ID: 1021632935 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:22664743-22664765 |
| Sequence | GGATGCTCCGAACTACACCG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1021632935_1021632944 | 27 | Left | 1021632935 | 7:22664743-22664765 | CCCCGGTGTAGTTCGGAGCATCC | No data | ||
| Right | 1021632944 | 7:22664793-22664815 | AGTGATTGAAAGCCAGGCACTGG | No data | ||||
| 1021632935_1021632943 | 21 | Left | 1021632935 | 7:22664743-22664765 | CCCCGGTGTAGTTCGGAGCATCC | No data | ||
| Right | 1021632943 | 7:22664787-22664809 | CAATGTAGTGATTGAAAGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1021632935 | Original CRISPR | GGATGCTCCGAACTACACCG GGG (reversed) | Intergenic | ||