ID: 1021620432

View in Genome Browser
Species Human (GRCh38)
Location 7:22545615-22545637
Sequence AAGGGCCAAATGAACTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021620428_1021620432 9 Left 1021620428 7:22545583-22545605 CCTGATCTGTGGAGTAGGGCTAT 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1021620432 7:22545615-22545637 AAGGGCCAAATGAACTCTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 198
1021620427_1021620432 10 Left 1021620427 7:22545582-22545604 CCCTGATCTGTGGAGTAGGGCTA 0: 1
1: 0
2: 1
3: 9
4: 100
Right 1021620432 7:22545615-22545637 AAGGGCCAAATGAACTCTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 198
1021620423_1021620432 21 Left 1021620423 7:22545571-22545593 CCGCACTGGTTCCCTGATCTGTG 0: 1
1: 2
2: 20
3: 61
4: 317
Right 1021620432 7:22545615-22545637 AAGGGCCAAATGAACTCTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021620432 Original CRISPR AAGGGCCAAATGAACTCTTC TGG Intronic
902646339 1:17801932-17801954 AAGGGTCATATGAATTGTTCAGG + Intronic
902825455 1:18970491-18970513 ATGGACCAGATGAGCTCTTCTGG - Intergenic
905011760 1:34751900-34751922 AAGAGCCACATGAACTATCCAGG + Intronic
905715182 1:40143264-40143286 AAGGGGCAAATGGAATCTTTTGG - Intergenic
906207843 1:43996622-43996644 GACGGACAAATGAACACTTCAGG + Intronic
907783939 1:57593701-57593723 AAGGCCCAAATGACATCATCAGG + Intronic
911725926 1:101240426-101240448 AGGGGCCAAATGAACCCTTTAGG - Exonic
912682304 1:111737163-111737185 AAGGGCCAAATGAAAGCTAATGG + Intronic
912703993 1:111898514-111898536 AAGGGGCAAATGAACAGTTCTGG - Intronic
916229599 1:162527715-162527737 AAGGGCCACAAGATTTCTTCTGG - Exonic
918111252 1:181457203-181457225 AAGGGGCAAAGGATCTCTTTGGG + Intronic
918185890 1:182127495-182127517 AATGGCAAAATAAACTGTTCAGG - Intergenic
918518347 1:185387031-185387053 ATGGGCCAAATAAAGTCTGCAGG + Intergenic
920111961 1:203593112-203593134 AAGGACCAAATGACCTCTGAAGG + Intergenic
920618103 1:207514496-207514518 GAGGGCCAAAGGAGCTCTTCCGG - Intronic
920634536 1:207686883-207686905 GAGGGGCAAAGGAGCTCTTCTGG - Intronic
920920933 1:210296682-210296704 TGGGGCTAAATGAACTCTGCTGG - Intergenic
923387244 1:233477244-233477266 GTGGGCAAAATGAACCCTTCAGG + Intergenic
924086850 1:240461252-240461274 AATGGCCAAATTACCTGTTCAGG - Intronic
924351849 1:243122187-243122209 AAGGGCCTGGTGACCTCTTCGGG + Intergenic
924485734 1:244481757-244481779 AAGGGAAAAAGGAACTCTTTGGG - Intronic
924537871 1:244952938-244952960 AAGGGCCCAACGAGCTTTTCTGG - Intergenic
924567909 1:245213261-245213283 AGGGGCCACATGACCACTTCAGG + Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065653134 10:27915417-27915439 AAGGGGCAAAGGAGCTCTCCGGG + Intronic
1066216407 10:33292630-33292652 GTTGGACAAATGAACTCTTCAGG - Intronic
1066339474 10:34516397-34516419 AATGGCTAACAGAACTCTTCAGG + Intronic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067968290 10:50940033-50940055 AAGGGGCAAGTGAACTCTCTGGG - Intergenic
1069030514 10:63590702-63590724 AAGGGCCAAAGGGACTTTTAAGG + Intronic
1069109975 10:64435257-64435279 AAGGGCACATGGAACTCTTCAGG + Intergenic
1071464443 10:85926543-85926565 AAGGGCCAAATGCAATTTCCTGG - Intronic
1072030349 10:91515103-91515125 AAGGGCCAAATGAATGGTTTTGG - Intergenic
1074386744 10:113022550-113022572 AAGGGGGAAATGAACACTTTAGG - Intronic
1074757940 10:116640707-116640729 AGGAGGCAAATGAACTCTACAGG - Intronic
1075992511 10:126849946-126849968 AAGGAACAAATGAAGTCTTGAGG + Intergenic
1076144057 10:128102942-128102964 AGGGGCCCGAAGAACTCTTCTGG + Exonic
1076224746 10:128765009-128765031 AGGGGGCAGATGGACTCTTCAGG + Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1078315660 11:10291289-10291311 AAGGGTCAAATGAGCTCTCTGGG - Intronic
1080062221 11:27969210-27969232 CAGGGCCATATGACCTCTTCTGG + Intergenic
1080821047 11:35806837-35806859 TAGGGCCAAATTAACTCTTGTGG + Exonic
1082662347 11:55927287-55927309 AATGGGCAAAGGAACTCTCCAGG + Intergenic
1083083663 11:60120125-60120147 AAGTACAAAATGAACTTTTCAGG + Intergenic
1084140896 11:67228335-67228357 AATGGCCAAATGAAATACTCTGG + Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085768093 11:79301426-79301448 CTGACCCAAATGAACTCTTCAGG + Intronic
1085901190 11:80701813-80701835 AAGGGGCACAGGAACTCCTCTGG + Intergenic
1086116116 11:83252665-83252687 AAGGGGCAAATGGAGGCTTCTGG + Intronic
1088401505 11:109425539-109425561 AAGGTACAAAAGAACACTTCTGG - Exonic
1090140529 11:124254724-124254746 GAGGGCTAAATGAAAGCTTCTGG - Intergenic
1091101438 11:132877460-132877482 AGAAGTCAAATGAACTCTTCAGG - Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093516313 12:19990712-19990734 CATGGCAAAATGAACTCTGCAGG + Intergenic
1096019083 12:48307269-48307291 AAGGGCAAAATGTACTCATTTGG - Intergenic
1097545605 12:60996965-60996987 AAGGGCCCAATAAACTCTCTTGG + Intergenic
1099842331 12:87981685-87981707 TGGGTCCAAATGAAGTCTTCTGG - Intronic
1099958049 12:89370332-89370354 AAGGGCTAAATGAAGCCTTCTGG + Intergenic
1101202390 12:102450318-102450340 AAGAGCTAAATGAACTATTTTGG + Intronic
1104230656 12:126880880-126880902 CAGGGAAAAATGAACTTTTCGGG + Intergenic
1104803008 12:131567442-131567464 AAGGGCCAGCTGAACACTTGAGG + Intergenic
1105752504 13:23434437-23434459 AAGGCTCAAATGATCTCTCCTGG + Intergenic
1106013063 13:25843516-25843538 AAGGGGCAAATGAGCTCTCTAGG - Intronic
1106673277 13:31930410-31930432 CAGGACCAAATGAAATATTCAGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108322398 13:49301534-49301556 AAGGGCCTTAGGAACACTTCTGG + Intergenic
1110740255 13:78987016-78987038 AAGGGCCAATTGAGCTCTATAGG - Intergenic
1115337423 14:32255526-32255548 GAGGGCCAACTGACCTATTCAGG + Intergenic
1115525148 14:34272431-34272453 AAAGGCCAAGGGAGCTCTTCTGG + Intronic
1117049014 14:51842352-51842374 AAGAAACAAATGAACTGTTCTGG - Intronic
1117750435 14:58916907-58916929 AAGGGCCCAATAAGCTCTTCTGG - Intergenic
1119932997 14:78566240-78566262 AAGGGCCAAATGGTGACTTCAGG + Intronic
1121979406 14:98441568-98441590 AAGGGGCAAATGAGCTCTCTAGG + Intergenic
1124785534 15:32676043-32676065 AAGGGCCAAATGCAGTTATCTGG - Intronic
1125362514 15:38879142-38879164 AAGGACCAAATGGACTCACCAGG - Intergenic
1126347819 15:47715693-47715715 TAGGGCAAATTGCACTCTTCAGG + Intronic
1126705375 15:51400877-51400899 GATGGCCAAAAGTACTCTTCTGG - Intronic
1126837043 15:52678660-52678682 CAGCCCCAAACGAACTCTTCCGG + Intronic
1127205691 15:56715804-56715826 GAGGGCCAAATGTGCACTTCTGG - Intronic
1129894581 15:79093936-79093958 AAGGGCTAAATGAACACTAGTGG - Intergenic
1132927598 16:2439318-2439340 AAGGGAACAATGAACTCTGCTGG + Intronic
1135924490 16:26680662-26680684 CAGGGCCTGATAAACTCTTCTGG + Intergenic
1139243529 16:65418763-65418785 AAGGGGCAAATGAGCTCTCTAGG + Intergenic
1139442944 16:66977809-66977831 AAGGGCCAAGTGAACAGTGCAGG + Intergenic
1139930658 16:70523605-70523627 AAGTGCCCAATGAACTCTAATGG + Intergenic
1143745056 17:8987360-8987382 AAGGGCCACAAGAAACCTTCTGG - Intergenic
1146125044 17:30224738-30224760 AGGGGCCAAATGATTTGTTCTGG + Intronic
1146412001 17:32594007-32594029 AAGGGGCATATGGACTCTTCGGG + Intronic
1148061207 17:44837711-44837733 GCGGGCAAGATGAACTCTTCAGG + Intergenic
1148237469 17:45978507-45978529 CAGGTCCAAATGATCTTTTCAGG - Intronic
1157689672 18:49671055-49671077 AAGGGGCAAATGAACTCTCTGGG - Intergenic
1158346531 18:56521846-56521868 AAGGAACAAATGAATTCCTCCGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1163969117 19:20775469-20775491 AAGGGCAAAATGAACCCCTTGGG + Intronic
1164437475 19:28243618-28243640 AGAGGCAAAAGGAACTCTTCTGG + Intergenic
926552516 2:14317258-14317280 AAGGGGCAAAAGAACTCTTTAGG + Intergenic
926975861 2:18516163-18516185 AATGGCAAAATGAACTTGTCTGG + Intergenic
927712880 2:25336593-25336615 AGGGGCCAAATGAGCTCATTTGG - Intronic
928758135 2:34550094-34550116 AAGGAAGATATGAACTCTTCTGG - Intergenic
930580047 2:53200080-53200102 AAGTTTCAAATGAAATCTTCCGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
934875821 2:97919013-97919035 AAAGGCCACATGTAGTCTTCTGG - Intronic
936174261 2:110205090-110205112 AAGGGTCAAATGTTCTCTTGCGG + Intergenic
937530125 2:122818244-122818266 AAGGGACAAATTAACTCTACAGG + Intergenic
939369597 2:141281855-141281877 AAGGATCAAGTGATCTCTTCAGG - Intronic
939504880 2:143032977-143032999 AAGGTAAAAATGACCTCTTCTGG - Intronic
940100870 2:150036860-150036882 AAGGGCCAAATTAACTATAAAGG + Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
943307031 2:186275702-186275724 AAGGGGCAAGAGAGCTCTTCAGG + Intergenic
945655775 2:212621137-212621159 AAGGTACAAATGAACATTTCAGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1168967120 20:1905458-1905480 GAGGGCTAAATGAAGGCTTCTGG + Intronic
1170277269 20:14605315-14605337 ACGAGCCAAAGGAACTCCTCAGG - Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1173302180 20:41813931-41813953 AAGGGGCACAGGAACCCTTCTGG + Intergenic
1177499749 21:21938172-21938194 AATGTCCAAATGAACTTTTCAGG + Intergenic
949263423 3:2129087-2129109 AAAGGCCAAATCAACTATTTAGG + Intronic
950114477 3:10441690-10441712 TTGGGCCACATGTACTCTTCTGG - Intronic
952850092 3:37720972-37720994 CAGGGCCAAGTGGACTCTTTGGG + Intronic
954903428 3:54040012-54040034 ATGGGTCAGATGAACACTTCTGG - Intergenic
955758290 3:62249525-62249547 AAGGGTTAAATGAACTTTACAGG + Intronic
956225421 3:66952102-66952124 TTGGGGCAAATAAACTCTTCTGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957504700 3:81104604-81104626 AGGGGCCATAAAAACTCTTCAGG + Intergenic
960511053 3:118549796-118549818 AATTGCCAAATGAACTTGTCAGG + Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
962685447 3:137843195-137843217 AAGGGACAAAGGAGCTCTCCAGG - Intergenic
964497056 3:157302497-157302519 AAGGGACAAGTGATCTCTCCTGG - Intronic
964515703 3:157505346-157505368 GAGGCCCAAATGAAGTCATCAGG + Intronic
964700601 3:159561809-159561831 AAGGGACAAATTAACCCCTCTGG + Intronic
969024340 4:4161595-4161617 AAAGGCCTATTGAACTCTTGGGG - Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
975204629 4:71630704-71630726 GTGGGCCAAAAGACCTCTTCAGG - Intergenic
977876593 4:102157142-102157164 AAGGGACAAATGAGCTCTCTGGG - Intergenic
979761686 4:124413750-124413772 AAGGGCCAAATCAGCTCTCTGGG - Intergenic
981252657 4:142622974-142622996 AAGGGCCAAAACATCTCTTTGGG - Intronic
983663429 4:170155476-170155498 AAAGGCCAAATGTAAGCTTCTGG - Intergenic
984842354 4:184080263-184080285 AAGGGCATCATGGACTCTTCTGG + Intergenic
988515389 5:31899798-31899820 AAGGGGCAAATGAGCTCTCTTGG - Intronic
1000284081 5:159811509-159811531 AAGGGACAAATGAACTTCTGTGG - Intergenic
1000344990 5:160307127-160307149 CAGCCCCAAATGGACTCTTCTGG - Intronic
1000501746 5:162060519-162060541 AGAGGCCAATTGAAATCTTCAGG + Intergenic
1000922631 5:167156723-167156745 GAGGGCAAAATGCACTCTCCTGG + Intergenic
1000981430 5:167820773-167820795 AAGAGCCAAATGAGCTTTGCGGG + Intronic
1001682385 5:173568208-173568230 AAGGGCCTACTCAAGTCTTCTGG - Intergenic
1002869481 6:1153946-1153968 AATGGCAAAATGAAGTTTTCTGG - Intergenic
1004322428 6:14642537-14642559 ATGTGGCAAATGGACTCTTCAGG + Intergenic
1004705957 6:18123977-18123999 ATGGGCCAATTAAACTTTTCGGG - Intergenic
1005614722 6:27561539-27561561 AAGGGCCAAAATGGCTCTTCTGG - Intergenic
1005958446 6:30680386-30680408 AAGGTCCAAATGATCTACTCAGG + Intronic
1006249879 6:32773972-32773994 AAGGGCCCACTCTACTCTTCTGG + Intergenic
1007745796 6:44042364-44042386 CAGGGCCCAATGAACATTTCTGG + Intergenic
1010030103 6:71264839-71264861 AAGGCCCAAAGATACTCTTCAGG - Intergenic
1010085650 6:71914761-71914783 CAGGGCAAAGTTAACTCTTCAGG + Intronic
1012365049 6:98428814-98428836 CAGTGCAAAATGAAGTCTTCGGG + Intergenic
1014381086 6:120743280-120743302 AAGGGGCAAATGAGCTCTCTGGG - Intergenic
1015478747 6:133683094-133683116 AAGGGCCACGTGAACTATTTTGG + Intergenic
1016702966 6:147074816-147074838 TGGTGCCAAATGAACTTTTCTGG - Intergenic
1018513934 6:164557368-164557390 AAGGGCTCAATGAACTCTTCAGG - Intergenic
1018538590 6:164851562-164851584 AAGAGCCAAAAGAGCTCTTTCGG - Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1021620432 7:22545615-22545637 AAGGGCCAAATGAACTCTTCTGG + Intronic
1024267772 7:47619859-47619881 AAGGGCCAAGGGAGCTCTTTGGG - Intergenic
1028086382 7:86642704-86642726 AAGCGCAAAATGATGTCTTCTGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030307979 7:108038493-108038515 AGGGGCCAAATTTACTTTTCTGG - Intronic
1030456502 7:109781321-109781343 AAGGACCAAATAGAATCTTCTGG + Intergenic
1032733017 7:134662875-134662897 ATGAACCAAATGAACTCTTGAGG + Intronic
1034737151 7:153439952-153439974 AAGGGCCAAGTGAGCTCTCTGGG - Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037200050 8:16241476-16241498 AAGGGTCTAATGAACTCCTTTGG - Intronic
1037764544 8:21764300-21764322 AAGGGGCAAGTGAGCTCTCCAGG + Intronic
1038484869 8:27927323-27927345 AAGACCCAAATGAACTCTCTGGG - Intronic
1038577968 8:28721666-28721688 AGGGGCTTACTGAACTCTTCTGG + Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039527276 8:38228053-38228075 AAGGGCCAGATAAATTCTTTAGG - Intronic
1040549925 8:48429846-48429868 AATGACCAAATGAACATTTCTGG - Intergenic
1041476230 8:58269837-58269859 AAGGGCTAAATGCACTATTCAGG - Intergenic
1045130690 8:99148795-99148817 AAGGGCCAAATGACTTCTATTGG + Intronic
1046102280 8:109628932-109628954 TAGGGTCAAAAGACCTCTTCAGG - Intronic
1047253937 8:123201604-123201626 AAGGGATAAATGGCCTCTTCTGG - Intronic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1052494312 9:29208362-29208384 AATGCCCAAATGAACTTTTATGG + Intergenic
1053096921 9:35336645-35336667 AAGGGGCAAAAGAACTCCTGTGG + Intronic
1053167508 9:35854861-35854883 AATGGACAAATGATCTTTTCTGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1058478847 9:105370285-105370307 AAGGTCAAGATGACCTCTTCAGG - Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062548519 9:137074931-137074953 AAGGCCCACATGCACTCTTCTGG - Intergenic
1186438829 X:9567395-9567417 ACGGGCCAATTTCACTCTTCTGG - Intronic
1187233527 X:17444795-17444817 TTGGGCCAAAGAAACTCTTCAGG - Intronic
1188543925 X:31281078-31281100 ACTGGCCAAATGAGGTCTTCAGG + Intronic
1188957937 X:36455797-36455819 AAGGGCCAAATTAACTATAAAGG + Intergenic
1189707339 X:43772168-43772190 AAGGGTCAAGGGAAGTCTTCTGG + Intronic
1189963639 X:46349853-46349875 AAGGGGCAAAAGAAGTCTCCGGG + Intergenic
1189986971 X:46562112-46562134 AGGGGCCTGAAGAACTCTTCTGG + Intergenic
1192153858 X:68728466-68728488 AAGGGCCAGATAAACTGGTCAGG + Intergenic
1194628409 X:96252955-96252977 AAGGGGCAAATAAAATCTTTTGG - Intergenic
1198656804 X:138923642-138923664 AAGGGCCATGTGCACTTTTCAGG - Intronic
1199462055 X:148095676-148095698 AAGGGCCCAATGGAGGCTTCAGG + Intergenic
1199513084 X:148644716-148644738 AAAAGACAAATGATCTCTTCAGG + Intronic