ID: 1021602260

View in Genome Browser
Species Human (GRCh38)
Location 7:22376051-22376073
Sequence CTATTTTTCCTGGTGTCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021602260_1021602264 13 Left 1021602260 7:22376051-22376073 CCAATAGACACCAGGAAAAATAG No data
Right 1021602264 7:22376087-22376109 CTCATTGTTGAAGAGGTGAGTGG No data
1021602260_1021602263 6 Left 1021602260 7:22376051-22376073 CCAATAGACACCAGGAAAAATAG No data
Right 1021602263 7:22376080-22376102 AAAGCATCTCATTGTTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021602260 Original CRISPR CTATTTTTCCTGGTGTCTAT TGG (reversed) Intergenic
No off target data available for this crispr