ID: 1021601276

View in Genome Browser
Species Human (GRCh38)
Location 7:22366211-22366233
Sequence GAGGCTAAAGACGCTGGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021601267_1021601276 23 Left 1021601267 7:22366165-22366187 CCCCCTTTTCTCTCATTCTCTCG No data
Right 1021601276 7:22366211-22366233 GAGGCTAAAGACGCTGGATGTGG No data
1021601270_1021601276 20 Left 1021601270 7:22366168-22366190 CCTTTTCTCTCATTCTCTCGTAA No data
Right 1021601276 7:22366211-22366233 GAGGCTAAAGACGCTGGATGTGG No data
1021601268_1021601276 22 Left 1021601268 7:22366166-22366188 CCCCTTTTCTCTCATTCTCTCGT No data
Right 1021601276 7:22366211-22366233 GAGGCTAAAGACGCTGGATGTGG No data
1021601269_1021601276 21 Left 1021601269 7:22366167-22366189 CCCTTTTCTCTCATTCTCTCGTA No data
Right 1021601276 7:22366211-22366233 GAGGCTAAAGACGCTGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021601276 Original CRISPR GAGGCTAAAGACGCTGGATG TGG Intergenic
No off target data available for this crispr