ID: 1021611503

View in Genome Browser
Species Human (GRCh38)
Location 7:22462158-22462180
Sequence TAATCCAGGAGTGAAGCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021611503_1021611507 -9 Left 1021611503 7:22462158-22462180 CCCCTAGCTTCACTCCTGGATTA 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1021611507 7:22462172-22462194 CCTGGATTAGAGAATTTGCAAGG 0: 1
1: 0
2: 0
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021611503 Original CRISPR TAATCCAGGAGTGAAGCTAG GGG (reversed) Intronic
908095149 1:60729853-60729875 TAATCCAGAAGTGGAGAGAGTGG - Intergenic
912590526 1:110814595-110814617 AAAGTCAGGACTGAAGCTAGAGG - Intergenic
914858185 1:151367009-151367031 AAATCCAGCAGTGGAGGTAGAGG - Intronic
918290222 1:183100218-183100240 TAATCCAGGAGAGATGACAGAGG - Intronic
919122345 1:193356866-193356888 CAAGCCAGAAGTAAAGCTAGTGG - Intergenic
919542419 1:198866334-198866356 TAATCAAAGAGTGATTCTAGAGG + Intergenic
921241818 1:213192476-213192498 TAATTCAGCAGTGAAGCCATTGG + Intronic
921942617 1:220858407-220858429 GAATCCAGGAGTGAAGCCTTTGG + Intergenic
1066446292 10:35486792-35486814 AAATCCAGGTGTGAGGCAAGTGG - Intronic
1068250375 10:54431148-54431170 GAATTCAGCAGTGAAGCTATTGG - Intronic
1068451187 10:57191129-57191151 GAATTCAGTAGTGAAGCCAGTGG + Intergenic
1069759032 10:70795241-70795263 TAATCCAGGAATGGAGTTAGAGG + Intergenic
1071739209 10:88337710-88337732 AAATCCAGGAGTAAAGCTATAGG - Intronic
1075021225 10:118953888-118953910 TAACCTAGGAGGGTAGCTAGTGG - Intergenic
1080998478 11:37636113-37636135 TCACCCAGGAGTGAAATTAGTGG + Intergenic
1081249913 11:40816522-40816544 GAATCAAGGTGTGAAGCCAGTGG - Intronic
1094440861 12:30474895-30474917 GAATTCAGTAGTGAAGCTATTGG - Intergenic
1095249982 12:39968040-39968062 TAATACAGGAGGGAAGCTATAGG - Intronic
1095452237 12:42344430-42344452 TAATCTAGGAGGGAAGAAAGTGG - Intronic
1095961539 12:47837890-47837912 TCAGCCTGGAGTGAATCTAGAGG + Intergenic
1098407347 12:70140475-70140497 TAATCCAGGAATAAAGTTAGAGG + Intergenic
1106871187 13:34023247-34023269 TATTCTAGGAGTGAAAATAGAGG + Intergenic
1109122864 13:58480639-58480661 TAATCAAGGAGTGGAGAAAGTGG - Intergenic
1110359955 13:74613397-74613419 GAATCCAGGAGTGGAGATAAAGG - Intergenic
1114439238 14:22732841-22732863 TAATCCAGGAATAGAGTTAGAGG - Intergenic
1115276077 14:31610455-31610477 GAATTCAGCAGTGAAGCTATTGG - Intronic
1115362060 14:32514884-32514906 TAATCCTGGAGTGAAGGTGGGGG + Intronic
1116602605 14:46946179-46946201 TATTCAATGAGTGAAGCTATAGG - Intronic
1117110663 14:52450481-52450503 TAATTCAGCAGTGAAGCCATTGG - Intronic
1118923416 14:70170292-70170314 TAATCCAAGAGTGAACCTGAAGG - Intronic
1118990921 14:70796340-70796362 TAAACCAGTAGTTAAGCCAGGGG + Intronic
1121614769 14:95306089-95306111 TGACCCAGGAGAGAAGCGAGGGG + Intronic
1124864218 15:33473194-33473216 TAATCCTGGAGTGAGGTCAGTGG - Intronic
1128181796 15:65611278-65611300 TCATCCCGGAGGGACGCTAGGGG + Intronic
1131606288 15:93906427-93906449 TAATCCAGGAAGGAAGGAAGAGG - Intergenic
1134537418 16:15037321-15037343 TAATCCAGCAGTCAAGCTTTTGG + Exonic
1141472881 16:84251604-84251626 GAATCCAGGAGTGAGGGTTGAGG + Intergenic
1143682432 17:8487348-8487370 GAGTCCAGCAGTGAAGCTGGGGG - Intronic
1144701026 17:17340083-17340105 GAATTCAGCAGTGAAGCTATTGG + Intronic
1152241522 17:79163702-79163724 TCAGCCAGGAGGGAAGCAAGTGG - Intronic
1152840016 17:82561399-82561421 TGAGCCAGGAGTGAGGGTAGAGG + Intronic
1155597648 18:27506708-27506730 GAATTCAGGAGTGAAGCCATTGG - Intergenic
1161518654 19:4711231-4711253 TACTCCTGGAGTAAAGGTAGAGG - Intronic
1162028707 19:7908325-7908347 TCCTCCAGGAGGGGAGCTAGGGG + Intronic
1162437141 19:10668058-10668080 TAATGCAAGAAGGAAGCTAGTGG + Intronic
1167768072 19:51497410-51497432 TATATCAGGAGTGACGCTAGGGG - Exonic
1168173315 19:54605724-54605746 TAATCCAGGACTGAAAATGGGGG + Intronic
925826373 2:7852026-7852048 TGATCCAGGAGTGATTCCAGAGG + Intergenic
926379548 2:12272320-12272342 TAACCCAGTTGTGAAGCTATTGG + Intergenic
930718279 2:54613840-54613862 TAAAACTGGGGTGAAGCTAGAGG - Intronic
930734300 2:54759798-54759820 TGATCCAAGAGTGAAGTTCGAGG + Intronic
931166790 2:59757326-59757348 TAATCCAAGAGTGAAAATATGGG + Intergenic
937520305 2:122705842-122705864 TTATCCATGAGCTAAGCTAGGGG + Intergenic
940474592 2:154146776-154146798 TAATGCAGGAGGGAAACTAATGG - Intronic
940507251 2:154571635-154571657 TATTCCATGAGTGAAGCCACTGG - Intergenic
941789082 2:169531258-169531280 TGATCAAGGATTGAAGGTAGTGG - Intronic
942964680 2:181877108-181877130 GAAGGCAGGAGTGAAGCAAGTGG - Intergenic
942975394 2:182011220-182011242 AAATTCAGCAGTGAAGCTATTGG + Intronic
944326755 2:198414757-198414779 TTATCCAGGAGTGAGACTGGGGG + Intronic
944487002 2:200217547-200217569 TGAGCCAGGAGTGAAGCTGCAGG + Intergenic
945039769 2:205733917-205733939 TAATCCCGCAGTAAATCTAGCGG + Intronic
945633803 2:212320595-212320617 GAGGGCAGGAGTGAAGCTAGGGG + Intronic
1168858654 20:1029034-1029056 GAGTCCAGGAGAGAAGGTAGCGG - Intergenic
1170063048 20:12280142-12280164 GAATTCAGCAGTGAAGCTATAGG - Intergenic
1172136296 20:32689158-32689180 TAATCCAGGGGTGTAGATGGGGG - Intergenic
1173457052 20:43211344-43211366 TAATCCAGGGGTGAAGGAGGTGG - Intergenic
1174208548 20:48858621-48858643 TAACACAGGAGTGAGGCCAGAGG - Intergenic
1175747712 20:61471137-61471159 AAATTCAGCAGTGAAGCCAGTGG + Intronic
949115171 3:311664-311686 TGCTCCAGGAGTGAAGCTAGTGG + Intronic
949281303 3:2350893-2350915 TAATCCAGGAATGTAGCAAATGG - Intronic
950893918 3:16430943-16430965 TAAGCCAGCAGTGAAGCTGGGGG - Intronic
958831055 3:99089765-99089787 TAATCCAGAAGTTAAGCTTAGGG - Intergenic
960094925 3:113680201-113680223 GAATTCAGCAGTGAAGCTATTGG + Intronic
962041047 3:131707809-131707831 TATAGCAAGAGTGAAGCTAGGGG - Intronic
962159830 3:132987494-132987516 TCATCCAGGAGTGAGGCTGCAGG + Intergenic
962841255 3:139234933-139234955 TCATCCAGGAGTGGAGTCAGGGG - Intronic
966180002 3:177179567-177179589 TCTCCCAGGAGTGAAGCTAAAGG + Intronic
971622322 4:28871324-28871346 TAATCTAAGAGTAAAGCTAATGG - Intergenic
972909936 4:43802142-43802164 GAATTCAGCAGTGAAGCTATTGG - Intergenic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
975312783 4:72921436-72921458 GAATCCAGCAATGAAGCTATCGG + Intergenic
976059890 4:81114973-81114995 TAATACAGCAGTGAAAATAGTGG - Intronic
976105565 4:81613499-81613521 TAATCCAGAGTTGAAGGTAGAGG + Intronic
976255395 4:83095175-83095197 TAATACAGGAGAGAAGCTAATGG + Intronic
977653835 4:99499102-99499124 GAATCAAGGAATGAAGCAAGAGG + Intergenic
978297939 4:107230447-107230469 TAATTCAGCAGTGAAACTATTGG - Intronic
978519955 4:109605121-109605143 TAATTCAGCAGTGAAGCCATTGG + Intronic
981287114 4:143030831-143030853 AAATTCAGCAGTGAAGCTATTGG - Intergenic
983389230 4:167107043-167107065 GAATTCAGCAGTGAAGCCAGTGG - Intronic
984627857 4:182028072-182028094 GAATTCAGCAGTGAAGCTATTGG + Intergenic
986882657 5:12194335-12194357 TATTACTGGAGTGAAACTAGTGG - Intergenic
990862409 5:60341463-60341485 TAACCCAGAAGTGGAGCTGGAGG + Intronic
991163508 5:63533279-63533301 TAATCCATGTGTCAAGCGAGGGG + Intergenic
991434103 5:66578581-66578603 TAGTTCAGGACTGAAGGTAGGGG + Intergenic
994488784 5:100414882-100414904 TAATCCAAGAGTGAAACAAATGG - Intergenic
995085687 5:108106753-108106775 TAAATCAGGAGTGATGCTATGGG + Intronic
995891717 5:116961216-116961238 TAATTCAGAAGTGAAGCTTTCGG - Intergenic
997250250 5:132383193-132383215 TATTACAGGAGTCAGGCTAGCGG - Intronic
1005535402 6:26750097-26750119 GAAGCCAGGAGTGAAGCTTCTGG + Intergenic
1006358143 6:33572781-33572803 TAATCCAGGGGTGTAGATGGGGG - Exonic
1006553719 6:34847408-34847430 AAATTCAGCAGTGAAGCTATTGG + Intronic
1008766882 6:54928140-54928162 TGATTCAGGACTGAAGCCAGGGG - Intronic
1009006436 6:57793730-57793752 GAAGCCAGGAGTGAAGCTTCTGG + Intergenic
1009266179 6:61557742-61557764 AAATTCAGCAGTGAAGCTATTGG + Intergenic
1009479623 6:64140607-64140629 TGATACAGGAATGAAGCTGGGGG - Intronic
1010626571 6:78143484-78143506 GAATTCAGCAGTGAAGCTATTGG - Intergenic
1011102598 6:83740190-83740212 TAATTCAACAGTGAAGCTATTGG + Intergenic
1011412696 6:87082499-87082521 TAATGCAAGAGTGAAACTGGAGG + Intergenic
1011815143 6:91180715-91180737 TTATGAAGGAGTGAAGCTACAGG + Intergenic
1011933896 6:92750508-92750530 GAATTCAGCAGTGAAGCCAGTGG + Intergenic
1014035324 6:116760824-116760846 TAATCCCTGTGTGAAGTTAGTGG + Intronic
1015739384 6:136437200-136437222 AAATAAAGGAGTGAAGCTAAAGG - Intronic
1017218234 6:151935428-151935450 CAGTCCAGGAGTGAAGGCAGTGG - Intronic
1018755181 6:166842592-166842614 TAATCCAGCACTGAAGCCAGAGG + Intronic
1018875334 6:167817552-167817574 TAATCCAGGAGCGGAGGGAGAGG + Intergenic
1019129405 6:169862686-169862708 CACTACAGGAGTGAAGCCAGTGG - Intergenic
1019413413 7:916568-916590 TAAGGCAGGAGTGGAGCGAGGGG + Intronic
1021611503 7:22462158-22462180 TAATCCAGGAGTGAAGCTAGGGG - Intronic
1023947261 7:44812945-44812967 TCATCCAGGAGTGAGGAAAGGGG + Intronic
1026466263 7:70657656-70657678 TAGTGAAGGAGTGACGCTAGGGG - Intronic
1028311432 7:89342850-89342872 GAATCCAGGAATATAGCTAGTGG - Intergenic
1028369052 7:90070361-90070383 CAAGGCAGGAGTGAGGCTAGGGG + Intergenic
1032497292 7:132372011-132372033 TAATGCAGGTGTCAATCTAGAGG - Intronic
1034408438 7:150922260-150922282 TGATCCTGGATTGCAGCTAGTGG + Intergenic
1034438197 7:151073665-151073687 CAATCCAGGAGTGTAGAAAGGGG + Intronic
1036159390 8:6372413-6372435 CAATCCAGTACTGAAGGTAGAGG + Intergenic
1037024842 8:14022392-14022414 TAATTCAGGAGTGATCCAAGGGG - Intergenic
1037433018 8:18833598-18833620 AAATACAGGAATGAAACTAGTGG - Intronic
1039274342 8:35918878-35918900 TAATAAAGTAGTGAAGATAGTGG + Intergenic
1041484543 8:58359683-58359705 CAATCCAGGACTGAAGCCAATGG + Intergenic
1041903904 8:63010956-63010978 TAATCCAGGAGTGACGTGACTGG + Intergenic
1042274820 8:66993328-66993350 TAAGCCAGGAGTGAAGTAACTGG - Intronic
1042656512 8:71103785-71103807 TAATCCTGAAATGAAGCTTGTGG - Intergenic
1042781203 8:72493040-72493062 TAATCAAGAAGGAAAGCTAGAGG + Intergenic
1043457854 8:80430033-80430055 TAATCCAGTGGTGAAGAAAGTGG + Intergenic
1044144490 8:88694471-88694493 GAATTCAGCAGTGAAGCTATCGG + Intergenic
1045249720 8:100473370-100473392 TCATCTTGGAGTGAAGCTATTGG + Intergenic
1046784174 8:118248410-118248432 TAGTCCAGCAGTCAAGCTGGTGG + Intronic
1047844678 8:128793200-128793222 TAAGCCTGGAGTGAAGCAACTGG - Intergenic
1048974738 8:139664837-139664859 TGCTCCAGGAATGAAGCCAGAGG - Intronic
1050510271 9:6387255-6387277 AAATTCAGCAGTGAAGCTATTGG - Intergenic
1050921323 9:11204664-11204686 GACTCCAGGAGTGCACCTAGCGG + Intergenic
1051047804 9:12896127-12896149 TAATACACAAGTTAAGCTAGTGG - Intergenic
1055406173 9:75975908-75975930 TGACCCTGGAGTGAAGCTGGGGG + Intronic
1056120323 9:83481309-83481331 TAATCCAGTTTTGTAGCTAGAGG + Intronic
1056839571 9:89987557-89987579 TAATACAGGAGTGCAGCAGGTGG - Intergenic
1059465744 9:114467693-114467715 TAATCCATGAGGGAAGCTGCAGG + Intronic
1061039818 9:128133912-128133934 TCATCCAGGAGTGAAACTGCTGG + Intergenic
1186273182 X:7912042-7912064 TTATGCAGGACTGAAGCTAGTGG - Exonic
1189716419 X:43871144-43871166 TTATCCTGGATTGAAGCAAGAGG + Intronic
1190401226 X:50037186-50037208 TAATTCAGGACTGTAGCTTGAGG + Intronic
1190604598 X:52127430-52127452 TCATCCAGAAATGAAGCTAGTGG + Intergenic
1192066368 X:67889671-67889693 TAAGGCAGCAGTGAAGCTGGGGG - Intergenic
1193098699 X:77582883-77582905 GAATTCAGCAGTGAAGCTATTGG - Intronic
1193406980 X:81112839-81112861 ATATCTAGGAGTGAAGCTATTGG - Intergenic
1194389378 X:93297364-93297386 GAATCCAGCAGTGAAGCCATTGG - Intergenic
1194612896 X:96065031-96065053 GAATTCAGCAGTGAAGCCAGTGG + Intergenic
1195480240 X:105336671-105336693 GAATTCAGGAGAGAAGCCAGAGG - Intronic
1197196386 X:123705994-123706016 TAAACCAGTAGTTAAGCTTGAGG - Intronic
1197623230 X:128775228-128775250 GAATCCAGCAGTGAAGCCATGGG + Intergenic
1200396027 X:155988494-155988516 TAATCCAGGAATAGAGTTAGAGG + Intergenic
1200840132 Y:7773545-7773567 CAAGCCAGAAGTGAAGCTGGGGG - Intergenic
1201269180 Y:12237829-12237851 AAATACAGGAGGGAAGCTAATGG - Intergenic