ID: 1021603096

View in Genome Browser
Species Human (GRCh38)
Location 7:22384002-22384024
Sequence TGAGTCAGTTACACTTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021603096_1021603101 4 Left 1021603096 7:22384002-22384024 CCCTTTTAAGTGTAACTGACTCA No data
Right 1021603101 7:22384029-22384051 AATGCAGGCTGGCAAAGGAAAGG No data
1021603096_1021603102 27 Left 1021603096 7:22384002-22384024 CCCTTTTAAGTGTAACTGACTCA No data
Right 1021603102 7:22384052-22384074 CTGTAGAAGCAAAAGCAGTGAGG No data
1021603096_1021603099 -7 Left 1021603096 7:22384002-22384024 CCCTTTTAAGTGTAACTGACTCA No data
Right 1021603099 7:22384018-22384040 TGACTCACAGTAATGCAGGCTGG No data
1021603096_1021603100 -1 Left 1021603096 7:22384002-22384024 CCCTTTTAAGTGTAACTGACTCA No data
Right 1021603100 7:22384024-22384046 ACAGTAATGCAGGCTGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021603096 Original CRISPR TGAGTCAGTTACACTTAAAA GGG (reversed) Intergenic
No off target data available for this crispr