ID: 1021604004

View in Genome Browser
Species Human (GRCh38)
Location 7:22392811-22392833
Sequence TATGCAGGGCTACCCAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021603994_1021604004 20 Left 1021603994 7:22392768-22392790 CCCCATCCCAATGATGCTGGAAA No data
Right 1021604004 7:22392811-22392833 TATGCAGGGCTACCCAATGGTGG No data
1021603996_1021604004 18 Left 1021603996 7:22392770-22392792 CCATCCCAATGATGCTGGAAAAT No data
Right 1021604004 7:22392811-22392833 TATGCAGGGCTACCCAATGGTGG No data
1021603995_1021604004 19 Left 1021603995 7:22392769-22392791 CCCATCCCAATGATGCTGGAAAA No data
Right 1021604004 7:22392811-22392833 TATGCAGGGCTACCCAATGGTGG No data
1021603989_1021604004 27 Left 1021603989 7:22392761-22392783 CCCCCATCCCCATCCCAATGATG No data
Right 1021604004 7:22392811-22392833 TATGCAGGGCTACCCAATGGTGG No data
1021603988_1021604004 28 Left 1021603988 7:22392760-22392782 CCCCCCATCCCCATCCCAATGAT No data
Right 1021604004 7:22392811-22392833 TATGCAGGGCTACCCAATGGTGG No data
1021603992_1021604004 24 Left 1021603992 7:22392764-22392786 CCATCCCCATCCCAATGATGCTG No data
Right 1021604004 7:22392811-22392833 TATGCAGGGCTACCCAATGGTGG No data
1021603998_1021604004 14 Left 1021603998 7:22392774-22392796 CCCAATGATGCTGGAAAATGGCG No data
Right 1021604004 7:22392811-22392833 TATGCAGGGCTACCCAATGGTGG No data
1021603990_1021604004 26 Left 1021603990 7:22392762-22392784 CCCCATCCCCATCCCAATGATGC No data
Right 1021604004 7:22392811-22392833 TATGCAGGGCTACCCAATGGTGG No data
1021603999_1021604004 13 Left 1021603999 7:22392775-22392797 CCAATGATGCTGGAAAATGGCGA No data
Right 1021604004 7:22392811-22392833 TATGCAGGGCTACCCAATGGTGG No data
1021603991_1021604004 25 Left 1021603991 7:22392763-22392785 CCCATCCCCATCCCAATGATGCT No data
Right 1021604004 7:22392811-22392833 TATGCAGGGCTACCCAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021604004 Original CRISPR TATGCAGGGCTACCCAATGG TGG Intergenic
No off target data available for this crispr