ID: 1021629042

View in Genome Browser
Species Human (GRCh38)
Location 7:22625476-22625498
Sequence CCCTGTCAGCAGAGGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021629035_1021629042 10 Left 1021629035 7:22625443-22625465 CCCTGGGAATTGCTAAGCTTCCT 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1021629042 7:22625476-22625498 CCCTGTCAGCAGAGGCAGAGAGG No data
1021629038_1021629042 -10 Left 1021629038 7:22625463-22625485 CCTTTGGTCTCTCCCCTGTCAGC 0: 1
1: 0
2: 1
3: 20
4: 290
Right 1021629042 7:22625476-22625498 CCCTGTCAGCAGAGGCAGAGAGG No data
1021629036_1021629042 9 Left 1021629036 7:22625444-22625466 CCTGGGAATTGCTAAGCTTCCTT 0: 1
1: 0
2: 1
3: 23
4: 160
Right 1021629042 7:22625476-22625498 CCCTGTCAGCAGAGGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021629042 Original CRISPR CCCTGTCAGCAGAGGCAGAG AGG Intronic
No off target data available for this crispr