ID: 1021603097

View in Genome Browser
Species Human (GRCh38)
Location 7:22384003-22384025
Sequence GTGAGTCAGTTACACTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021603097_1021603100 -2 Left 1021603097 7:22384003-22384025 CCTTTTAAGTGTAACTGACTCAC No data
Right 1021603100 7:22384024-22384046 ACAGTAATGCAGGCTGGCAAAGG No data
1021603097_1021603099 -8 Left 1021603097 7:22384003-22384025 CCTTTTAAGTGTAACTGACTCAC No data
Right 1021603099 7:22384018-22384040 TGACTCACAGTAATGCAGGCTGG No data
1021603097_1021603102 26 Left 1021603097 7:22384003-22384025 CCTTTTAAGTGTAACTGACTCAC No data
Right 1021603102 7:22384052-22384074 CTGTAGAAGCAAAAGCAGTGAGG No data
1021603097_1021603101 3 Left 1021603097 7:22384003-22384025 CCTTTTAAGTGTAACTGACTCAC No data
Right 1021603101 7:22384029-22384051 AATGCAGGCTGGCAAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021603097 Original CRISPR GTGAGTCAGTTACACTTAAA AGG (reversed) Intergenic
No off target data available for this crispr