + Intergenic
1140422454 16:74831803-74831825 ATTTTTCAGCAGAAGCCATTTGG + Intergenic
1141008472 16:80375142-80375164 CTGGTTCCTCAGAAGGCATGGGG - Intergenic
1141028616 16:80569724-80569746 CTGTATTATCAGAAACCATGAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141204381 16:81922215-81922237 ATGTTTCATAAGAAGCAATGTGG - Intronic
1142269136 16:89080029-89080051 CTGATTTGGCACAAGCCATGGGG + Intergenic
1145042035 17:19584173-19584195 TTGTGACAGCAGAAGCCACGGGG + Intergenic
1146925979 17:36745781-36745803 CCGTTTAAGCAGAAGCCCAGAGG + Intergenic
1148776013 17:50096074-50096096 CTCTTTCAGAAGATGCCATTGGG + Intronic
1151507556 17:74539547-74539569 CTGTGACAGCAGGAGCCATTGGG - Intergenic
1151509094 17:74547392-74547414 CTGTGACAGCAGGAGCCATTGGG - Intergenic
1151514282 17:74582155-74582177 CTGTTAGAGGAGAGGCCATGGGG + Intronic
1152201705 17:78951045-78951067 CTGTCCCAGCTGATGCCATGTGG + Intergenic
1152788081 17:82262265-82262287 CTGCTTCAGCAGTAGCCTGGGGG + Intronic
1156447013 18:37244631-37244653 CTGTTTCAAGAACAGCCATGAGG + Exonic
1156465665 18:37346744-37346766 CTGCTTGTGCAGAAGCCCTGGGG + Intronic
1156806592 18:41190453-41190475 CTTTGTCAGCAGAAGGCATGAGG + Intergenic
1158584795 18:58722506-58722528 TGGTTTCTGCAGTAGCCATGTGG - Intronic
1158926569 18:62270139-62270161 CTGCTGCTTCAGAAGCCATGTGG - Intronic
1160278409 18:77461920-77461942 CTCTCTCTGCTGAAGCCATGAGG + Intergenic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1163029941 19:14537368-14537390 CTGTTTCAGCCGCACCCAGGTGG + Intronic
1163332161 19:16646643-16646665 GTGTTTCCACAGAAGACATGTGG - Exonic
1163578867 19:18126301-18126323 CTGGTCCAGCAGTAGCCAGGGGG + Intronic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164964745 19:32472561-32472583 CTCTTTCAGCAAAAGTCAGGCGG + Intronic
1168107916 19:54175365-54175387 CTTTTGCACCAGAAGCCCTGGGG + Intronic
927287963 2:21376698-21376720 CTGTTTCTGCCCAAGTCATGAGG + Intergenic
931133847 2:59374131-59374153 CTGTGTGAGTGGAAGCCATGTGG + Intergenic
932471512 2:71962475-71962497 CTGGGCCAGCTGAAGCCATGTGG - Intergenic
934038773 2:88110492-88110514 CTGTTCCACAAGAAGCAATGAGG + Exonic
934918483 2:98321054-98321076 CTGTTTCAGCTTCAGCCATGAGG + Intergenic
935519626 2:104088416-104088438 CAATTTCAGCAAAAGCCATCTGG + Intergenic
935728165 2:106042216-106042238 CTGGTTCAACAGAAGCCAAGTGG - Intergenic
937995149 2:127688669-127688691 ATGTCTCATCAGAAGCAATGGGG - Intergenic
939325300 2:140680213-140680235 CTGTTTCAGCAGGAACCAGCAGG - Intronic
939877949 2:147599043-147599065 CTTTTTCTGCAGAAGCCTGGAGG + Intergenic
943026779 2:182638869-182638891 CTGAATAAACAGAAGCCATGTGG + Intergenic
943718485 2:191178299-191178321 CTGTATGAACAGAAGACATGGGG + Intergenic
944984122 2:205155226-205155248 CAGTTTCAGAATATGCCATGAGG + Intronic
947465078 2:230336471-230336493 CTGTTTCATGAGAATCTATGAGG + Intronic
948482365 2:238258186-238258208 CTGTGTCCACAGAAGCCATGGGG + Intronic
948619736 2:239226937-239226959 CTGTTTCAGCAGAATCTTGGAGG - Intronic
1169611882 20:7390208-7390230 CTGTTTCCGCCACAGCCATGAGG + Intergenic
1169997016 20:11569928-11569950 TTGATTAAGCAGAATCCATGAGG + Intergenic
1170308239 20:14963530-14963552 CTGTTTCAGCACAACACAAGTGG - Intronic
1171126421 20:22605813-22605835 CTCATTCAGCAGAACCAATGAGG - Intergenic
1171793774 20:29550808-29550830 CTGTTTCAGCAGGAGTTGTGGGG + Intergenic
1172096707 20:32463999-32464021 CTGTCACAGCAGCAGCCAGGCGG + Intronic
1172306163 20:33882309-33882331 CTGTTTGAGCAGAAGCCGGAGGG - Intergenic
1172364159 20:34336040-34336062 CTGTTTCTGCAGTAGCCTGGTGG - Intergenic
1173163702 20:40671330-40671352 CTGTCTCACCACAAGGCATGTGG - Intergenic
1173223550 20:41148073-41148095 CTGCTTCAGCAGAACCCACTAGG - Intronic
1173645748 20:44632155-44632177 ACATTTCAGCAGAAGCCTTGGGG + Intronic
1173747081 20:45445947-45445969 GTGTTTGAGCAGCAGCGATGAGG + Intergenic
1176074445 20:63242051-63242073 CTGTTTCAGAGGAGGCCAGGTGG + Intronic
1176264822 20:64203649-64203671 CTGGCTCAACAGCAGCCATGGGG - Intronic
1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG + Intergenic
1178024881 21:28454959-28454981 CTGTTTCTGCAAAAGCCAATAGG + Intergenic
1179537920 21:42064101-42064123 CTGATTCACCAGCAGCCTTGGGG - Intronic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1182109969 22:27716107-27716129 TTGTCTCAGCTGATGCCATGTGG - Intergenic
1182275979 22:29188942-29188964 CTGTCTGAGCAGAGGCCCTGAGG + Intergenic
1182348691 22:29685774-29685796 TGGTTTCAGCAGTACCCATGGGG + Intronic
1183367729 22:37416212-37416234 CTGCTTCAGGAGAACCCCTGGGG + Intronic
1183524113 22:38313838-38313860 CAGTTTCTGCAGGAGTCATGCGG - Intronic
1185179852 22:49353007-49353029 GGGTCTCAACAGAAGCCATGGGG - Intergenic
1185275132 22:49947476-49947498 CTGGTGCACCAGAAGCCACGAGG - Intergenic
952820415 3:37481535-37481557 ATGATGTAGCAGAAGCCATGGGG - Exonic
954289726 3:49643238-49643260 CTGGGTCTGCAGCAGCCATGGGG + Intronic
955060543 3:55488653-55488675 CTCTTTCAGCAGATGCCGCGGGG - Intronic
955075291 3:55607742-55607764 CTGTTTCAACAGTCTCCATGAGG - Intronic
955239678 3:57167500-57167522 CTGTTTCACCAAAACCCATATGG - Intronic
956185161 3:66555527-66555549 ATGTTTTACCAGAAGCCAAGAGG + Intergenic
958809270 3:98840960-98840982 TTGCTTCAGCAGAATCCCTGAGG - Intronic
960051434 3:113242441-113242463 GTGTTTTAGCAGAAGCTCTGTGG + Intronic
961911023 3:130316707-130316729 ATATGACAGCAGAAGCCATGAGG - Intergenic
962128685 3:132649576-132649598 CTGTCTCAGCAAGAGCAATGTGG - Intronic
963569795 3:146979084-146979106 TTGTGTCAACAGACGCCATGAGG - Intergenic
963838023 3:150076647-150076669 CAGTCTCAGCAGACACCATGTGG + Intergenic
964274475 3:154995015-154995037 CTGTTTTATCAGAGGACATGTGG - Intergenic
969115443 4:4868119-4868141 CTGTGTCACCAGAACCCCTGTGG - Intergenic
976480217 4:85534443-85534465 CTGCTCCAGCAGAAGGAATGTGG + Intronic
978799036 4:112737543-112737565 CTGCTCCAGCTGATGCCATGTGG - Intergenic
981175528 4:141678525-141678547 CTGCTTCAGAAAAATCCATGGGG - Intronic
981495371 4:145385769-145385791 CAGTGTCAGCAGAGACCATGTGG - Intergenic
982155277 4:152514193-152514215 CTGTCTCAGAAGAAGCTAAGTGG + Intronic
984642324 4:182181346-182181368 CTCTTTCAGCAGAAGATTTGGGG - Intronic
986093749 5:4536193-4536215 CTGCACCAGCAGAAGCCAGGAGG + Intergenic
986936736 5:12897738-12897760 TTGTTTCTGCCGAAGGCATGTGG - Intergenic
987246472 5:16054195-16054217 CTGGTGCAGCAGATGCAATGAGG + Intergenic
987288762 5:16487987-16488009 CTGTTTAAGCAGCAGCTGTGTGG + Intronic
987594493 5:19979375-19979397 CAGTTTCAGCAGAAGGTCTGAGG - Intronic
989233946 5:39122335-39122357 CTGTTTCATCAGCAGAGATGAGG - Exonic
989273623 5:39560883-39560905 TCTATTCAGCAGAAGCCATGTGG + Intergenic
989360816 5:40599457-40599479 CAGGTTCAGATGAAGCCATGAGG - Intergenic
990322059 5:54639861-54639883 ATGTATCAGCAAAAGCCAGGTGG + Intergenic
992927456 5:81603409-81603431 CTGGGTCAGAAGAAGCCTTGAGG - Intronic
996197958 5:120633028-120633050 ATTTTTCAGCAGAAACCATCAGG + Intronic
997735037 5:136206937-136206959 GTGCTTCAGCAAAAGCCATTAGG - Intergenic
999730944 5:154476417-154476439 CTCTTTCAGCAGGAACCAAGCGG + Intronic
999948142 5:156619644-156619666 CTTTTCCAGCAGAGGCCAAGGGG + Intronic
1000201060 5:159011544-159011566 CTGTTTCAGCAGAATGGAAGCGG + Intronic
1001901440 5:175433818-175433840 CTGTTTCAGCAGAATTAGTGTGG + Intergenic
1001920428 5:175595568-175595590 ATGGTTCAGCAGAGGCAATGAGG - Intergenic
1003127988 6:3371284-3371306 CTCTAGCAGCAGATGCCATGTGG - Intronic
1004750929 6:18561145-18561167 CTCTTTCTGCAGCAGCCATCTGG - Intergenic
1004754716 6:18599528-18599550 CTATTTCACCAGAAGCTATGGGG + Intergenic
1006415424 6:33900871-33900893 CTGTTGCTGCAGATGCCACGAGG + Intergenic
1007132731 6:39491687-39491709 CAGTGTTAGCAGAAGCCTTGAGG + Intronic
1007503018 6:42313032-42313054 CTGCTTCAGCAGAAACAATCAGG - Intronic
1007516006 6:42411907-42411929 CGGTGTCTGCAGAAGCCATCTGG - Intronic
1008942762 6:57064978-57065000 GAGCTTCAGCAGAAGTCATGAGG - Intergenic
1009582436 6:65553206-65553228 CTGTTTCAGATGAAGCCACTTGG - Intronic
1009840101 6:69060268-69060290 CTCTCTCAGCAAAAGCCATAGGG + Intronic
1012310045 6:97712437-97712459 CTGTCACAGCAGAGGCCATGGGG + Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015985347 6:138879053-138879075 GTGTTTCAGCAGCAGGCAGGAGG - Intronic
1017390435 6:153933093-153933115 ATGTTTCAGCAGATGCTATCTGG + Intergenic
1018029033 6:159827491-159827513 CTGTTCCAGCTGCAGCCATGTGG + Intergenic
1019096590 6:169586312-169586334 CTGTTATAGGAAAAGCCATGCGG - Intronic
1019464055 7:1176775-1176797 CTGACTCATCAGAAGCCAGGTGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022142993 7:27509361-27509383 GTGTAGCAGCAGAAGCCATGAGG + Intergenic
1023156286 7:37255879-37255901 CTCTCTCACCAGAAGCCGTGGGG + Intronic
1023157981 7:37270486-37270508 CAGTTTCCACTGAAGCCATGTGG - Intronic
1023164512 7:37330063-37330085 CTCTCCCATCAGAAGCCATGTGG - Intronic
1024163801 7:46709260-46709282 CCCTTTCAGCAGAAGACAGGTGG - Intronic
1024597114 7:50947468-50947490 CTGTTTCAGCTGAAGCCTGTGGG - Intergenic
1026290160 7:68998874-68998896 CTGGTTCAACAGAAGCCCTGAGG - Intergenic
1026502888 7:70957982-70958004 TTATTGCAGCAGCAGCCATGGGG + Intergenic
1027606835 7:80310873-80310895 CTGTTTCAACAGTGGCAATGTGG + Intergenic
1029094990 7:98077993-98078015 CTGATTCAGCAGCAGCTATAGGG - Intergenic
1029340370 7:99938834-99938856 CTGAATCAGCAGAAGCTATTTGG - Intergenic
1030084079 7:105802446-105802468 CTGTTTCAGCAGATACCACTGGG + Intronic
1030382800 7:108831908-108831930 CTGCCTCAGAAGAAGCTATGTGG - Intergenic
1033845578 7:145427910-145427932 GTGTATCAGCAGAAACCAAGTGG + Intergenic
1034214953 7:149398114-149398136 CTGTTTCTGCAGAAACCCTGTGG - Intergenic
1034255448 7:149722399-149722421 CTGTTGCAGGAGAAGACAAGAGG - Intronic
1039753740 8:40500326-40500348 CTGTTTCTGCAGGACCTATGTGG - Intergenic
1041283073 8:56231132-56231154 CAGTTTCAGAATATGCCATGAGG - Intergenic
1041803216 8:61822428-61822450 CTGATTCACCAAAACCCATGGGG - Intergenic
1043471757 8:80569950-80569972 CTCCTTCAGAAGGAGCCATGAGG - Intergenic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1045055709 8:98366724-98366746 CAGTCTCAGCTGAAGCCAGGTGG - Intergenic
1045436544 8:102170198-102170220 TTGTTTTAGTAGAGGCCATGTGG - Intergenic
1046660721 8:116945995-116946017 CTGTTACAGCAGAAGTCATTTGG - Intergenic
1048374103 8:133807135-133807157 CAGTTTCAGCATAAGCCAGATGG - Intergenic
1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG + Intronic
1049009866 8:139880139-139880161 CTCTTCCCGAAGAAGCCATGTGG - Intronic
1049361918 8:142216000-142216022 CTGCCTCAGCAGATGGCATGTGG + Intronic
1051889520 9:21927961-21927983 CAGTTTCATCAGAACCCCTGTGG - Intronic
1051991961 9:23162648-23162670 CTGTCCCAGCAGCAGCCATTCGG + Intergenic
1054152655 9:61617957-61617979 CTGTTTCAGCAGGAGTTGTGGGG + Intergenic
1054744085 9:68836785-68836807 CTGTCTTACCAGAAGCCAGGTGG + Intronic
1056534358 9:87515210-87515232 TTGTTGCAACAGAAACCATGTGG - Intronic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1059938756 9:119337397-119337419 TTGTTTCAGGATAAGCCAGGAGG + Intronic
1061649018 9:132031152-132031174 CTGCTCCATCAGAAGCCAGGTGG + Intronic
1188232049 X:27676514-27676536 CTGTTTTGGCAGAAAACATGAGG - Intronic
1189778711 X:44493459-44493481 CAGTTTCAGGAGAAACGATGAGG + Intergenic
1190876238 X:54462194-54462216 CTTTTTCAGCAGGAGGAATGAGG + Intronic
1194817652 X:98463997-98464019 TAGTTTCAACAGAAGCCATGTGG + Intergenic
1195600518 X:106742028-106742050 ATGTTTCATTAGTAGCCATGAGG + Intronic
1196897886 X:120355539-120355561 CTGTAGCAACAGAAGCCATTTGG - Intergenic
1199013342 X:142782321-142782343 CTGTTTACTCAGAAGCAATGAGG - Intergenic
1199941802 X:152635124-152635146 CAGATTCAGTAGAAGCCATCAGG + Intergenic
1201384099 Y:13419432-13419454 CTGTTCTGGCAGAAGCCTTGTGG - Intronic
1201782797 Y:17741956-17741978 CTGCTTGAGCAGAGGTCATGGGG - Intergenic
1201818756 Y:18164031-18164053 CTGCTTGAGCAGAGGTCATGGGG + Intergenic