ID: 1021641779

View in Genome Browser
Species Human (GRCh38)
Location 7:22744574-22744596
Sequence CACAGCACTGTGTGGTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021641776_1021641779 15 Left 1021641776 7:22744536-22744558 CCAGAGGCAACATTACTGGTCAA No data
Right 1021641779 7:22744574-22744596 CACAGCACTGTGTGGTGGTGTGG No data
1021641774_1021641779 25 Left 1021641774 7:22744526-22744548 CCAAGATTTGCCAGAGGCAACAT 0: 19
1: 16
2: 16
3: 31
4: 153
Right 1021641779 7:22744574-22744596 CACAGCACTGTGTGGTGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021641779 Original CRISPR CACAGCACTGTGTGGTGGTG TGG Intergenic
No off target data available for this crispr