ID: 1021627645

View in Genome Browser
Species Human (GRCh38)
Location 7:22610081-22610103
Sequence TAGTGGAGATGGAGAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 987
Summary {0: 1, 1: 6, 2: 28, 3: 150, 4: 802}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021627645_1021627652 18 Left 1021627645 7:22610081-22610103 CCAACTTCTCTCCATCTCCACTA 0: 1
1: 6
2: 28
3: 150
4: 802
Right 1021627652 7:22610122-22610144 TCGCTTCTCTCCTGAACTCCTGG No data
1021627645_1021627653 19 Left 1021627645 7:22610081-22610103 CCAACTTCTCTCCATCTCCACTA 0: 1
1: 6
2: 28
3: 150
4: 802
Right 1021627653 7:22610123-22610145 CGCTTCTCTCCTGAACTCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021627645 Original CRISPR TAGTGGAGATGGAGAGAAGT TGG (reversed) Intronic
900037136 1:423881-423903 TAGTGGAAATAGAGATAAGGAGG + Intergenic
900058766 1:659622-659644 TAGTGGAAATAGAGATAAGGAGG + Intergenic
900487457 1:2930102-2930124 TGGTGGAAAAGGAGAGAAGCCGG + Intergenic
900908930 1:5580425-5580447 TAGTTGAAATGGAGTCAAGTGGG - Intergenic
901175585 1:7296467-7296489 TAGTGGGGATGGGAAGAAGTGGG + Intronic
902571526 1:17350068-17350090 TAGTGGAGAAGGCTAGGAGTTGG - Intronic
902928276 1:19712163-19712185 TGGAGGAGAGGGAGAGAGGTGGG + Intronic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903064562 1:20691925-20691947 TAGCAAAGATGGAGAGAAGTGGG - Intronic
904724479 1:32536753-32536775 GAGTGGAGGTAGATAGAAGTGGG - Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905045677 1:34998612-34998634 TAATGGAGGTGGTAAGAAGTAGG + Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905337680 1:37256724-37256746 GAGGAGAGATGGAGAGAAGGAGG - Intergenic
905689844 1:39934944-39934966 GAGTGGAGATGGAAAGAATGAGG + Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906227658 1:44134800-44134822 GAGTGGAGGTAGGGAGAAGTAGG + Exonic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
907178402 1:52547385-52547407 TAGTGAGGATGTAGAGAAATTGG + Intronic
907342063 1:53742248-53742270 TAGTGAGGATGGAGAGGAGGAGG - Intergenic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
907901565 1:58746303-58746325 TGGTGGACATGGAGAGAAGGGGG - Intergenic
907931411 1:59004425-59004447 TAATGAAGATGTAGAGAAATTGG + Intergenic
908037068 1:60067297-60067319 TGGTGAAGATGTAGAGAAATAGG - Intronic
908121643 1:60991525-60991547 TGGTAGAGCTGGTGAGAAGTAGG - Intronic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908693355 1:66807928-66807950 TAGAGGGGATAGAGAGCAGTGGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909465317 1:75967295-75967317 TCGTGGTAATGGAGAGCAGTGGG - Intergenic
909756055 1:79227442-79227464 TAGCGGTGATGGAGAGGAGGTGG - Intergenic
909845663 1:80390725-80390747 AAGGGGAGATAGAGAGAAGTTGG + Intergenic
910064134 1:83132652-83132674 TGGTGGAAATGGATAAAAGTGGG - Intergenic
910064409 1:83136000-83136022 TAGTGGAGTTGCAGAGAATGGGG - Intergenic
910286425 1:85559874-85559896 TTGTCCACATGGAGAGAAGTAGG + Intronic
910726438 1:90344835-90344857 TAGTGACGATGGAGGGAAGTGGG - Intergenic
911093573 1:94037423-94037445 AAGGGGAAGTGGAGAGAAGTAGG - Intronic
911433430 1:97823471-97823493 GAGTGGAAATGGGGAGAGGTTGG - Intronic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
911968110 1:104393894-104393916 TTGTGTAGATGGAGAGTAGAAGG + Intergenic
912053975 1:105570969-105570991 TAGTGGAAATAGGGAGATGTTGG + Intergenic
912204476 1:107494800-107494822 AAGGGGAGATGGAGTGAAGAGGG - Intergenic
912348150 1:108985014-108985036 CAGTGGAGGTGGAGCAAAGTGGG - Intronic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912580796 1:110719243-110719265 GAATGGAGATGAAGAGAACTGGG + Intergenic
912614140 1:111080030-111080052 TAGTGGAAAGGGGGAGAAGGAGG - Intergenic
912827120 1:112915686-112915708 TAGTTGTGATGGAGAAAAATGGG + Intronic
912865467 1:113252410-113252432 AAGTGGTAATGGAGATAAGTGGG + Intergenic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913313680 1:117531496-117531518 TAGTGGAGATGTGGAGAAACTGG - Intergenic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
914949652 1:152101561-152101583 AAGAGGAGATGGGTAGAAGTAGG - Intergenic
915288517 1:154867944-154867966 GAGTGGAGATGGAGGAAGGTGGG - Intronic
915369595 1:155337481-155337503 TAGTGGAGAGGGAGAGGAAAGGG - Exonic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915858298 1:159414221-159414243 GGGTGGTGATGAAGAGAAGTTGG - Intergenic
915925701 1:160017599-160017621 TACTAGAGATGGTAAGAAGTGGG - Intergenic
916522467 1:165577068-165577090 TGGTGAGGATGTAGAGAAGTTGG + Intergenic
916808808 1:168286861-168286883 TGGTGAAGATGTAGAGAAATTGG - Intronic
917063260 1:171063982-171064004 GAGGAGAGATGGAGAGAAGGGGG + Intronic
917089509 1:171338478-171338500 TGGATGAGATGGAGAGCAGTAGG - Intronic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917223832 1:172760697-172760719 TAGTAAAGAAAGAGAGAAGTGGG + Intergenic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
917873667 1:179265662-179265684 TGGTGAAGATGTAGAGAAATTGG - Intergenic
918107366 1:181426243-181426265 GACTTGAGATGGAGAGAGGTTGG - Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918321622 1:183370514-183370536 AAGTGGAGAAGTGGAGAAGTGGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918997394 1:191779970-191779992 TAGAGGGGATAGGGAGAAGTCGG + Intergenic
919083852 1:192897045-192897067 AAGGGGAGATGGGGAGAGGTTGG + Intergenic
919158879 1:193803050-193803072 GAATTGAGATGGAGAGGAGTTGG + Intergenic
919318969 1:196009641-196009663 TGGGGGAAATGGAGAGAGGTTGG + Intergenic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
919749972 1:201031465-201031487 TAGTGAGGATGCGGAGAAGTAGG + Intergenic
920622937 1:207566272-207566294 AAGGGGAGAAGGAGAGAAGAAGG - Intronic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921323245 1:213964379-213964401 TAAGGGAAATGGAGAGATGTTGG + Intergenic
922769099 1:228172489-228172511 AGCTGGAGATGGACAGAAGTGGG - Intronic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923310524 1:232730355-232730377 TGGTAGAAATGGAGAGAAGTAGG - Intergenic
923520879 1:234734282-234734304 TAGAGTGGATGGAGAGAGGTGGG + Intergenic
924292270 1:242548565-242548587 GTGAGGAGATGGAGAGATGTGGG + Intergenic
924431827 1:244004004-244004026 TAGTGGAGCTCCAGAGAAGATGG + Intergenic
924484744 1:244470521-244470543 TCGTGGGGATGTAGAGAAATGGG + Intronic
1063555030 10:7070211-7070233 TATTGGATATGGAGAGAAAGAGG + Intergenic
1063626199 10:7692196-7692218 TAGTGGAGCTGTTGAGAAGAGGG - Intergenic
1063836189 10:10016172-10016194 TCGTGGAGATAGAGAGTAGAAGG - Intergenic
1064233409 10:13550262-13550284 TAGAGAAGAGGGAGAGAAGAGGG + Intergenic
1064325135 10:14343433-14343455 GAGGGGAGATGGAGAGGAGCTGG - Intronic
1064406936 10:15072360-15072382 TAGTGTAAAAGGAGAGATGTTGG + Intronic
1064484911 10:15776359-15776381 TGGTGAAGATGGGGAGAAATTGG - Intergenic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1064943324 10:20759080-20759102 AGGTGGAGATGGGGAGATGTTGG + Intergenic
1065030653 10:21582655-21582677 TAGTGGAGATGGAGAGAGAGAGG + Intronic
1065097492 10:22296181-22296203 TAGTGTAGAGGGAGGGAAGAGGG - Intergenic
1065111589 10:22445221-22445243 AACTGGAGAAGGAGAGAAATGGG + Intronic
1065367989 10:24953159-24953181 GAGCGGAGGTGGAGAGAGGTGGG - Intergenic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065986331 10:30956543-30956565 TAGGAGAGATGAAGAGAGGTTGG - Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068379607 10:56234037-56234059 TAGTGGAAATGGAGATAACTGGG - Intergenic
1068714866 10:60177005-60177027 CAGTGGAGATGGTGAAATGTAGG - Intronic
1068815714 10:61309378-61309400 TAGGGGAAATGGTGAGATGTTGG - Intergenic
1068961754 10:62873399-62873421 TAGTGAAGATGCAGAGAAACTGG - Intronic
1069166931 10:65171894-65171916 TAGTGGAGATGGAGAAGAATAGG + Intergenic
1069551128 10:69365190-69365212 TAATGGTGGTGGAGAGAGGTGGG + Intronic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070109193 10:73466077-73466099 AAGTGAAGATGGAGAACAGTAGG - Intronic
1070429685 10:76324783-76324805 TATTAGTGATGGAGAGAAATTGG + Intronic
1070495293 10:77015836-77015858 GAGTGGAGGTGGAGAGAGGTGGG - Intronic
1070541805 10:77420817-77420839 AAGCTGAGATGGAGAGAAGTGGG - Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071048462 10:81415048-81415070 TAGAGGAGAATGGGAGAAGTTGG - Intergenic
1071381545 10:85068157-85068179 TTGAGGAGAGGGAGAGAGGTGGG - Intergenic
1071706946 10:88009414-88009436 AAGTGGGGATAGAGAAAAGTAGG + Intergenic
1071755445 10:88533608-88533630 TTGTGAGGATGGAGTGAAGTGGG + Intronic
1071810507 10:89176085-89176107 TACAGGAGATGGAGGGAGGTAGG - Intergenic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1074052873 10:109895764-109895786 TATTAGAAATGGAGAGAAGTGGG - Intronic
1074446394 10:113524647-113524669 TAGTGAGGATGGAGTAAAGTTGG - Intergenic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1075159585 10:120011574-120011596 AAGTGAAGAGGGAGAGAATTCGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075516055 10:123109202-123109224 TAGAGGAGATGGAGGCAAGAAGG + Intergenic
1075719146 10:124574865-124574887 GAGTGGAGAAGGACAGCAGTGGG - Intronic
1075820381 10:125302958-125302980 TAGTGGAGATGAAGAAGAGGGGG - Intergenic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1075993651 10:126859368-126859390 TAGTGGAGATGAAGAGGAAGAGG - Intergenic
1076619778 10:131779781-131779803 TCGTGGAGATGGAGAGGCCTTGG - Intergenic
1076734852 10:132454150-132454172 TTGTGGAGTTGGAGAGAGTTAGG - Intergenic
1076963863 11:61803-61825 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077279648 11:1736850-1736872 GAGTGGAGCTGGAAAAAAGTTGG + Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078682847 11:13496079-13496101 TAGTTGAGATCCAGAGAATTGGG - Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079287944 11:19156735-19156757 TTGTGGAGATGGAGACAGGCAGG - Intronic
1079594766 11:22229121-22229143 GAGAGGACATGGAGAGAAGGTGG - Intronic
1080056939 11:27916280-27916302 TAATGGAGATGGAAAGGAGGGGG + Intergenic
1080479248 11:32628778-32628800 TACTGGACAGGGAGAGAAGCAGG + Intronic
1080514431 11:33006899-33006921 AAGTGGAGATGTAGTGGAGTTGG + Intergenic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081075938 11:38673753-38673775 AAGTTGAGAAGGAGAGAAGGTGG - Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081974782 11:47226244-47226266 TGGTGGGGAAGTAGAGAAGTTGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083790424 11:64981320-64981342 TAATGGAGATAGAGAGTAGAAGG - Intergenic
1084030525 11:66478095-66478117 TTCTGGAGATGAAGAGAAGAAGG + Intergenic
1084032704 11:66490467-66490489 GAGGGGAGCTGGAGTGAAGTTGG - Intronic
1084770902 11:71342283-71342305 CAGTGGAGAACGTGAGAAGTGGG + Intergenic
1084951703 11:72670007-72670029 TGGTGGAGCAGGAGAGGAGTGGG - Intronic
1085014962 11:73167909-73167931 TAGGAGAGAGGGAGAGAAGTGGG + Intergenic
1086074866 11:82839777-82839799 TAGTGGAGTGGGAGAGGAGTTGG - Intronic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1086138063 11:83462612-83462634 GAGGGGAGATGAAGAGAAGCTGG + Intronic
1087195824 11:95303357-95303379 TAGTGAGGATGGAGAGGAGAGGG + Intergenic
1087204039 11:95375277-95375299 TGGTGGAGATAGACAGAAGTGGG + Intergenic
1087219963 11:95536036-95536058 TAGTGGAGAGGGTGAAAAGGGGG + Intergenic
1087583499 11:100089899-100089921 TAGAGGGGAGGGAGAGAATTGGG + Intronic
1087588853 11:100158242-100158264 TACTGGAAATGGAGAGTTGTTGG + Intronic
1088021521 11:105125393-105125415 TAGTCCAGATGCAGAGAAGCAGG - Intergenic
1088218948 11:107546531-107546553 TATTTGAGATGGAAAGAAATTGG + Intronic
1088368928 11:109067440-109067462 TAGTGGAGCTGGGGAGAGGACGG - Intergenic
1088629212 11:111758041-111758063 TAGTGAAGATGGAAAGGATTTGG - Intronic
1088821265 11:113459644-113459666 AGGGGGAGATGGAGAGAGGTTGG + Intronic
1089547620 11:119241842-119241864 GTGTAGAGATGGAAAGAAGTGGG + Intronic
1089996832 11:122916042-122916064 TAGGGAAGATGAAGAGAGGTTGG + Intronic
1091076083 11:132618530-132618552 TAGTGAAGGTGAAAAGAAGTGGG - Intronic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091707702 12:2710302-2710324 TAGTGGGGAAGCAGAAAAGTTGG - Intergenic
1092074054 12:5658213-5658235 AAGTGGAGGTATAGAGAAGTTGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092798209 12:12135338-12135360 GAGTGGAGGGGGAGAGAAGTGGG + Intronic
1092894002 12:12995809-12995831 TAATGGAGATGGGGTGAAGGAGG - Intronic
1093262571 12:16957349-16957371 TATGAGAGAAGGAGAGAAGTGGG - Intergenic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1094664923 12:32510194-32510216 TAGTGGGAATGGGAAGAAGTGGG + Intronic
1095319613 12:40810523-40810545 TGGTGGAAATGGGGAGATGTTGG - Intronic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095716547 12:45352313-45352335 GAGTGGGGAGGGAAAGAAGTGGG - Intronic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096263774 12:50108437-50108459 TAGGGGTGATGGACAGAAGTGGG - Intronic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096739876 12:53685274-53685296 TAGTGGGGATGGTGAGGAGTAGG + Intergenic
1097623168 12:61966139-61966161 CAGTGAAGATGAGGAGAAGTTGG - Intronic
1097669237 12:62516280-62516302 TGGTGGAGATGGGGAGCAGGGGG + Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1098033431 12:66278276-66278298 TCCAGGAGATGGAGGGAAGTGGG + Intergenic
1098298141 12:69025323-69025345 TGGAGGAGATGGAGATAAGCAGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098451318 12:70621240-70621262 TGGTGGAGAGTGAGAGAATTTGG + Intronic
1098605966 12:72389937-72389959 TAGTGGAGGTGGTAAGAAGGGGG + Intronic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099039959 12:77640409-77640431 GGATGGAAATGGAGAGAAGTAGG - Intergenic
1099048079 12:77748730-77748752 TGGGGGAGATGGGGAGATGTTGG + Intergenic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1100272202 12:93037230-93037252 TAGTGAGGATGTAGAGAAATTGG - Intergenic
1100396871 12:94193364-94193386 TAGTGGTGAGGGAAGGAAGTGGG + Intronic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1100625504 12:96327397-96327419 TACTGAAGATGGAGGGAAGCAGG + Intronic
1100631276 12:96391737-96391759 TAGTGAAAATGGAGAGAAAAGGG - Intronic
1100995882 12:100300676-100300698 TCATGGAGATGGAGAGTAGAAGG - Intronic
1101006620 12:100406959-100406981 CAATGGAGATGGAGAGAGGGGGG + Intronic
1101199263 12:102417716-102417738 TAGAGGAAATGAAGAAAAGTAGG - Exonic
1101728924 12:107410615-107410637 CAGTGGAGATGGGGAGGACTTGG + Intronic
1101730443 12:107422601-107422623 CAGTGGAGGTGATGAGAAGTTGG + Intronic
1102172585 12:110853381-110853403 TGGGGGAGATGGAGAGGAGTGGG - Intronic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103099298 12:118158597-118158619 TAATGGAGATGGAGAGGAGTGGG - Intronic
1103781581 12:123402319-123402341 GAATGGAGATGGAGAGGAGGTGG + Intronic
1104278717 12:127354140-127354162 TGGTGGAGGTGGAGGGAAGTGGG + Intergenic
1104300614 12:127561832-127561854 GAGTGAAGATGGAAGGAAGTGGG + Intergenic
1104329714 12:127833537-127833559 TGGTGGACATGGAGAGATGATGG + Intergenic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104577383 12:129980263-129980285 CAGTGAAGATGGAAAGAATTGGG + Intergenic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105211056 13:18257293-18257315 GGGTGGAGATGGAGAGAGTTAGG + Intergenic
1105774713 13:23646920-23646942 TGGTGGAGATGTGGAGAAATTGG - Intronic
1106984787 13:35333673-35333695 TTGAGGAGTTGGAGAGAGGTAGG - Intronic
1107223482 13:38016844-38016866 GAGTGGAGGTGAAGAGAGGTTGG - Intergenic
1107317542 13:39149995-39150017 AAGTAGAGAAGGAAAGAAGTCGG + Intergenic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108007225 13:45961540-45961562 TAGTGGGGGTGGGGAGATGTGGG + Intronic
1108411439 13:50151655-50151677 TAGTGAGGATGGGGAGAAATTGG - Intronic
1108703932 13:52968127-52968149 TGGTGGAGGTGGAGGAAAGTCGG - Intergenic
1108941531 13:55962033-55962055 TATTAGAGAGGGAGAGAAGGAGG + Intergenic
1108979293 13:56490362-56490384 TTGAGGAGAGGGAGAGAATTGGG - Intergenic
1109889617 13:68591633-68591655 TAGTAGGGATGCAGAGAAATAGG - Intergenic
1110009274 13:70311386-70311408 GAGTGTCAATGGAGAGAAGTTGG - Intergenic
1110100505 13:71595491-71595513 TAATGGAGAAGGAAAGAAGTAGG + Intronic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110398427 13:75060738-75060760 TAGTGAAGATGCAGAGAAAAGGG + Intergenic
1110783736 13:79497983-79498005 TAGTGGCACTGAAGAGAAGTGGG + Intronic
1111706747 13:91759553-91759575 TCATGGAGATGGAGAGTAGAAGG - Intronic
1111846071 13:93510292-93510314 GAGGGAAGATGAAGAGAAGTGGG - Intronic
1112002596 13:95225099-95225121 TGGGGGAGAGGGAGAGAAGAAGG - Intronic
1112273035 13:97987673-97987695 TAGTAGAGATGGAGCCAACTGGG + Intronic
1112566800 13:100558836-100558858 GAGAGGGGATGGAGAGAGGTTGG + Intronic
1113144797 13:107196688-107196710 TGGGGGAGATGGGGAGATGTAGG + Intronic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1113818631 13:113194430-113194452 TATGGGAGGTGGAGAGAAGAGGG - Intronic
1114523649 14:23354125-23354147 TGGTAGAGATGGAGAGATGTGGG - Intergenic
1114898602 14:27027008-27027030 TAGTGGGGGTGGCGATAAGTTGG - Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115141746 14:30179614-30179636 GAGGAGAGATGGAGAGAACTAGG + Intronic
1115157405 14:30356795-30356817 TAGAGGGGATGGGGAGATGTGGG - Intergenic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115842970 14:37492729-37492751 TGGTGTAGATGAAGAGATGTTGG - Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116601037 14:46922870-46922892 TAATGCGGATGGAGCGAAGTAGG + Intronic
1116602129 14:46939117-46939139 TAGTTGAGAAGGAGAGAATAGGG + Intronic
1117108384 14:52422255-52422277 AATTGGAGTTGGAGGGAAGTGGG + Intergenic
1117201685 14:53396228-53396250 CAGAGGAGAGGGAGAGAAATGGG - Intergenic
1117354430 14:54910139-54910161 TAGAGGAGCTCGGGAGAAGTGGG - Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117840588 14:59856650-59856672 GATTGGGGGTGGAGAGAAGTCGG - Intronic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118906165 14:70024972-70024994 TAAGGGGAATGGAGAGAAGTGGG + Intronic
1119402218 14:74370661-74370683 TGGTGGAAGTGGAGAGAAGTAGG - Intergenic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119500653 14:75124563-75124585 TACTGGAGAAGCAGAGAACTGGG + Intronic
1119994649 14:79240009-79240031 TAGGGGGAATGGAGAGATGTTGG + Intronic
1120138676 14:80901763-80901785 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1120295925 14:82640755-82640777 GAGGGGAGATGGGGAAAAGTAGG + Intergenic
1120545769 14:85809406-85809428 AAGTGGAGATGTAGAGAGGTAGG + Intergenic
1121642098 14:95492132-95492154 TGGTGAAGATGTAGGGAAGTTGG + Intergenic
1122043082 14:99003708-99003730 TTCTGGAGATGGACAGAATTGGG - Intergenic
1122149606 14:99717830-99717852 AAGTGGAGGTGGAGAGGAATGGG - Intronic
1122629156 14:103099438-103099460 TGGTGGAGAGGGAGAGGAGTGGG + Intergenic
1123159765 14:106267070-106267092 TAGTGGGGAGGGAGAGCATTAGG + Intergenic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1124385541 15:29205452-29205474 TGGTGAGGATGTAGAGAAGTTGG - Intronic
1124427381 15:29572995-29573017 TAGTGGAGATGTCGAGAATTGGG + Intergenic
1124485432 15:30110726-30110748 TAGTGCAGATGGAGAAACGATGG - Intergenic
1124518144 15:30386541-30386563 TAGTGCAGATGGAGAAACGATGG + Intronic
1124540509 15:30579712-30579734 TAGTGCAGATGGAGAAACGATGG - Intergenic
1124758144 15:32427869-32427891 TAGTGCAGATGGAGAAACGATGG + Intergenic
1124817423 15:33009232-33009254 TAGTGGAGATGGTGGTAACTTGG - Intronic
1124936207 15:34173748-34173770 GAGAGGAGATGGAGACAACTGGG + Intronic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125315384 15:38425970-38425992 TAGGGGAGATGAAGAGAGATTGG + Intergenic
1125568274 15:40694522-40694544 TCGAGAAGATGGATAGAAGTGGG - Intergenic
1125615494 15:41008425-41008447 TAGGGGAAATGGGGAGATGTTGG + Intronic
1125803437 15:42471280-42471302 TACTGGAAATGCAGAGAACTGGG - Intronic
1125841503 15:42805608-42805630 TAATAGAGATGGAGGGAAATGGG - Intronic
1125890681 15:43264142-43264164 TAGTGGGAATGCAGAGAAATTGG + Intronic
1126132275 15:45353289-45353311 TTGCGGAGATGGGGAGAAGAGGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127038089 15:54941932-54941954 TGGTAGAGGTGGAGAGAAGAGGG - Intergenic
1127169301 15:56282707-56282729 TAGTTGAAAGGGAGAAAAGTGGG + Intronic
1127215611 15:56820356-56820378 GAGTGGAGATGTAGAGATGGTGG - Intronic
1127244851 15:57161107-57161129 TAATTGAGATGGGGAGAAATGGG + Intronic
1127492703 15:59480047-59480069 TGGTGGAGATGGGGAGAAGATGG + Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128511818 15:68318247-68318269 GAGTGGAGGTAAAGAGAAGTGGG - Intronic
1128571424 15:68736255-68736277 TCATGAAGATGGAAAGAAGTGGG - Intergenic
1128843888 15:70872405-70872427 TAGGGGAGAGGGAGAGGAGGAGG + Intronic
1129330937 15:74826778-74826800 TAAGGGAGATGGGGACAAGTCGG + Exonic
1129545951 15:76395030-76395052 TCATGGAGATGGAGAGTAGAAGG - Intronic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1129798467 15:78395847-78395869 TCGTGGAGCTGGAAAGAACTTGG + Intergenic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1130251214 15:82301384-82301406 TAGGTGAGATGGAGAGAGGGAGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131303817 15:91223766-91223788 TACTGGAGATGGTGAAAAATCGG + Intronic
1131515862 15:93076257-93076279 GAGTGGAAAGGGAGAGAAGGTGG - Intronic
1131545828 15:93314754-93314776 AGGTGGAGATGGTGAGAAGGTGG + Intergenic
1131818125 15:96244119-96244141 TATTGGATATGGACAGCAGTGGG + Intergenic
1131867864 15:96731303-96731325 GAGTTGAGATGGGGAGAGGTGGG - Intergenic
1132202226 15:99962888-99962910 CAGTGAAGATAGGGAGAAGTGGG + Intergenic
1132236694 15:100227425-100227447 TAGGGGAGATAAAGAAAAGTGGG - Intronic
1132299524 15:100767432-100767454 GAGGGGAGATGGAGAGAGGGAGG - Intergenic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132444687 15:101903368-101903390 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1133537070 16:6712708-6712730 GAGGGGAGGTGGGGAGAAGTGGG - Intronic
1133876920 16:9743735-9743757 TAGTGGAAATGAAGAGCAGCAGG + Intergenic
1134201765 16:12205094-12205116 CAGTGAAGATGGAGAGTCGTGGG + Intronic
1134323124 16:13181757-13181779 TGATGGAGATGGGGAGAAGGGGG + Intronic
1134371110 16:13625760-13625782 TAGTGAAGATTTAGAGAAATAGG - Intergenic
1135030604 16:19035274-19035296 GAGTGGAGAGGGAGAGAGGGAGG + Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135244426 16:20842976-20842998 CAGTGAAGATGTAGATAAGTTGG - Intronic
1135248293 16:20876963-20876985 GAGGGGAGATGAAAAGAAGTGGG + Intronic
1135299835 16:21316433-21316455 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1137270550 16:46899972-46899994 TTGTGCAGATGAAGAGAAGCTGG + Intronic
1137306581 16:47206777-47206799 TAGCAGTGATGGAGAGAAATGGG - Intronic
1137420045 16:48325393-48325415 TAGTGGGGATGGGGAGAGATTGG - Intronic
1137847720 16:51708470-51708492 TAGTGGAGCTGGAGAAAAGATGG + Intergenic
1138540479 16:57684534-57684556 TATTGGGGCTGGAGAGAGGTGGG + Intronic
1139118881 16:63991265-63991287 TCAAGAAGATGGAGAGAAGTAGG + Intergenic
1139120215 16:64007274-64007296 GTGTGGAGAGAGAGAGAAGTGGG - Intergenic
1139197029 16:64931182-64931204 GGGTGGAAATGGGGAGAAGTAGG + Intergenic
1139530542 16:67540429-67540451 TGGAGGAGAAGGGGAGAAGTCGG - Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141816163 16:86410594-86410616 GAGTGGAGATGGTGAGTAGGTGG + Intergenic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1142134178 16:88444094-88444116 AAGTGGGGTAGGAGAGAAGTGGG + Intergenic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1142591719 17:1009204-1009226 TAGTGGGGATGGACAGCAGTGGG - Intronic
1143352167 17:6296999-6297021 TAGTAGAGATGGGGAGGAGGTGG - Intergenic
1144051617 17:11501857-11501879 TAGTGGAAAAGGAGAGAAAAGGG + Intronic
1144211202 17:13017291-13017313 TAGCAGAGGTGGAGAGGAGTGGG + Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144935187 17:18892462-18892484 TGGTGAAGATGTGGAGAAGTTGG - Intronic
1146073420 17:29705201-29705223 TAGTGGTGATAGGGATAAGTGGG - Intronic
1146421582 17:32691317-32691339 TAGTGGAGATGAAGAGCGATTGG - Intronic
1146499750 17:33354304-33354326 TAGTGGGGATGGAGAGCATGAGG - Intronic
1146530546 17:33604341-33604363 GAGTGGACATGGAGAGCAGGTGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146733577 17:35216904-35216926 TAGTGGAGATGGAGAAGGGCAGG + Intergenic
1146833641 17:36091976-36091998 CAGTGGAGCTGCAGAGCAGTGGG + Intergenic
1146848231 17:36198815-36198837 CAGTGGAGCTGCAGAGCAGTGGG + Intronic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147328066 17:39679504-39679526 TAGTAGAGGTGGGGACAAGTGGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1148065761 17:44868571-44868593 TGGTGGAGATGGAGAGGCTTGGG - Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149002453 17:51771234-51771256 TATTGGAGATGGAGCCTAGTGGG - Intronic
1149317321 17:55450836-55450858 CAAAGGAGATGGAAAGAAGTGGG - Intergenic
1149689055 17:58558465-58558487 TAGTGGGGCTAGAGAGAATTTGG - Intronic
1150317740 17:64183735-64183757 TAGTGAGGATGTAGAGAAATTGG - Intronic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1151999859 17:77638462-77638484 TAGGAGAGACGGAAAGAAGTGGG + Intergenic
1152056124 17:78028254-78028276 TTCTGGGGATGGGGAGAAGTGGG + Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1153098343 18:1435428-1435450 CAGTGAAGTTGGAAAGAAGTAGG - Intergenic
1153175432 18:2366987-2367009 TAGAGGAGAGGGAGAGAGATGGG - Intergenic
1153390575 18:4553246-4553268 TGGTGAAGATGCAGAGAAATTGG - Intergenic
1153539840 18:6141682-6141704 TAGTAGTGATGAAGATAAGTTGG - Intronic
1153709429 18:7783166-7783188 TAGTGGAGTGGGTGAGAGGTGGG + Intronic
1153798327 18:8646049-8646071 TGGTGAAGATGTAGAGAATTTGG + Intergenic
1154183765 18:12161707-12161729 TTGTGGAGATAGAGAGTAGAAGG - Intergenic
1154247550 18:12713122-12713144 CAGTGGAGGAGGAAAGAAGTCGG - Intronic
1155104016 18:22642639-22642661 TGGAGGAGATGGGGAGAAGATGG + Intergenic
1155124754 18:22861793-22861815 TGAGGGAGATGAAGAGAAGTGGG + Intronic
1155325305 18:24658504-24658526 TGGGGGAGATGGAGAGGAGGAGG + Intergenic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1155433614 18:25787841-25787863 TAGAGGTGATGGTCAGAAGTGGG - Intergenic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1155844457 18:30688033-30688055 TAGCTGAGATGGAAAGAAGATGG - Intergenic
1155855199 18:30825488-30825510 TGGTTGAGATGGACAGAAATGGG + Intergenic
1155968538 18:32058758-32058780 TAGTGGGGATTGGGGGAAGTGGG - Intronic
1156452697 18:37275423-37275445 GAGGGGCGAGGGAGAGAAGTAGG + Intronic
1156849145 18:41705423-41705445 TCTGGGAGATGCAGAGAAGTTGG + Intergenic
1156920985 18:42522116-42522138 CAGTGGAGATGAAGAGTAATAGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157279339 18:46335369-46335391 GAGTGGAGGTGGGGAGAAGAGGG - Intronic
1157572667 18:48723407-48723429 TAGTGCAGGTGGGGAGAAGGTGG - Intronic
1157726886 18:49971250-49971272 GAGTAGAGAGGGCGAGAAGTGGG + Intronic
1157953810 18:52071862-52071884 TCATAGAGATGGAGAGTAGTAGG - Intergenic
1158561355 18:58516472-58516494 TTGTGGAGAGGGAGAGGGGTGGG - Intronic
1159046016 18:63368898-63368920 TAGTGAAGATGTAGAGAAATTGG - Intergenic
1159108176 18:64027124-64027146 TAGTGGAGATGGAGGGGCGGGGG + Intergenic
1159626383 18:70700149-70700171 AAGGGGAGATGGAGAGAAGCTGG - Intergenic
1159949282 18:74468652-74468674 TGGAGGAGATGGAGGGAACTGGG + Intergenic
1160640667 19:131435-131457 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1160970349 19:1765160-1765182 TAGAGGAGATGGAGACCAGCTGG - Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163255953 19:16155968-16155990 TGGTGGAGATGGAAAGAAGGAGG + Intronic
1163570560 19:18079540-18079562 TACCGGGGATGGAGAGAAGGAGG - Intronic
1165340181 19:35205683-35205705 AAATGGAGAGGGAGAGAAGGAGG - Intergenic
1166898493 19:46039935-46039957 TCCTGCAGAAGGAGAGAAGTGGG + Exonic
1166914120 19:46182959-46182981 TGGGAGAGATGGGGAGAAGTGGG - Intergenic
1168099486 19:54133743-54133765 GAGGGGAGGTGGAGAGAAGGAGG - Intergenic
1168167925 19:54565999-54566021 CAGTGGACAGGGAGAAAAGTAGG + Intergenic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925384983 2:3455531-3455553 TCATGGAGATGGAGAGCAGGAGG - Intronic
926400402 2:12490698-12490720 CAGAGGAGGAGGAGAGAAGTGGG - Intergenic
926560051 2:14406863-14406885 CAGTGGAGATGAAGAAGAGTAGG - Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
926803582 2:16684072-16684094 AAGTGGAGATGAAGAGAAACTGG - Intergenic
927727172 2:25434841-25434863 TGGTGAAGATGTAGAGAAATTGG - Intronic
927801491 2:26104215-26104237 TAGTGAGGATGTAGAGAAATTGG - Intronic
928067494 2:28180967-28180989 TAGTGAAGATGCAGAGAAAAGGG + Intronic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
928866472 2:35922804-35922826 TAGTGGAAAGGAAGAGAAGAAGG + Intergenic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929324307 2:40588874-40588896 TCGTGGAGATAGAGAGTAGAAGG + Intronic
929867845 2:45733678-45733700 TAGTGGAGACGGTGAGAGGGAGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930376138 2:50569146-50569168 TAGTGGGGGTTGGGAGAAGTGGG + Intronic
930985664 2:57584768-57584790 TAGTGGGGATGGCGAGGAGGTGG - Intergenic
931807361 2:65820172-65820194 TAGTAGAGGTGGAGAGAAGCAGG - Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932294251 2:70610914-70610936 TAGTGGAAATGGATAGTATTTGG + Intronic
932324936 2:70852563-70852585 TGGTGGATATGCAGAGAAATTGG + Intergenic
932561605 2:72876757-72876779 TAGAGGAGGGGGAGGGAAGTTGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932733446 2:74236852-74236874 TGTTGGAGATGGAAAGCAGTAGG - Intronic
933350026 2:81142083-81142105 GAGAGGGGATGAAGAGAAGTTGG - Intergenic
934015718 2:87879497-87879519 TAATGGAGATAGAGAGTAGGAGG - Intergenic
934539821 2:95164672-95164694 TTATGGAGATGGAGAGTAGAAGG + Intronic
934698397 2:96417297-96417319 TGGTGAGGATGCAGAGAAGTAGG - Intergenic
936674160 2:114695207-114695229 TATTGGAGATGTAGTGAAATGGG + Intronic
936680073 2:114760013-114760035 TGGTGCAGGTGGTGAGAAGTGGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936806538 2:116339236-116339258 GAGTGGAGAAGAAGAGAATTTGG - Intergenic
936911902 2:117602240-117602262 TGGGGGAGATGGAGAGAAGCAGG - Intergenic
937048841 2:118871609-118871631 CAGAGGAGCTGGAAAGAAGTAGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937627902 2:124064446-124064468 TAATAGAAATGGAGAGAAGCAGG - Intronic
938391886 2:130913197-130913219 TTGTGGAGTTGGAGGGAAGCAGG + Intronic
938722417 2:134078350-134078372 TAGTGGAGAGGAAGATAAGCTGG + Intergenic
938746979 2:134288824-134288846 TAGGGGAGAGGGAGAAGAGTGGG - Intronic
939017981 2:136923590-136923612 TAATGAAGATGGAGAGAAATTGG - Intronic
939167141 2:138652145-138652167 TAGTGGAGAGGGAGAGGTGTGGG + Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
939835386 2:147124138-147124160 GAGTAGAGAAGGAGAGAAATGGG + Intergenic
939933665 2:148261907-148261929 TAGGGGAGAGGGAGAGAGATGGG + Intronic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
941447301 2:165617915-165617937 GAGTGGATGTGGAGAGATGTTGG + Intronic
942917637 2:181330771-181330793 GAAAGGAGATGGTGAGAAGTAGG + Intergenic
944291312 2:198008836-198008858 TGGTGAAGATGTAGAGAAGATGG - Intronic
944457179 2:199907849-199907871 CAGTTGAGAGGGAGAGGAGTGGG - Intergenic
944877058 2:203972939-203972961 GAGTGGAGTTGGAGAAGAGTGGG - Intergenic
945712767 2:213320532-213320554 AAGGGGAGATGAAGAGAAATTGG - Intronic
945713914 2:213334765-213334787 TAATGGAGATAGAGAGTAGAAGG + Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946512219 2:220370379-220370401 CAGTGCAGGTGGTGAGAAGTGGG - Intergenic
946628195 2:221637580-221637602 GAGTGGACATGGAAAGAGGTGGG + Intergenic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
946920315 2:224573942-224573964 TAGTGGAAATGGAAAGGAATTGG + Intronic
947289549 2:228557207-228557229 TGGTGGAAATGGAAAGAAGAGGG - Intergenic
948238992 2:236412980-236413002 CCGTGGAGATGGGGAGATGTGGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948481081 2:238251020-238251042 GAGTGGAGATGGTGAGAGCTTGG - Intronic
948853675 2:240720246-240720268 TTGTGGAGATGAAGAGATGCTGG - Intronic
948879133 2:240847259-240847281 CAGCGGAGAGGGAGAGAAGGAGG - Intergenic
1168968343 20:1913638-1913660 TAGGGGAGAAGGAGAGAACCAGG - Intronic
1169140872 20:3226949-3226971 TGGTGGCGATGGAGGGAGGTGGG - Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1169776461 20:9259582-9259604 TGGCAGAGATGGAGAGAAGGAGG + Intronic
1170206164 20:13800884-13800906 TAGAGGAGGAGGAGAGATGTAGG - Intronic
1170287368 20:14724998-14725020 TTCTGGAGATGGAGACAAATGGG + Intronic
1170434418 20:16310966-16310988 GAGAGCAGAAGGAGAGAAGTGGG - Intronic
1170506217 20:17028256-17028278 TAGGGAAGACAGAGAGAAGTTGG + Intergenic
1170545664 20:17433898-17433920 GAGAGGAAAGGGAGAGAAGTAGG - Intronic
1170630246 20:18058822-18058844 GAGGGGAGAGGGAGAGAAGGAGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170801938 20:19597702-19597724 GAGGGGAGATGAAGAGAGGTTGG - Intronic
1170818082 20:19731950-19731972 TCATGGAGATGGAGAGTAGAAGG - Intergenic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171077179 20:22139732-22139754 TTGCAGAGATGTAGAGAAGTTGG - Intergenic
1172176709 20:32976802-32976824 TAAAGGAGATAGGGAGAAGTGGG + Intergenic
1172372942 20:34409747-34409769 TAGTGTAGATTCATAGAAGTAGG + Intronic
1172578930 20:36031419-36031441 TAGAGGAGGTGGAGACAAGGAGG + Intergenic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1172790505 20:37502095-37502117 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1173844951 20:46182411-46182433 TAGTGGAGGCACAGAGAAGTAGG + Intronic
1174052865 20:47779418-47779440 CAATGGAGATGGAGTGAAATGGG - Intronic
1174312564 20:49669265-49669287 TAGAGGTCATGGATAGAAGTTGG - Intronic
1174747554 20:53078709-53078731 CAATAGAGATGTAGAGAAGTGGG + Intronic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175857306 20:62129015-62129037 GGGAGGAGATGGAGAGAGGTGGG + Intronic
1176183714 20:63766715-63766737 TTCTGAAGATGGAGAAAAGTGGG - Intronic
1176886544 21:14263149-14263171 TAGTGAACAGAGAGAGAAGTCGG - Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177774347 21:25551272-25551294 CAGTAGAGATGGACAGATGTAGG + Intergenic
1177937319 21:27365807-27365829 TAGTGGAGATGGAGCCATGCAGG - Intergenic
1178231407 21:30789196-30789218 TAGAGGAAATGGGGAGAAGTAGG - Intergenic
1178596858 21:33962161-33962183 GAGTGGAGTTGGAGAGAAACAGG + Intergenic
1178859358 21:36276047-36276069 TGGTGGAGCTGGAGCGGAGTCGG + Intronic
1179992810 21:44957453-44957475 TGGTGGAGATGAAGAGGAGGAGG - Intronic
1181499256 22:23306558-23306580 TAGAGGAGATGGAGACACGTTGG + Intronic
1181922978 22:26334906-26334928 AAGGGGAGATGGAGAGATGCTGG - Intronic
1182116219 22:27757961-27757983 TAGTGGGGCAGGAGAAAAGTGGG - Intronic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182817953 22:33183854-33183876 TAGAAGAAATGGAGAGATGTTGG + Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182983171 22:34691755-34691777 AAAGGGAAATGGAGAGAAGTAGG - Intergenic
1183084457 22:35478056-35478078 GAGAGGAGAAGGAGGGAAGTGGG - Intergenic
1183381494 22:37492560-37492582 GAGTGGAGAGGGAGAGATGAAGG + Intronic
1183724559 22:39581217-39581239 AAGTGGGGAGGCAGAGAAGTGGG + Intronic
1184968740 22:48000085-48000107 GAGTGGAGATGGGGAGAGGTTGG - Intergenic
949380557 3:3440793-3440815 TAGTGAGGATGTAGAGAAATTGG + Intergenic
950053037 3:10006510-10006532 TAGTGGAGATGCTAAGTAGTGGG - Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950694972 3:14691924-14691946 TCATGGAGATGGAGAGCAGATGG - Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
952240951 3:31531597-31531619 TAGCGGACAAGGAGGGAAGTGGG + Intergenic
952552859 3:34498600-34498622 TGGTGGAGACGTAGAGAAATAGG + Intergenic
952835363 3:37597445-37597467 TGGTGGAGGTGAAGAGAAGAGGG + Intronic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
953005963 3:38979680-38979702 CAGTGGAGATAGAGAGACTTTGG - Intergenic
953237811 3:41121402-41121424 AAGTGGAAATGGAGAGGGGTTGG + Intergenic
953267063 3:41400814-41400836 TAGGGGAGATGCTGAGAAATTGG - Intronic
953279437 3:41539461-41539483 TAGTAGTGTTGGAGAGTAGTAGG - Intronic
953549301 3:43888791-43888813 TCGTGGAGATAGAGAGTAGAAGG + Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
954163426 3:48738253-48738275 TAGTGGAGATGTCAAGCAGTGGG + Intronic
955353343 3:58210041-58210063 TAGAGGAGAGGGAGAGAGGAAGG + Intronic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
955711067 3:61779537-61779559 CAGTGAAGATGGAGGGATGTAGG + Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
956014499 3:64867385-64867407 TAGTGGAGAAGGAAAGAAGAGGG + Intergenic
956112597 3:65884737-65884759 AAGTGGGGATGGAGAGATGGAGG - Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
957157709 3:76566725-76566747 GGGTGGAGAGGAAGAGAAGTGGG + Intronic
957542532 3:81592276-81592298 TGGAGGAAATGGAGAGATGTTGG - Intronic
957596036 3:82268077-82268099 TGGTGGAGAGAGAGAGAAATAGG + Intergenic
957800536 3:85074152-85074174 TAATGTGGCTGGAGAGAAGTGGG - Intronic
957941370 3:87008921-87008943 GAGGGGTGATGAAGAGAAGTTGG - Intergenic
958112150 3:89162524-89162546 TTGAGGAGAAGGAGAGAGGTTGG - Intronic
959089216 3:101884622-101884644 GACGCGAGATGGAGAGAAGTAGG + Intergenic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
959874598 3:111367752-111367774 AAATGGAGATGTAGAGAGGTTGG - Intronic
960078302 3:113513710-113513732 TAGTAGAGATGGAGAAGAGCGGG - Intronic
960173335 3:114488594-114488616 TAGTGAGGATGCAGAGAAATGGG + Intronic
960258576 3:115538028-115538050 TATTGGAGCAGGAGAGAGGTAGG - Intergenic
960427628 3:117528351-117528373 TCCTGGAGATGGAGAGTAGAAGG - Intergenic
960431607 3:117575968-117575990 TGGAGGGGATGAAGAGAAGTTGG - Intergenic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960537036 3:118826034-118826056 TGGTGGAAATGGAGAGAAGGAGG + Intergenic
960691912 3:120355196-120355218 TGGTGCAGATGTAGAGAAATTGG + Intergenic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
961369603 3:126421507-126421529 AAGCAGGGATGGAGAGAAGTGGG + Intronic
961957278 3:130816980-130817002 TAATGGAGATGGTAAGTAGTTGG + Intergenic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
962932886 3:140053817-140053839 TTGTGGAGATGGAGTGAGATGGG + Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087446 3:141451271-141451293 TAGTGGGGATGGTAAGAAATGGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964159750 3:153632774-153632796 AAGGTGAGAGGGAGAGAAGTAGG - Intergenic
964245071 3:154642262-154642284 TGGAGGAGATGAAGAGAATTGGG - Intergenic
965046971 3:163590963-163590985 TAGTGAAGAGGCAGAGAAATGGG - Intergenic
965373768 3:167896301-167896323 TTGTTGTGATGGAGAGAGGTGGG + Intergenic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
965447367 3:168791692-168791714 ATGGGGAGATGAAGAGAAGTTGG + Intergenic
965464680 3:169013337-169013359 CAGTGCAGATAGAGAGAAGCAGG - Intergenic
965493705 3:169371358-169371380 TAGGGGAAATGGGGAGATGTTGG + Intronic
965773439 3:172204980-172205002 TAGTGGAAATGGAGAGAGACGGG + Intronic
965908249 3:173737889-173737911 TGGTGAGGATGCAGAGAAGTTGG - Intronic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966302523 3:178495381-178495403 TAGTGGAGATGAAGCCAAGTGGG - Intronic
966431051 3:179832134-179832156 CAGTGGAGAACGAGAGAATTAGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967352257 3:188526827-188526849 TAGTTGAGAGGAAGAGAAATAGG + Intronic
967367057 3:188699244-188699266 ACGTGGAGACGGAGAGAGGTGGG + Intronic
967417535 3:189235393-189235415 AAGGGAAGATGGAGAGAGGTGGG + Intronic
967638165 3:191830077-191830099 TAGTGGAGAGGGTGGGAAGCAGG + Intergenic
967650302 3:191977559-191977581 TGGTGAGGATGTAGAGAAGTTGG + Intergenic
967661552 3:192116720-192116742 TAATTGAGATGGAAAGTAGTTGG - Intergenic
967926978 3:194658094-194658116 TCGTAGAGATGGAGAGACTTAGG - Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969728066 4:8937272-8937294 GAAAGGAGATGAAGAGAAGTTGG + Intergenic
969951386 4:10839937-10839959 TCGTGATGATGCAGAGAAGTTGG - Intergenic
970105318 4:12575992-12576014 TAGTGGAAAAGGAGAGAAAAGGG + Intergenic
970693236 4:18643987-18644009 TGGTGGAAATATAGAGAAGTTGG - Intergenic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971251877 4:24979424-24979446 GAGAAGACATGGAGAGAAGTGGG + Intronic
971429267 4:26547079-26547101 TGGTGGAGGTAGAGAGAAGGAGG - Intergenic
971471458 4:27031357-27031379 TTCAGGAGAGGGAGAGAAGTGGG - Intergenic
972164595 4:36266925-36266947 TAGAGGGGATGGAAATAAGTAGG + Intergenic
972263152 4:37431521-37431543 TAGAGGAAATAGAGAGATGTTGG + Intronic
972393335 4:38634052-38634074 GAGTGGAAATGAAGAGAAATGGG - Intergenic
972962607 4:44472720-44472742 TAGTGGAGGTGAAGTGAAGTGGG + Intergenic
973762170 4:54127687-54127709 TTGTGGAGATAGAGAGTAGAAGG - Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974172282 4:58281732-58281754 TAGTGAAGATGTTGAGAAGAAGG + Intergenic
974269579 4:59633273-59633295 TAGTGGAGCTGTTGAGAAGAGGG - Intergenic
974669046 4:65004713-65004735 TGGTGGAGATAGAGAAAAGACGG - Intergenic
974732488 4:65886628-65886650 TAGTGGAAATTGAGAGAATCTGG - Intergenic
975583559 4:75928610-75928632 GAGTGGAGATGCTGAGAAGATGG + Intronic
975641737 4:76507377-76507399 TGGTGAAGATGTAGAGAAATTGG - Intronic
975656589 4:76647277-76647299 TGGTGGTGATGAAGAGATGTTGG + Intronic
977715117 4:100173529-100173551 TTGAGGAGAGGGAGAGAGGTGGG + Intergenic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
978277362 4:106967996-106968018 GAGAGGAGATGGAGAGATGAAGG + Intronic
978561679 4:110040775-110040797 GAGGGGAGAGAGAGAGAAGTGGG - Intergenic
978918973 4:114158846-114158868 TTGTGAAGGTGGGGAGAAGTGGG + Intergenic
979108914 4:116725115-116725137 AAGTGGAGATGGCGAAAAGTAGG - Intergenic
979318539 4:119296851-119296873 TGGTGAAGATGGAGAGATCTTGG - Intergenic
979635948 4:122954318-122954340 TAGTGGAGCTGGGCAGAAGGTGG - Intronic
979880966 4:125960341-125960363 TGGGGGAAATGGAGAGATGTTGG - Intergenic
979995156 4:127423551-127423573 TAGTGGAAATGAAGAGAAATAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980281208 4:130722651-130722673 TAGTGCAGGTGGAGGGAAGAGGG - Intergenic
980953284 4:139402927-139402949 ACATGGAAATGGAGAGAAGTTGG - Intronic
981287291 4:143033234-143033256 TAGTGGATGGGGAGGGAAGTGGG + Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981735217 4:147942632-147942654 TAGGGGAGAAGGAAAGAAGGGGG - Intronic
981895085 4:149789008-149789030 TAGAGGAGATGAAGAGAGGCTGG + Intergenic
981907267 4:149935928-149935950 TAGGGGAAATGGGGAGATGTTGG - Intergenic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
981954720 4:150455848-150455870 TAATGGAGATAGAGAGTAGAAGG - Intronic
982166576 4:152618709-152618731 AAGTGGAGGTGGAGAGAAAGTGG - Exonic
983044689 4:162972042-162972064 TTTTGGAGATGGAGAGATATGGG - Intergenic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984085502 4:175305811-175305833 TAGAAGAAATGGAAAGAAGTAGG + Intergenic
984149406 4:176108028-176108050 TAGGGGAGAGGGAGGCAAGTGGG - Intronic
984376696 4:178939626-178939648 TTATGGAGATGAAGAGAATTGGG + Intergenic
984500201 4:180549154-180549176 AAGGGGAGATAGAAAGAAGTTGG - Intergenic
984675125 4:182538698-182538720 TAGTGGAGTTGAAGAGAAGTGGG + Intronic
984783582 4:183548087-183548109 GGGAGGAGATGGAGAGATGTTGG - Intergenic
984837282 4:184033663-184033685 TGGTGGAGCTGGAGATAAGTGGG - Intergenic
985363623 4:189202461-189202483 TCGTGGAGAAGGAGAAAAGCAGG + Intergenic
985715723 5:1459882-1459904 TAGTGGGGATGCTGAGAAGTGGG - Intronic
986092406 5:4523262-4523284 GGGTGGTGATGGCGAGAAGTGGG + Intergenic
986184794 5:5425158-5425180 CAGTGGAGATGTTGAAAAGTGGG - Intronic
986346339 5:6838818-6838840 CAGTGGAGATGCTGAGAAGCAGG + Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
986639349 5:9857155-9857177 AGGAGGAGATGAAGAGAAGTTGG + Intergenic
987636502 5:20548878-20548900 TACTGGTGAAAGAGAGAAGTTGG + Intronic
987652829 5:20766265-20766287 AAGAGGAGATGAAGAGAAGTTGG + Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
987760373 5:22154373-22154395 TAGGGGAAATGGAGAGATGTTGG - Intronic
988156097 5:27450820-27450842 AGGAGGAAATGGAGAGAAGTAGG + Intergenic
988249185 5:28732894-28732916 GAGTGGGGATGGGGAGATGTTGG - Intergenic
988742729 5:34095219-34095241 AAGAGGAGATGAAGAGAAGTTGG - Intronic
989238890 5:39180713-39180735 TAGCTAAGATGGAGAGCAGTAGG + Intronic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
990058563 5:51617756-51617778 TAGAGGAGATGGAGAGAGGTTGG - Intergenic
990235514 5:53763250-53763272 TAGAGAGGATGTAGAGAAGTAGG + Intergenic
990768564 5:59216426-59216448 TAGTAGGGATGGAAGGAAGTGGG - Intronic
990831663 5:59965815-59965837 TAGTGGAGATGGAGACCATTCGG - Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991481926 5:67090298-67090320 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991481938 5:67090330-67090352 AAGTGGGGAGGGGGAGAAGTGGG - Intronic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991895122 5:71387788-71387810 TTGGGGAAATGGAGAGATGTTGG - Intergenic
992009321 5:72511019-72511041 TAGTGGAGATGGGGAGCCGCTGG - Intergenic
992590088 5:78285847-78285869 TGGTGGTAGTGGAGAGAAGTGGG - Intronic
993276366 5:85864842-85864864 TAGGGAGGGTGGAGAGAAGTGGG + Intergenic
993355564 5:86902990-86903012 TAGTGGAAAAGGAGAAAAGTGGG - Intergenic
993367645 5:87052751-87052773 TTTTGGATATGGGGAGAAGTAGG - Intergenic
993458272 5:88150409-88150431 TAATGGAGGTGGAGAAAATTGGG - Intergenic
993844914 5:92929567-92929589 TGGTAGAGATAGAAAGAAGTGGG + Intergenic
994038109 5:95225799-95225821 GAAGGGAGATGGAGAGAAGAGGG - Intronic
994749090 5:103716488-103716510 TAGGGGATATGGAAAGAAGGGGG - Intergenic
995298287 5:110545576-110545598 ATGTGGAGAAGGAGAGAAATAGG + Intronic
995535373 5:113130573-113130595 TATTGGAGATGGAGTCTAGTGGG + Intronic
995940970 5:117583357-117583379 TAGTGGAGACATAGAGAAATGGG - Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996254498 5:121382210-121382232 TAGTAAAGATGTAGAAAAGTTGG - Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996293219 5:121879352-121879374 TTCTGGGGATGGAGAGAAATGGG + Intergenic
996368787 5:122731257-122731279 AAGGGGAGATGAAGAGAGGTTGG - Intergenic
997063736 5:130538478-130538500 GAGAGAAGATGGGGAGAAGTTGG + Intergenic
997612538 5:135225155-135225177 TTGTGGAGTCAGAGAGAAGTTGG + Intronic
998046979 5:138995693-138995715 AAGAGGAGATGAAGAGAGGTTGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998717487 5:144902122-144902144 TAGGAGAGAGGGAAAGAAGTAGG + Intergenic
998892102 5:146757172-146757194 GAGTGGAGAGGGAGGGAGGTAGG + Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000993555 5:167935620-167935642 AGGTGGTGAAGGAGAGAAGTTGG + Intronic
1001054790 5:168440314-168440336 TGGTGAAGATGTAGAGAAATTGG + Intronic
1001061733 5:168496457-168496479 AAGCAGAGAGGGAGAGAAGTGGG + Intronic
1001064353 5:168524124-168524146 GAGGGAAGATGAAGAGAAGTGGG + Intergenic
1001578561 5:172781936-172781958 TAGGGGAAATGGGGAGATGTTGG + Intergenic
1001680375 5:173552728-173552750 GAGTGGAGATGGAGAACAGCTGG - Intergenic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001848254 5:174940497-174940519 GGATGGAGATGGAGAGAAGGAGG + Intergenic
1002019682 5:176355104-176355126 TAGGGGAGCTGGAGAGATGCAGG + Intronic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002736685 5:181394985-181395007 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1002748015 6:79838-79860 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003281503 6:4696126-4696148 GAGGGGAGATGGGGAGATGTTGG + Intergenic
1003366161 6:5476795-5476817 GAGTGGAAATGGGGAGAGGTGGG + Intronic
1003801954 6:9680317-9680339 TGGAGAAGATGGAGAGAATTTGG - Intronic
1004240316 6:13915493-13915515 TAGTGGAAATGAAAAGGAGTAGG + Intergenic
1004696643 6:18040263-18040285 TGGTGGTGATGGAGACAAGGGGG + Intergenic
1005390928 6:25332419-25332441 CAGTGAAGGTGTAGAGAAGTGGG + Intronic
1005529706 6:26690473-26690495 GAGTGGAGATGGAAAGAAAAGGG + Intergenic
1005541090 6:26811174-26811196 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005907125 6:30272469-30272491 TAGGGGAAATGGGGAGATGTTGG + Intergenic
1005954354 6:30653347-30653369 TACTGGAGATTGAGAGCAGTTGG - Exonic
1006477218 6:34264328-34264350 TAGGGGGAATGGAGAGATGTTGG - Intergenic
1006609570 6:35286098-35286120 GAGTGGAAATAGAGAGAAATGGG - Intronic
1006627590 6:35408387-35408409 GAATGGAGCTGGGGAGAAGTAGG + Intronic
1006856586 6:37137846-37137868 AAATGGAGAGGGAAAGAAGTAGG - Intergenic
1006920750 6:37625655-37625677 GAGGGAAGAGGGAGAGAAGTTGG - Intergenic
1008501307 6:52185678-52185700 TGATGGAGATGGAGAAAAGGGGG - Intergenic
1008718435 6:54318487-54318509 TAGTGAGGATAGAGAGAAGTAGG - Intronic
1008798476 6:55337138-55337160 GAGGAGAAATGGAGAGAAGTTGG - Intronic
1008924064 6:56873723-56873745 GAGGGGAGATGAAGAGAGGTTGG + Intronic
1009011903 6:57853262-57853284 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1009609070 6:65914822-65914844 TAGTGGAGATTGAGAGGAGTTGG - Intergenic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1010016585 6:71111174-71111196 TATTGGAGATGGAGAGAAAATGG - Intergenic
1010116174 6:72315273-72315295 TAGTGAAGATGGTGAGAAGAGGG + Intronic
1010246604 6:73665368-73665390 AAGGGGGGATGAAGAGAAGTTGG + Intergenic
1010538807 6:77064916-77064938 TGGTGGAGATGAAGAGAAACTGG - Intergenic
1011123398 6:83979841-83979863 TCCTGGAGATAGAGAGAAGAAGG - Intergenic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011532152 6:88334546-88334568 TCGTGGAGATAGAGAGTAGAAGG + Intergenic
1011626393 6:89286926-89286948 TACAGGAGCTGGAGAGAAGCTGG - Intronic
1011637789 6:89390520-89390542 TAGTGAAGATGTAGAGAAACTGG + Intronic
1011872634 6:91915617-91915639 TTTTGTAGATGGTGAGAAGTAGG - Intergenic
1012143790 6:95656141-95656163 AAGTGGGGATGGAGAAAAGGTGG - Intergenic
1013060869 6:106632590-106632612 TGGTGAGGATGGAGAAAAGTTGG - Intronic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1013473287 6:110485315-110485337 TGGTGGAGATGTGGAGAAGGTGG - Intergenic
1013687799 6:112605801-112605823 TCGTGGAGATAGAGAGTAGAAGG + Intergenic
1013708806 6:112873111-112873133 TAGTGAGGATGTAGAGAAATAGG + Intergenic
1014339689 6:120188402-120188424 TTGTGGAGACGGAGAGTAGAAGG + Intergenic
1014340326 6:120197530-120197552 GAGTGGAGATGGAAAGCACTAGG + Intergenic
1015179304 6:130344929-130344951 TAGAGGAGATGGAGGGGGGTGGG - Intronic
1015369181 6:132431423-132431445 GAGGGGAGATGAAGAGAGGTTGG - Intergenic
1015510222 6:134031040-134031062 GAGTGGAACTGGAGATAAGTAGG + Intronic
1015598076 6:134885144-134885166 GAGGGGAGATGGAGAGAGGGGGG + Intergenic
1015888661 6:137946864-137946886 AAGTGGAGATGGATACAAGGGGG - Intergenic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016975805 6:149806440-149806462 TAGTAAGGATAGAGAGAAGTGGG + Intronic
1017043464 6:150325920-150325942 CAGGGGAGGTGGTGAGAAGTGGG + Intergenic
1017242107 6:152181906-152181928 TGGTGAAGATGTAGAGAAATTGG - Intronic
1017612846 6:156209473-156209495 GAGGGGAGATGAAGAGAAGCTGG - Intergenic
1018406614 6:163490776-163490798 TGGAAGAGATGGACAGAAGTGGG + Intronic
1019087495 6:169493543-169493565 TAGTGGAAATGGAGAAAAACAGG - Intronic
1019106632 6:169673077-169673099 TGATGGAGATGGAGAGGAGATGG + Intronic
1019241783 6:170670514-170670536 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020393597 7:7687426-7687448 TAGTTTAGCTGGAGAGAATTTGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020790386 7:12620337-12620359 TAGAGGAAATGGAGAAATGTTGG - Intronic
1021354221 7:19634273-19634295 TAGAGAAGATGTAGAGAAATGGG + Intergenic
1021381221 7:19969040-19969062 TGGGGGAGATGGGGAGAGGTTGG - Intergenic
1021545464 7:21808515-21808537 GAGAGGGGATGCAGAGAAGTTGG - Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022097213 7:27148411-27148433 TAGCGGAGAAGGAGAGAATGAGG - Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022552471 7:31254282-31254304 TAGGGGAAATGGAGAGATGTTGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1022965619 7:35468618-35468640 TAGAGGAGGTGGAGAAAAGAGGG - Intergenic
1023206378 7:37754794-37754816 TAGTTGAAATGGGGAGATGTTGG - Intronic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1024089798 7:45925824-45925846 CACTGGAGATGGAGAGACGGAGG + Intergenic
1024313735 7:47994036-47994058 AATTGGAGATGTGGAGAAGTGGG + Intronic
1024316544 7:48024514-48024536 TAGTGGAAATGTAGAGAAATTGG + Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1025061860 7:55816205-55816227 GATTGGGGAGGGAGAGAAGTGGG + Intronic
1027279701 7:76598755-76598777 TAGTGGAGTTGCAGAGAATGGGG + Intergenic
1027279980 7:76602092-76602114 TGGTGGAAATGGATAAAAGTGGG + Intergenic
1027345770 7:77258024-77258046 TATAGGAGATGGAGGGAAGCAGG + Intronic
1027484700 7:78746819-78746841 TAGTGAAAGTGGAGAGAATTGGG - Intronic
1027918078 7:84352236-84352258 TAGTGGAAAGTGGGAGAAGTGGG + Intronic
1028191112 7:87853334-87853356 TAGTGAAGATGTGGAGAAATTGG + Intronic
1028225687 7:88250052-88250074 TCGTGGAGATAGAGAGTAGAAGG - Intergenic
1028573165 7:92314914-92314936 TACTGGAGATGGAAAGAATGAGG + Intronic
1029370386 7:100146584-100146606 TAATGGAGCTGGAGATAACTGGG + Intergenic
1030152325 7:106419926-106419948 TGGTGGTGATGGAATGAAGTGGG - Intergenic
1030350260 7:108476985-108477007 TAGGGGAAATGGAGAGATGTTGG + Intronic
1030594852 7:111525576-111525598 TAGTGGAGATGGATTAAAATGGG + Intronic
1030704561 7:112678091-112678113 AGATGGAGATGGAGAGAACTGGG + Intergenic
1031132102 7:117844355-117844377 AAGTGGAGATGGGGTGAAGCAGG + Intronic
1031150117 7:118044467-118044489 TATTGGTAATGGAGAGAAATAGG + Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032238137 7:130141714-130141736 TGGAGGAGAGGGAGAGCAGTGGG - Intergenic
1032411382 7:131695421-131695443 TGGTGGAGATGGACAGCAGCTGG + Intergenic
1032440896 7:131942215-131942237 TAGTGAAGATGTGGAGAAATTGG + Intergenic
1032610617 7:133408402-133408424 TGATGGAGGTGGAGAGAGGTTGG + Intronic
1032853623 7:135816169-135816191 TGGTTGAGATGCAGAGAAGTGGG + Intergenic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1034523490 7:151639230-151639252 TAGCAGGGATGGAGACAAGTGGG - Intronic
1035506333 8:137582-137604 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1035859662 8:3013984-3014006 TAGTGTAGAGGCAGAGAACTTGG - Intronic
1036175281 8:6531839-6531861 TTATGGAGAAGGAGACAAGTGGG - Intronic
1036561784 8:9904880-9904902 GAGTGGAGATGGAGGTGAGTAGG - Intergenic
1036757639 8:11481783-11481805 CAATGGAGATGGGGAAAAGTGGG + Intergenic
1037030519 8:14098734-14098756 TAATGGAGATGTGGAGAAGAGGG + Intronic
1037037500 8:14185911-14185933 TACTGGACATGGTGAGAATTTGG - Intronic
1037246399 8:16840585-16840607 TAGAAGTGATGAAGAGAAGTTGG + Intergenic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1039158719 8:34592956-34592978 GAGTGGCAATGGAGAGATGTTGG + Intergenic
1039209151 8:35192126-35192148 TGGGGGTGATGGAGAGATGTTGG - Intergenic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1040061382 8:43106127-43106149 TGGTGAAGATGCAGAGAAATGGG - Intronic
1040756911 8:50787353-50787375 TAGTGAGGATGTAGAGAAATTGG + Intronic
1040989326 8:53332674-53332696 TGGTGAGGATGCAGAGAAGTTGG - Intergenic
1041449610 8:57993315-57993337 TACTTGAGAGGGAGAGAAGTTGG + Intergenic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041800051 8:61788936-61788958 TAGGGGAAATGGAGAGATGTTGG - Intergenic
1041878226 8:62715084-62715106 CAGAGGAGAGAGAGAGAAGTAGG + Intronic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1042408099 8:68429399-68429421 TGGTGAAGATGTAGAGAAATGGG + Intronic
1042633086 8:70842844-70842866 TATTGGAGCTGGAGAGAAAAAGG - Intergenic
1042838598 8:73100923-73100945 AATTGGAGATGGAAAGAACTAGG + Intronic
1042955020 8:74240438-74240460 TCATGGAGATGGAGAGTAGAAGG - Intronic
1043149109 8:76691135-76691157 TTGTGGAGATGGTGAAGAGTTGG + Intronic
1043196350 8:77297149-77297171 TAGTAGAGGTGGAAAGAAGCAGG - Intergenic
1043291513 8:78607579-78607601 TAGTGGAGAGGTAGACAAGGAGG - Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044133409 8:88555508-88555530 TGGTGAAGATGTAGAGAAATTGG - Intergenic
1044340055 8:91036542-91036564 TGGTAGAGATGGAGAGATGAAGG - Intronic
1044350765 8:91163558-91163580 AAGTGGAAGTTGAGAGAAGTAGG - Intronic
1044478282 8:92654243-92654265 TAGTAGAGAGGGGGAGAAGAGGG + Intergenic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044833889 8:96277311-96277333 TAGTGGAGATGGTGGGGAGTTGG + Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045370623 8:101518753-101518775 TAGCAGAGATGGAAAGAACTTGG - Intronic
1045530668 8:102982150-102982172 TAGTGTAAGTGGTGAGAAGTTGG + Intergenic
1045696016 8:104809660-104809682 TAGTGGGGATGGTAAGAAGATGG - Intronic
1046079320 8:109352000-109352022 TATTAGTGCTGGAGAGAAGTGGG - Intergenic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046120858 8:109844981-109845003 GAGTGGAGATGAAGAGAGGTTGG - Intergenic
1046323526 8:112610018-112610040 TAGGGGAAATGGTGAGATGTCGG + Intronic
1046428363 8:114086237-114086259 TTATGGAGTAGGAGAGAAGTGGG - Intergenic
1046713837 8:117545622-117545644 TGGGGGAGAGGGAGAGGAGTCGG + Intergenic
1046905902 8:119572893-119572915 TACTGGAAATGGAGTGAAGGTGG + Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047072808 8:121365994-121366016 TCGTGGACATAGAGAGAAGGAGG + Intergenic
1047551567 8:125878487-125878509 TAGTGGAGAGGGAGAGGGGAGGG + Intergenic
1047634485 8:126744996-126745018 CAGTGAAGATGAAGAAAAGTAGG + Intergenic
1047880212 8:129184584-129184606 TGGTGAAGATGTAGAGAAATTGG + Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1048008759 8:130440120-130440142 CAATGGAGGTAGAGAGAAGTGGG - Intronic
1048065140 8:130960114-130960136 CAGTGGAGATGGAGAAACATGGG + Intronic
1048190204 8:132281580-132281602 AGGTGGAGATGGAATGAAGTAGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048667139 8:136674990-136675012 TAGTGGCGATGCAGAAAAGTAGG + Intergenic
1048748983 8:137649606-137649628 AAGAGGAGATGGAAAGAAGGAGG + Intergenic
1049129183 8:140821364-140821386 TAGTGGTGAAGAAGAGAAATGGG + Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049152097 8:141041603-141041625 AAGTGGATGTGGAGAGAGGTGGG + Intergenic
1049299037 8:141860088-141860110 ATGCGGAGATGGAGAGAGGTGGG + Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050085068 9:1956562-1956584 AAGAGGAGATGGAGAGAGGTTGG + Intergenic
1050288008 9:4124002-4124024 TACTGGAGATAAAGAGAAGATGG - Intronic
1050782606 9:9356604-9356626 AAGTAGTGATGGGGAGAAGTAGG + Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1052001518 9:23288013-23288035 TTGTGGAGCAGGAAAGAAGTTGG - Intergenic
1052208564 9:25872672-25872694 TCATGGAGATGGAGAGTAGAAGG - Intergenic
1052658547 9:31398245-31398267 AGGGGGAGATGAAGAGAAGTTGG - Intergenic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1053510116 9:38680569-38680591 GAGTTGAGATGTAGAAAAGTGGG + Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055409799 9:76016935-76016957 TAGTGGAGGTTGGGAGAAGAAGG - Intronic
1056139128 9:83657480-83657502 CAGTGGAGGTGGTAAGAAGTTGG - Intergenic
1056673396 9:88651347-88651369 GAGCAGAGATGGAAAGAAGTGGG + Intergenic
1057919327 9:99083760-99083782 CAGTGGATGTGGTGAGAAGTGGG + Intergenic
1057992902 9:99790807-99790829 TAGGGGAGATAAAGAGAAATTGG - Intergenic
1058115030 9:101075814-101075836 TGGTGTAGATGGAGAGTGGTTGG + Intronic
1058208250 9:102134800-102134822 TACTGGAGAGGGAGAGCATTAGG + Intergenic
1058732292 9:107861922-107861944 AAGAGCAGATGGAGAGAAGTGGG + Intergenic
1058946249 9:109859284-109859306 TAGTGGAGGATGAGAGAGGTTGG + Intronic
1059018190 9:110544900-110544922 TATGGGGGATGAAGAGAAGTTGG - Intronic
1059131361 9:111753893-111753915 TAGGGGAAATGAGGAGAAGTTGG + Intronic
1059378234 9:113902465-113902487 TAGGGGAGGAGCAGAGAAGTTGG - Intronic
1059820652 9:117968659-117968681 TGGGGGAGATGGAGAGAACAAGG + Intergenic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1062703542 9:137921123-137921145 AAGTGCAGATGGAGAAAAGAAGG + Intronic
1203601974 Un_KI270748v1:19748-19770 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1185669524 X:1795007-1795029 AAGTGAGGATGGAGAGACGTTGG - Intergenic
1185922232 X:4106538-4106560 TGGGGGAAATGGAGAGATGTTGG - Intergenic
1186301336 X:8202935-8202957 TAGTGGGGATGGAGAGTATATGG - Intergenic
1186657351 X:11629133-11629155 TGGTGGAGATGGAGGAAAGTAGG - Intronic
1186658721 X:11645736-11645758 AAGAGGAGAAGGAGAGGAGTAGG + Intronic
1186682360 X:11889207-11889229 TAGTGGGGAATGTGAGAAGTTGG - Intergenic
1186710068 X:12184787-12184809 TCGTGGAGATAGAGAGTAGAAGG + Intronic
1187410905 X:19049792-19049814 TAGTGGAGTTGGGGAGGAGAGGG - Intronic
1187454550 X:19429706-19429728 AAGTGTGGATGGAGAGAAGGTGG + Intronic
1187724551 X:22188940-22188962 TCGTGGAGATAGAGAGTAGAAGG - Intronic
1187872618 X:23777094-23777116 TGGTGTAGATGTAGAGAAATTGG + Intergenic
1187918437 X:24177533-24177555 TGGTGGAGGTTGAGAGTAGTTGG - Intronic
1188221880 X:27550662-27550684 GAGGGAAGATGGAGAGAGGTTGG - Intergenic
1188520343 X:31031581-31031603 GAGTGGTGATAGAGAGAAGCAGG + Intergenic
1188642121 X:32519327-32519349 TGGTGGGGGTGGAGAGTAGTTGG + Intronic
1189595441 X:42559992-42560014 TAGTGGAGATAAAGAAAAGCAGG + Intergenic
1189778070 X:44487900-44487922 GAGGGGAGAAGGAGAGAAGCTGG + Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190898402 X:54643806-54643828 TTGTGGAGGTAGAGAGTAGTAGG - Intergenic
1191000251 X:55652347-55652369 TAAAGGAGATAGGGAGAAGTGGG - Intergenic
1191053189 X:56216143-56216165 AAGTGAAGATGAAGAGAAGTAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191219506 X:57972724-57972746 TTGTTGATATGGAGAGAAATGGG + Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192571461 X:72209604-72209626 TAGTAGAGATGGAAAGAAGGTGG - Intronic
1192655495 X:72989070-72989092 TAGTAGAGATAGAGAGTACTTGG + Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1193671466 X:84391583-84391605 TAGTGAGGATGCAGAGAAATAGG - Intronic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1193842392 X:86422848-86422870 TCATGGAGATGGAGAGTAGAAGG - Intronic
1193951572 X:87807302-87807324 TAATGGAGATGGAGAGTAATAGG - Intergenic
1195003091 X:100661126-100661148 TTGTGAAGATGGAGAGAAACTGG - Intronic
1195084366 X:101400366-101400388 TAGTGAAGATGGAAGGAAGTGGG + Intronic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195418123 X:104642150-104642172 GAAAGGAGAGGGAGAGAAGTAGG - Intronic
1195598918 X:106724254-106724276 TAGTGGACATGAAGAGAAGTGGG - Intronic
1195824040 X:108977836-108977858 TAGTGCGGTTGGGGAGAAGTGGG + Intergenic
1195910064 X:109880450-109880472 CAGAGGAGATGGGGAGAAGCAGG - Intergenic
1196227479 X:113183446-113183468 TAGGGGTGATGGGGAGATGTAGG + Intergenic
1196560128 X:117136469-117136491 GAGAGGAGATGAAGAGAGGTTGG - Intergenic
1196575227 X:117309312-117309334 TAGAGGGGATGAAGAGAGGTTGG + Intergenic
1196666547 X:118323179-118323201 TAGTGGACTTGGAAAGAAGTTGG - Intergenic
1196893892 X:120314501-120314523 TGAAGAAGATGGAGAGAAGTAGG - Intergenic
1196903224 X:120407134-120407156 AAGTGGGGATGGATAGAAATGGG - Intergenic
1197452163 X:126632785-126632807 TCATGGAGATGGAGAGAAGAAGG - Intergenic
1197867230 X:131032255-131032277 GAGGGGAAATGGAGAGATGTTGG - Intergenic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198316013 X:135467201-135467223 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1199099230 X:143779471-143779493 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1199128768 X:144159028-144159050 TAATGGAGATAGAGAGTAGGAGG + Intergenic
1199195421 X:145023807-145023829 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1199226100 X:145376536-145376558 TAGTAGAGATGGAGACAAGGAGG + Intergenic
1199259783 X:145758986-145759008 AAGTGGACAGGGAGAGAAGCAGG + Intergenic
1199475029 X:148235783-148235805 TAGAGGAGATGAAGAAAAGTAGG - Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1199784112 X:151089140-151089162 TAGTGGATATTGAGAGAAATTGG - Intergenic
1200722711 Y:6626230-6626252 TGGGGGAGATGGAAAGAAGGAGG + Intergenic
1200754546 Y:6977819-6977841 TAATGCAGAAGGAGAGAACTGGG + Intronic
1200945213 Y:8828811-8828833 TGGTAGAGATGGTGAGAAGTGGG + Intergenic
1201663801 Y:16426790-16426812 TAGGGAAGAAGGAGAGAAATGGG - Intergenic