ID: 1021632935

View in Genome Browser
Species Human (GRCh38)
Location 7:22664743-22664765
Sequence GGATGCTCCGAACTACACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021632935_1021632944 27 Left 1021632935 7:22664743-22664765 CCCCGGTGTAGTTCGGAGCATCC No data
Right 1021632944 7:22664793-22664815 AGTGATTGAAAGCCAGGCACTGG No data
1021632935_1021632943 21 Left 1021632935 7:22664743-22664765 CCCCGGTGTAGTTCGGAGCATCC No data
Right 1021632943 7:22664787-22664809 CAATGTAGTGATTGAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021632935 Original CRISPR GGATGCTCCGAACTACACCG GGG (reversed) Intergenic