ID: 1021626239

View in Genome Browser
Species Human (GRCh38)
Location 7:22595724-22595746
Sequence CAGGATTGCCTCACCCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 326}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021626239_1021626250 11 Left 1021626239 7:22595724-22595746 CCCTGCAGGGTGAGGCAATCCTG 0: 1
1: 0
2: 0
3: 22
4: 326
Right 1021626250 7:22595758-22595780 TCACTGCTGAGGAGAAGAGGGGG 0: 1
1: 0
2: 3
3: 32
4: 366
1021626239_1021626243 0 Left 1021626239 7:22595724-22595746 CCCTGCAGGGTGAGGCAATCCTG 0: 1
1: 0
2: 0
3: 22
4: 326
Right 1021626243 7:22595747-22595769 CCCAACCACCTTCACTGCTGAGG 0: 1
1: 0
2: 1
3: 15
4: 221
1021626239_1021626247 8 Left 1021626239 7:22595724-22595746 CCCTGCAGGGTGAGGCAATCCTG 0: 1
1: 0
2: 0
3: 22
4: 326
Right 1021626247 7:22595755-22595777 CCTTCACTGCTGAGGAGAAGAGG 0: 1
1: 0
2: 2
3: 20
4: 204
1021626239_1021626249 10 Left 1021626239 7:22595724-22595746 CCCTGCAGGGTGAGGCAATCCTG 0: 1
1: 0
2: 0
3: 22
4: 326
Right 1021626249 7:22595757-22595779 TTCACTGCTGAGGAGAAGAGGGG 0: 1
1: 0
2: 1
3: 30
4: 298
1021626239_1021626251 20 Left 1021626239 7:22595724-22595746 CCCTGCAGGGTGAGGCAATCCTG 0: 1
1: 0
2: 0
3: 22
4: 326
Right 1021626251 7:22595767-22595789 AGGAGAAGAGGGGGCCTGAGAGG 0: 1
1: 0
2: 7
3: 77
4: 727
1021626239_1021626252 23 Left 1021626239 7:22595724-22595746 CCCTGCAGGGTGAGGCAATCCTG 0: 1
1: 0
2: 0
3: 22
4: 326
Right 1021626252 7:22595770-22595792 AGAAGAGGGGGCCTGAGAGGAGG No data
1021626239_1021626248 9 Left 1021626239 7:22595724-22595746 CCCTGCAGGGTGAGGCAATCCTG 0: 1
1: 0
2: 0
3: 22
4: 326
Right 1021626248 7:22595756-22595778 CTTCACTGCTGAGGAGAAGAGGG 0: 1
1: 0
2: 1
3: 24
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021626239 Original CRISPR CAGGATTGCCTCACCCTGCA GGG (reversed) Intronic
901359412 1:8683797-8683819 CAGGCATGCCCCACCCTGCCCGG - Intronic
902210977 1:14904325-14904347 AAGAATTGCCTCACTTTGCAGGG + Intronic
902516773 1:16993767-16993789 CAGGAATGCCTGCCCCTTCAGGG + Exonic
903111707 1:21140454-21140476 CAGGAATGCACCACCATGCATGG + Intronic
903576061 1:24340612-24340634 CAGGCTTACCTCACTCAGCAGGG + Intronic
903648254 1:24907472-24907494 CAGAAATGCCTCACTCTGCTGGG + Intronic
903778428 1:25807598-25807620 TAGGCTTGCCACCCCCTGCAGGG - Intronic
904144310 1:28377739-28377761 GAGGATTGCCTGAGCCTGGAAGG + Intronic
904307825 1:29601620-29601642 CAGGACTGGCACAGCCTGCAAGG - Intergenic
904638488 1:31903270-31903292 CAGGCATGCATCACCCTGCCTGG + Intergenic
904742425 1:32688674-32688696 CAGAATTGCCTGAACCCGCAAGG - Intronic
905153837 1:35956736-35956758 CAGAATTGCTTGACCCTGGAAGG - Intronic
905471558 1:38196063-38196085 CAGGATGGCTTCAACCTGGAAGG - Intergenic
905735897 1:40325600-40325622 CAGGCATGCCCCACCCTGCCTGG + Intergenic
906160058 1:43641435-43641457 CAGGATTGCTTGAACCTGGAAGG + Intergenic
906649013 1:47497362-47497384 CAGGAGTGCATCACCATGCTTGG + Intergenic
907730376 1:57060291-57060313 CAGGCATGCCTCACCATGCCCGG + Intronic
910547376 1:88433271-88433293 CTGGCTGGCCTCACCCTTCAGGG - Intergenic
912275868 1:108257889-108257911 CAGGAGTGCATCACCATGCCCGG + Intergenic
912292360 1:108436467-108436489 CAGGAGTGCATCACCATGCCCGG - Intronic
912527267 1:110292702-110292724 CACCATTGCCTCACTGTGCAGGG + Intergenic
912790570 1:112645489-112645511 CAGGTGTGCCTCACCATGCCTGG - Intronic
917825697 1:178818215-178818237 CAGGAGAGCCCCACCATGCATGG - Intronic
917875704 1:179285121-179285143 CAGGATTGAGTCACCCCCCACGG - Intergenic
919217009 1:194569769-194569791 CAGGCTTGCGTCACCATGCCTGG - Intergenic
919866449 1:201786626-201786648 CTGCCTTGCCTCACCCTGCAGGG - Intronic
920101244 1:203518250-203518272 CAGGCTTGCATCACCATGCCTGG - Intergenic
921384208 1:214552474-214552496 CAGAATCGCCCCACCCTGCCTGG + Intergenic
922949559 1:229547326-229547348 GGGGATTGCCTCTGCCTGCATGG - Intronic
1063553703 10:7057789-7057811 CAGGAATGCACCACCCTGCCTGG + Intergenic
1063555358 10:7074130-7074152 CAGGGCTGCTTCTCCCTGCAGGG - Intergenic
1064207086 10:13333581-13333603 CAGGCTTGCCCCACCATGCCTGG + Intronic
1064716799 10:18184927-18184949 CAGGATTGCCTGAGCCTGGGAGG - Intronic
1065551628 10:26873515-26873537 CAGGCTTGCCCCACCATGCCTGG + Intergenic
1068134004 10:52932549-52932571 GTGGATTGTCTCACCATGCAGGG - Intergenic
1068953942 10:62805105-62805127 CAGGCTTGCCTCACCTTCCGGGG + Exonic
1069367195 10:67706290-67706312 TTGGATTAACTCACCCTGCAGGG + Intergenic
1069502669 10:68967982-68968004 GAGGATTGCTTCAACCTGGAAGG - Intronic
1069637041 10:69931219-69931241 CAGGATTGCCTAATCCAGCTGGG + Intronic
1069682894 10:70297887-70297909 CAGGCATGCGTCACCATGCATGG - Intergenic
1071312219 10:84353591-84353613 CAGGATTGGCTAAACCTGAAGGG - Intronic
1073094483 10:100971399-100971421 GAGGATTCCCTGACCCTGAAAGG - Intronic
1073170313 10:101501101-101501123 CAGAATTGCCTGAACCTGCGGGG + Intronic
1075083282 10:119397782-119397804 GAGGCTGGTCTCACCCTGCAAGG - Intronic
1075481446 10:122786015-122786037 CAGGATTGCCTCGCTCTCCATGG + Intergenic
1075650961 10:124128214-124128236 CGGGCTTGCCTCACCCTACCTGG + Intergenic
1075751241 10:124773285-124773307 GAGGATTGCCTGAACCTGGAAGG - Intronic
1075937685 10:126357350-126357372 CAGGAATACCTTACCCAGCAAGG + Intronic
1076346163 10:129780229-129780251 CTGGCTTGCCTCAACCAGCATGG + Intergenic
1077521135 11:3035626-3035648 CAGGCTTGCATCACCATGCTTGG + Intronic
1077623136 11:3745728-3745750 CAGGCATGCATCACCATGCATGG + Intronic
1077844879 11:6013368-6013390 AACAATTGCCTCCCCCTGCAGGG - Intergenic
1078283317 11:9924836-9924858 GAGGATTGCCTGAGCCTGGAAGG - Intronic
1078688312 11:13553370-13553392 CAGGTGTGCCTCACCATGCCAGG - Intergenic
1079064139 11:17275158-17275180 GAGGATTGCCTGAGCCTGCGAGG + Intronic
1079315171 11:19401652-19401674 CAGGATTCACCCACTCTGCAGGG + Intronic
1082939164 11:58685688-58685710 CAGTATTACCTCTCCCTGCTCGG - Intronic
1083698152 11:64456316-64456338 CAGGAATGCGTCACCATGCCTGG - Intergenic
1084299345 11:68236361-68236383 CAGGCGTGCATCACCATGCATGG + Intergenic
1084495518 11:69500980-69501002 CAGGCAGGCATCACCCTGCAGGG + Intergenic
1084540148 11:69781440-69781462 CAGCAGGGCCACACCCTGCAGGG - Intergenic
1085330748 11:75648406-75648428 GAGGATTGCTTGACCCTGGAAGG + Intronic
1085974251 11:81633852-81633874 CAGGCATGCCTGACCCTGCCAGG + Intergenic
1087475806 11:98633054-98633076 TAGGAATGCCTCAACCTGCTGGG - Intergenic
1088485407 11:110335579-110335601 CAGGAATGCGCCACCATGCATGG - Intergenic
1089484583 11:118835577-118835599 CAGGATTGCAACACCATGCCTGG - Intergenic
1090302606 11:125658156-125658178 GAGGATTGCTTGAGCCTGCAAGG - Intronic
1091091559 11:132776070-132776092 CAGGCATGCCTCACCATGCCTGG + Intronic
1096193010 12:49632442-49632464 CAGGCTTCCCCCACCCTTCAGGG - Intronic
1099058426 12:77874306-77874328 GAGGATTGCTTGAGCCTGCAAGG - Intronic
1099789126 12:87308487-87308509 CAGGCTTGTGTCACCATGCATGG + Intergenic
1100191938 12:92202385-92202407 CAGGAATGTCTCACCATGCCTGG - Intergenic
1100547050 12:95613243-95613265 TAGCATTGCCTCTCCCTGCCTGG - Intergenic
1101309545 12:103563899-103563921 CAGCATTGCCTAGGCCTGCAAGG - Intergenic
1101948467 12:109156080-109156102 CAGGCTTGCACCACCCTGCCTGG - Intronic
1101997977 12:109538697-109538719 CAGCATCTCCTCACCCTGCTGGG - Intergenic
1102312011 12:111852914-111852936 CAGGCTTGCTTCACCATGCCTGG + Intronic
1103503219 12:121421461-121421483 GAGGATTGCTTGAGCCTGCAGGG + Intronic
1103624968 12:122211307-122211329 CAGGATTGCTTGACCCTGGGAGG + Intronic
1103799111 12:123525753-123525775 CAGGCTTGTCTCAACCTCCAGGG + Intronic
1105359303 13:19692264-19692286 CAGGTTTGCGTCACCATGCCCGG + Intronic
1109127991 13:58542753-58542775 CAGGATTGCCTGTCACTTCATGG - Intergenic
1110249859 13:73369608-73369630 GAGGATTGCCTGAGCCTGGAAGG + Intergenic
1112074305 13:95892863-95892885 CATTATTGCCGCAGCCTGCAAGG + Intronic
1112358188 13:98692294-98692316 CAGGAGTGCATCACCATGCCTGG + Intronic
1112664857 13:101557944-101557966 CAGGAGTGCATCACCATGCCTGG - Intronic
1113747396 13:112754715-112754737 CTGGAATGTCTCACACTGCAGGG + Intronic
1117745760 14:58867789-58867811 CAGGTATGCCTCACCATGCCTGG + Intergenic
1117841885 14:59869695-59869717 CCGGATGGCCCCACCTTGCAGGG - Intronic
1118056350 14:62083359-62083381 CAGGATTGCCTGCCCCCACAGGG + Intronic
1120982573 14:90303589-90303611 CAGGAATGCCTCTCCCTACCTGG + Intronic
1121055059 14:90845578-90845600 CTGGTTTGCCTCTCCCAGCACGG + Intergenic
1121314491 14:92953000-92953022 CCACAATGCCTCACCCTGCAAGG - Intronic
1121548407 14:94779840-94779862 CAGGAGTGGGTCAGCCTGCAGGG + Intergenic
1121771945 14:96553419-96553441 GAGGATTGCTTGAACCTGCAAGG + Intronic
1122770799 14:104096822-104096844 CAGGACTGCCACCCCCTGCCAGG + Intronic
1122930125 14:104929299-104929321 CAGAAGAGCCTCTCCCTGCAAGG - Exonic
1123831815 15:24146964-24146986 AAGGTTTGCATCACCCTGCCAGG - Intergenic
1123836793 15:24202980-24203002 AAGGTTTGCATCACCCTGCCAGG - Intergenic
1124422505 15:29535105-29535127 CAGGCTTGCCCCACCATGCCCGG - Intronic
1125001838 15:34778879-34778901 CAGGAGTGCCCCACCATGCCTGG + Intergenic
1125693663 15:41617239-41617261 AAGGATTCCTTCAGCCTGCAAGG + Intergenic
1125723699 15:41857318-41857340 CAGCAGTGCCTCAGCCTGCCTGG + Exonic
1125782409 15:42281540-42281562 CAGGCATGCATCACCCTGCCTGG - Intronic
1126172882 15:45708800-45708822 CAGGCCTTTCTCACCCTGCAGGG + Intergenic
1126376436 15:48001607-48001629 CAGATTAGCCTCATCCTGCAGGG + Intergenic
1126376576 15:48002720-48002742 CAGGTTAGCCTGATCCTGCAGGG - Intergenic
1127328511 15:57917400-57917422 CAGGAATGCGCCACCATGCACGG - Intergenic
1127543211 15:59963875-59963897 CAGGCTTGCATCACCATGCCTGG - Intergenic
1128171212 15:65515119-65515141 CAGGAATGCATCACCATGCCTGG + Intronic
1128304648 15:66590074-66590096 CAGGCATGCATCACCCTGCCTGG - Intronic
1128961472 15:72010428-72010450 CAGGATTGCTTCACGGTGGAAGG - Exonic
1130714361 15:86316897-86316919 CAGGACTGCCTCAGCCTGGCAGG - Intronic
1132484854 16:185550-185572 CAGGAGCGCCTCTCCCTGCACGG + Intergenic
1132749927 16:1452780-1452802 CGGGATTGCCAGCCCCTGCAGGG - Exonic
1134755622 16:16664867-16664889 CAGGCATGCATCACCATGCATGG + Intergenic
1134990444 16:18694294-18694316 CAGGCATGCATCACCATGCATGG - Intergenic
1135668315 16:24354101-24354123 GAGGATTGCCTGAGCCTGGAAGG + Intronic
1135971837 16:27077836-27077858 CAGGAATGCACCACCATGCACGG + Intergenic
1137308092 16:47224907-47224929 GAGGATTGCCTCAGCCTGGGAGG + Intronic
1138485453 16:57340006-57340028 CAGGCTTGCATCACCATGCCTGG + Intergenic
1139482000 16:67235946-67235968 CAGCATTGCTTCCCCCAGCAGGG - Intronic
1139778331 16:69330762-69330784 CAGGACTGCCTCGCCCTGGAAGG - Intronic
1140198192 16:72873050-72873072 CAGGAATTCCTCACCCTCGAAGG + Intronic
1140470045 16:75208852-75208874 CAGGAGGGCCTCACTCTGAAGGG + Intergenic
1140917385 16:79506473-79506495 CAGGAGAGCCTCACCCTTTATGG - Intergenic
1141244158 16:82290907-82290929 GAGGATTGCCTGACCCTGGGAGG - Intergenic
1142384442 16:89753962-89753984 CAGAATTGCCTGAACCTGGAAGG + Intronic
1143222040 17:5270511-5270533 AAGAATTGCCTGAACCTGCAAGG + Intergenic
1143880211 17:10024230-10024252 CAGCATTACCTCACCCTTCATGG + Intronic
1144350311 17:14388860-14388882 CAGGATTGCACCACCATGCCTGG + Intergenic
1146208596 17:30924510-30924532 GAGGATACCCTCAGCCTGCATGG + Intronic
1146600973 17:34215693-34215715 GGGCATTGCCTCACCCTGGAAGG - Intergenic
1147310797 17:39595262-39595284 TGGGATTCCCCCACCCTGCATGG + Intergenic
1149803583 17:59593616-59593638 CAGGCTTGCATCACCATGCCTGG + Intronic
1149842908 17:59981871-59981893 CAGGCTTGCATCACCATGCCTGG - Intergenic
1150130894 17:62668260-62668282 GAGGATTGCTTGAGCCTGCAAGG + Intronic
1150982584 17:70158824-70158846 CTGGATTGTCTCACCCTGTGGGG + Intergenic
1152686812 17:81697979-81698001 CAGGATTGCACCACCATGCCTGG + Intronic
1153084714 18:1271335-1271357 CAGCATTGCCTCCCACAGCAAGG + Intergenic
1153316385 18:3726799-3726821 CAGGCTTGGCTGCCCCTGCAAGG - Intronic
1153691746 18:7601106-7601128 AAGGATTGCTCCACCCTACAGGG + Intronic
1156403532 18:36761522-36761544 TGGCATTCCCTCACCCTGCATGG + Intronic
1156715411 18:40002966-40002988 CAGGCGTGCATCACCATGCAGGG - Intergenic
1157201046 18:45659988-45660010 CAAGCATGCCTCACCATGCATGG - Intronic
1157910662 18:51614975-51614997 CAGGCTCGCCCCACCCTGGAGGG - Intergenic
1157913780 18:51644462-51644484 CAGGCTTCACACACCCTGCAGGG - Intergenic
1160437664 18:78863588-78863610 GAGAAGTCCCTCACCCTGCAAGG + Intergenic
1161213531 19:3081081-3081103 CAGGCTTGCATCACCATGCCTGG + Intergenic
1161622441 19:5305402-5305424 CAGGCATGCCTCACCCTGCCTGG - Intronic
1161700897 19:5794540-5794562 CAGGATTGCTTGAGCCTGGAAGG + Intergenic
1162250871 19:9442578-9442600 CAGGCGTGCATCACCATGCAGGG + Intergenic
1163571700 19:18085884-18085906 CAGGAGTGAGTCACCGTGCAGGG + Intronic
1163689202 19:18729649-18729671 CAGGATTGCTTGAGCCTGGAAGG + Intronic
1165673714 19:37703093-37703115 CAGGAATGCATCACCATGCCTGG + Intronic
1166623882 19:44332032-44332054 CAGGATTGCGTCACCATGCCTGG - Intronic
1167655637 19:50762181-50762203 CAGGCTTGAGTCACCCTGCCCGG - Intergenic
927197339 2:20557792-20557814 CAGGAATGCAGAACCCTGCAGGG + Intergenic
927541717 2:23917913-23917935 CAGGCTTGCGTCACCATGCCTGG - Intronic
928316578 2:30251142-30251164 GAGGATTGCCTGAGCCTGGAAGG - Intronic
929505895 2:42527777-42527799 CAGGCTGGCCTCACCCTTCTGGG - Intronic
931342274 2:61413299-61413321 CAGAATTGCCTGAACCTGGAAGG + Intronic
931560448 2:63555357-63555379 CATGGCTGCCTCTCCCTGCAGGG - Intronic
931920632 2:67011638-67011660 CAGGTATGCATCACCATGCATGG + Intergenic
932254378 2:70271208-70271230 CAGGCATGCCTCACCATGCCTGG + Intronic
933736850 2:85502260-85502282 CAGGCATGCATCACCATGCATGG - Intergenic
934673812 2:96235105-96235127 TAGGAGTGCTTCACCCTGCCTGG - Intergenic
935716683 2:105945197-105945219 CAGGAGTGCGTCACCATGCCTGG - Intergenic
936341465 2:111637218-111637240 CAGGTTTGCATCACCATGCCTGG - Intergenic
937559944 2:123209912-123209934 CAGGAATGCACCACCCTGCCCGG - Intergenic
939643532 2:144669287-144669309 CAGCCTTGCCTCCCCCAGCATGG - Intergenic
939797736 2:146667739-146667761 GAGGATTGCCTGAGCCTGGAAGG + Intergenic
939972061 2:148673724-148673746 CAGGTGTGCCTCACCATGCCTGG + Intronic
940312179 2:152290628-152290650 CAGGTGTGCATCACCATGCATGG - Intergenic
941520001 2:166530291-166530313 AAGGATTGCTTCACCCTGCCTGG - Intergenic
941867505 2:170350089-170350111 GAGGATTGCTTCACCCTGGGAGG - Intronic
942465883 2:176207282-176207304 CAGGTTTGCACCACCATGCATGG + Intergenic
942865995 2:180675638-180675660 CAGGATGGCATGAACCTGCAGGG - Intergenic
943658228 2:190531319-190531341 CAGGTTTGCCTCAACCCTCAAGG + Intronic
944088288 2:195874677-195874699 CAGGCATGCATCACCATGCATGG - Intronic
946012531 2:216577670-216577692 CAGGAGTGACTCACCATGCCTGG + Intronic
946025293 2:216668397-216668419 CAGGAGTGCATCACCATGCCTGG + Intergenic
946150678 2:217766032-217766054 CAGGCGTGCATCACCATGCATGG - Intergenic
946314121 2:218898190-218898212 CCGGATTGCCTTCCCCTGTAGGG - Intronic
948071632 2:235132444-235132466 CAGGCATGCGTCACCCTGCCTGG - Intergenic
948909794 2:240997331-240997353 CAGAATTGCCACCCCATGCAGGG + Intergenic
948972528 2:241440471-241440493 CAGTATTTCCTCATCCTGCTTGG + Intronic
1169318336 20:4611167-4611189 TATGATTACTTCACCCTGCAAGG + Intergenic
1172004058 20:31805272-31805294 CAGAATTGCTTGAACCTGCAAGG - Intergenic
1172125382 20:32622491-32622513 AGGGACTGCCCCACCCTGCAAGG + Intergenic
1172690512 20:36786365-36786387 CAGCATTGCCTGGCCCTGGAGGG - Exonic
1177625762 21:23657314-23657336 CAGGAATGCATCACCATGCCTGG + Intergenic
1179784842 21:43723712-43723734 CAGGCTTGCCTCTCCCCACAGGG - Intronic
1180031839 21:45215549-45215571 CAGGATGGCCTCAAACTCCAGGG - Intronic
1181471992 22:23146097-23146119 CAGGCCTGCCCCACCCTGCCTGG - Intronic
1182398780 22:30057885-30057907 CAGGATTGCCTGAGCCTGAGAGG + Intergenic
1183854797 22:40624281-40624303 CAGGCGTGCCCCACCATGCACGG - Intronic
1183978222 22:41525368-41525390 CAGGACAGCCCCACCCTGCCAGG + Intronic
1184468970 22:44684814-44684836 AAGGATGACCTCACCCAGCACGG - Intronic
1184796725 22:46737537-46737559 CAGGAAGTCCTCACCCTGCAAGG + Intronic
1185264571 22:49893829-49893851 AAGGATTGCACCATCCTGCAAGG + Intergenic
950021016 3:9787864-9787886 CAGACTTGACTCACCCTTCAAGG - Intronic
950054164 3:10011736-10011758 CAGGAATGCCTTCCCTTGCAGGG - Intergenic
950437831 3:12991373-12991395 CAGGTTTGCATCTCACTGCATGG + Intronic
951938567 3:28051631-28051653 CAGGTTTGCACCACCATGCAAGG - Intergenic
952559286 3:34571483-34571505 CAGGATTGAGTCACCCTGCTGGG + Intergenic
952596345 3:35023168-35023190 CAGGCTTGCCTCACCATGCCTGG - Intergenic
952852809 3:37742728-37742750 CAGGGATGGCTCTCCCTGCAAGG - Intronic
952889148 3:38029505-38029527 CGGGACTTCCTGACCCTGCACGG - Intronic
953006907 3:38987358-38987380 CAGGATTCACTCATCTTGCAAGG + Intergenic
953157585 3:40388550-40388572 CAGGATTTTCTCACACTGGAAGG + Intronic
954560300 3:51550649-51550671 GAGGATTGCCTGACCCTGGGAGG + Intronic
955197846 3:56821819-56821841 CAGGCTTGCCCCACCATGCCCGG - Intronic
955897123 3:63712382-63712404 GAGGATTGCCTGAGCCTGGAAGG + Intergenic
956769628 3:72513728-72513750 GAGGATTACCTGAGCCTGCAAGG + Intergenic
960836096 3:121908332-121908354 GAGCATTGCCTCACCCAGGAAGG - Intronic
960953154 3:123012527-123012549 CAGGAATGCCTCTCCTTGAAAGG - Intronic
961588031 3:127950752-127950774 CAGGATTGAGTCACCGTGCCCGG - Intronic
963394763 3:144717283-144717305 CAGGCATGCATCACCATGCATGG - Intergenic
965069236 3:163896097-163896119 TATGTTTGCCTCACCTTGCATGG - Intergenic
965146243 3:164908407-164908429 GAAGATTGCCTGACCCTGCAAGG - Intergenic
968964894 4:3764872-3764894 CTGGCTGGCCTCTCCCTGCATGG - Intergenic
969483712 4:7460091-7460113 CAGCAGTCCCTCCCCCTGCATGG + Intronic
970507149 4:16743145-16743167 CAGGCTTGCATCACCATGCCTGG - Intronic
971409081 4:26351468-26351490 GAGGATTGCCTGAGCCTGCAAGG - Intronic
972074943 4:35075822-35075844 CAGGCTGGCCTCAAACTGCAGGG - Intergenic
973081932 4:46003552-46003574 CTGCTTTGCCTCACCCTCCACGG + Intergenic
976158690 4:82175575-82175597 GAGGGATGCCTCACCCTGCTTGG - Intergenic
976344070 4:83979472-83979494 CAGAATTGCTTCAACCTGGAAGG + Intergenic
976975920 4:91165908-91165930 CAGCTTTGGCTCACCCTCCATGG + Intronic
977202122 4:94129838-94129860 CAGGCATGCATCACCATGCACGG - Intergenic
977938368 4:102830774-102830796 GAGGATTGCCTCAGCCTGGGAGG + Intronic
978024832 4:103860475-103860497 CAGGACTGCATCACCATGCCTGG - Intergenic
978578649 4:110210986-110211008 CAGGCATGCCTCACCATGCCTGG - Intergenic
980065113 4:128179000-128179022 CAGGATTGCTTGAGCCTGTAGGG + Intronic
981369936 4:143948471-143948493 AAGGATTGCTTCAGCCTGGATGG - Intergenic
981379694 4:144058526-144058548 AAGGATTGCTTCAGCCTGGATGG - Intergenic
981788654 4:148509925-148509947 GAGGATTGCTTGAGCCTGCAAGG + Intergenic
983946609 4:173592756-173592778 CAGGTGTGCCTCACCATGCCTGG + Intergenic
985260065 4:188106696-188106718 CAGGGTGGCCTCGCCCTGCAGGG - Intronic
985972666 5:3390791-3390813 CAGCATTGCCCCACCTTGCTGGG + Intergenic
989034913 5:37160482-37160504 CAAGATTGCCTCCGCCTGCCAGG - Intronic
990034502 5:51303507-51303529 CAGGATTGCCTGAACCTGGGAGG + Intergenic
990589951 5:57252224-57252246 CAGGCTTGCACCACCATGCACGG + Intronic
990954003 5:61325730-61325752 CAAAATTGCCTCACCCTACTAGG - Intergenic
992432142 5:76719497-76719519 CAGAATTGCCTGAACCTGGAAGG + Intronic
993477128 5:88379802-88379824 CAGGCATGCCCCACCATGCACGG + Intergenic
997433781 5:133859175-133859197 CAGGCTTGCATCACCGTGCCTGG + Intergenic
997460998 5:134052416-134052438 GAGGATTGCTTGAACCTGCAAGG - Intergenic
999710213 5:154311699-154311721 GAGAATTGCTTCACCCTGAATGG - Intronic
999742096 5:154563926-154563948 AAGGATTGCTTCACCCTGAGGGG - Intergenic
999991478 5:157054039-157054061 CAGGAGTGCATCACCATGCCCGG - Intronic
999993326 5:157068442-157068464 CAGGAGTGCATCACCATGCCCGG - Intergenic
1000307883 5:160012506-160012528 CAGGCTTGCACCACCCTGCCTGG + Intronic
1000843045 5:166245524-166245546 AAGGAAAGCCTCACCCTGTAAGG + Intergenic
1001926967 5:175644671-175644693 GAGGATTGCTTGAGCCTGCAAGG + Intergenic
1002562553 5:180092174-180092196 CTGGCTTGCCTCTCCCAGCATGG + Intergenic
1002826820 6:781600-781622 CTTGATTGCCTCAGCCTGGAAGG + Intergenic
1003208487 6:4036894-4036916 AAGGATTGCCTCAGCCTGGGAGG + Intronic
1007109566 6:39305059-39305081 CAGCATGGCCTCAGCCTGAATGG - Intronic
1007299867 6:40859048-40859070 CAGGCAGGCCTCACTCTGCAGGG + Intergenic
1007486995 6:42187508-42187530 GAGGATTGCCTGAGCCTGGAAGG - Intronic
1007590863 6:43020284-43020306 CAGGAATGCCTCACCCCACCAGG - Intronic
1008070871 6:47097596-47097618 CAGGATTTCCCCTCCCTGCAGGG - Intergenic
1011611437 6:89155362-89155384 GAGGATTGCTTCAGCCTGGAAGG - Intronic
1012262882 6:97108484-97108506 CAGGATTCCCTCCACCAGCATGG + Intronic
1012430606 6:99160108-99160130 AAGGAGTGGCTCACCCTGAAAGG - Intergenic
1012664554 6:101951232-101951254 CAGGATTTCTTCACACTTCATGG - Intronic
1013102625 6:106999479-106999501 GAGGATTGCTTGACCCTGGAAGG + Intergenic
1013262832 6:108463197-108463219 GAGAATTGCCTGAACCTGCAAGG + Intronic
1013504744 6:110788303-110788325 CAGGTTTGCATCACCATGCCTGG + Intronic
1014289985 6:119547248-119547270 CAGGCTTGTTTCACCCTGCTTGG + Intergenic
1014582511 6:123156409-123156431 CAGGAATGCACCACCATGCATGG - Intergenic
1015931370 6:138363456-138363478 CAGTTTTGCCTCACCCTGTCTGG - Intergenic
1017431912 6:154379653-154379675 GAGGATTGCCTCAGCCTGAAAGG + Intronic
1018377964 6:163231491-163231513 CCGGGTTGTCACACCCTGCACGG + Intronic
1018619344 6:165715063-165715085 GAGTATTGGCTCAGCCTGCAGGG + Intronic
1019065513 6:169292744-169292766 CAGGATGGCCTCTTGCTGCAGGG - Intergenic
1020797993 7:12699495-12699517 CAGGAGTGCGTCACCATGCCCGG + Intergenic
1021626239 7:22595724-22595746 CAGGATTGCCTCACCCTGCAGGG - Intronic
1021708757 7:23394375-23394397 CAGGATCGCTTCAGCCTGGAAGG + Intronic
1021729679 7:23584428-23584450 GAGGAGTGCCTGACCCTTCATGG - Intergenic
1023552419 7:41384280-41384302 CAGGAAAGACTCATCCTGCAAGG - Intergenic
1023934880 7:44732603-44732625 CAGGATTGTGTCACCATGCCCGG - Intergenic
1024302685 7:47899677-47899699 CAGGCTTGCGTCACCGTGCCTGG - Intronic
1025706473 7:63869972-63869994 CAGGTTTGCCTCAAACTGCTGGG - Intergenic
1026103070 7:67398658-67398680 CAGGAATGTCTCACCATGCCAGG + Intergenic
1026587626 7:71669366-71669388 CAGGCTTGCATCACCATGCCTGG - Intronic
1026597747 7:71748570-71748592 CAGGCTTGCGTCACCATGCCCGG - Intergenic
1029851190 7:103463020-103463042 GGGCATTGCCTCACCCTGGAAGG - Intergenic
1031485708 7:122321254-122321276 CAGGATTGCTTCAGCCTGGGAGG - Intronic
1032249986 7:130247665-130247687 CAGGAGTGTGTCACCATGCATGG + Intergenic
1033095948 7:138430901-138430923 CAGGATTGCTTGAGCCTGAAAGG + Intergenic
1033378956 7:140793766-140793788 CAGGCATGCCTCACCATGCATGG + Intronic
1035125521 7:156605815-156605837 CAGGGGTGCCTCACCTTGTAGGG - Intergenic
1036808608 8:11852226-11852248 CAGGCTTGCACCACCGTGCACGG - Intronic
1037433399 8:18838298-18838320 CAGCAATGCCTCACCATGCTTGG + Intronic
1037615398 8:20514529-20514551 CTGGATTACCGCACCCTGCCGGG - Intergenic
1038198180 8:25387269-25387291 CAGGATTGCCTGAGCCTGGGAGG - Intronic
1038683182 8:29689188-29689210 CAGGCTTGCATCACCATGCCTGG + Intergenic
1039084437 8:33765889-33765911 CAGGTATGCATCACCATGCATGG - Intergenic
1039252207 8:35679158-35679180 GAGGATTGCTTCAGCCTGGAAGG + Intronic
1039329905 8:36525560-36525582 GAGGATTTCCTCACCCTGTGAGG + Intergenic
1039656455 8:39413749-39413771 CAGGCTTGCATCACCATGCCTGG - Intergenic
1041233774 8:55778128-55778150 CAGGAGTGCCCCACCATGCCTGG - Intronic
1042917497 8:73889867-73889889 GAGGATTGCTTCAGCCTGAAAGG + Intergenic
1044581226 8:93828136-93828158 CAGGATTGCATTAAGCTGCATGG - Intergenic
1047991148 8:130288000-130288022 TGGGATGGCCTCACCCTGCATGG - Intronic
1048307472 8:133294409-133294431 CAGGTTTGACTCAGCCTGGAAGG - Intronic
1048869300 8:138783957-138783979 CAGCAGTCCCTCTCCCTGCATGG - Intronic
1049209425 8:141378719-141378741 GAGGCTTCCCTCACCCTGCCTGG - Intergenic
1049392567 8:142379761-142379783 CAGGGCTGCCTCAGCCTCCAGGG + Intronic
1049436772 8:142590053-142590075 CAGGACAGACTCACCCTGGAGGG - Intergenic
1049475456 8:142795109-142795131 CAGGAGGGGCTCACCCTTCAGGG - Intergenic
1049851235 8:144831923-144831945 GAGGATTGCCTGAGCCTGGAAGG + Intronic
1050052077 9:1613073-1613095 CAGGATTGCGTCACCATGCCTGG + Intergenic
1052432850 9:28389616-28389638 TAGTGTTGCATCACCCTGCAGGG + Intronic
1053001630 9:34579942-34579964 GAGGATTGCCTCAGCGAGCAGGG - Intronic
1054906470 9:70418331-70418353 CAGGGTTTCCCCACCTTGCAGGG + Intergenic
1055113005 9:72578021-72578043 CAGGTATGCCTCACCATGCCTGG + Exonic
1057084074 9:92192586-92192608 GAGGATTGCCTGAGCCTGGAAGG - Intergenic
1057366350 9:94425159-94425181 CAGGAGTGCGTCACCATGCCTGG - Intronic
1058500512 9:105610671-105610693 GAGGCTTTCCTCACCCTGCTTGG + Intronic
1059347615 9:113640479-113640501 CAGGAGTGCACCACCATGCATGG + Intergenic
1060396448 9:123319902-123319924 CAGGATGGCCTCTCCCTCCAAGG - Intergenic
1061627884 9:131852223-131852245 CATGCTTGGCTCACCCAGCAGGG - Intergenic
1061948163 9:133920376-133920398 CTGGATTGCCCCAGCCTGCAGGG - Intronic
1062002112 9:134221499-134221521 CAGTGTTGCCTCACCATGCATGG + Intergenic
1062362592 9:136194685-136194707 CAGGGTTGCCCAAGCCTGCATGG + Intergenic
1062451915 9:136619343-136619365 CTGGACTGCCTCACCCAGAAGGG - Intergenic
1186114080 X:6286975-6286997 CAGGAGTGCATCACCATGCCTGG + Intergenic
1187143329 X:16615194-16615216 CAGGTGTGCATCACCCTGCCTGG - Intronic
1187380633 X:18798711-18798733 GAGAATTGCCTCACCCTGGGAGG - Intronic
1187418733 X:19116067-19116089 CAGGCTTGCCCCACCATGCCTGG - Intronic
1189326265 X:40113315-40113337 GAGGATTGCTTAACCCTGGAAGG + Intronic
1189504509 X:41598047-41598069 GAGGATTGCCTGAGCCTGGAAGG + Intronic
1189822744 X:44886198-44886220 CAGGAATGCGCCACCCTGCCCGG + Intronic
1190203351 X:48382249-48382271 CAGGCTGGCCTCAACCTCCAGGG - Intergenic
1190207185 X:48413155-48413177 CAGGCTGGCCTCAACCTCCAGGG + Intergenic
1192112907 X:68383452-68383474 CAGGAGTGCATCACCATGCCTGG - Intronic
1192377703 X:70581089-70581111 GAGGATTGCCTGAGCCTGGAAGG - Intronic
1192592264 X:72370098-72370120 CAGGATAGCCTCTCCCTGGCTGG - Intronic
1193091762 X:77501345-77501367 CAGGAGTGCATCACCATGCCTGG - Intergenic
1193409278 X:81143511-81143533 CTGCTTTGGCTCACCCTGCATGG - Intronic
1196830031 X:119768516-119768538 CAGGCTTGCATCACCATGCCCGG + Intergenic
1197672739 X:129296524-129296546 CACGATTGCATCACCCAGCCTGG + Intergenic
1198688971 X:139259724-139259746 AGGCATTGCCTCACCCTGGAAGG + Intergenic
1200316345 X:155136973-155136995 AAGAAATGCCTGACCCTGCAGGG - Intronic
1201545653 Y:15158860-15158882 AAGCAATGCCTCACCCTGCTTGG + Intergenic