ID: 1021613707

View in Genome Browser
Species Human (GRCh38)
Location 7:22481466-22481488
Sequence ATACCATTCTCTTCTTGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021613707_1021613711 24 Left 1021613707 7:22481466-22481488 CCTCTACAAGAAGAGAATGGTAT 0: 1
1: 0
2: 0
3: 5
4: 166
Right 1021613711 7:22481513-22481535 TGTCAGAAATGCAGAGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021613707 Original CRISPR ATACCATTCTCTTCTTGTAG AGG (reversed) Intronic