ID: 1021603102

View in Genome Browser
Species Human (GRCh38)
Location 7:22384052-22384074
Sequence CTGTAGAAGCAAAAGCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021603097_1021603102 26 Left 1021603097 7:22384003-22384025 CCTTTTAAGTGTAACTGACTCAC No data
Right 1021603102 7:22384052-22384074 CTGTAGAAGCAAAAGCAGTGAGG No data
1021603096_1021603102 27 Left 1021603096 7:22384002-22384024 CCCTTTTAAGTGTAACTGACTCA No data
Right 1021603102 7:22384052-22384074 CTGTAGAAGCAAAAGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021603102 Original CRISPR CTGTAGAAGCAAAAGCAGTG AGG Intergenic
No off target data available for this crispr