ID: 1021642406

View in Genome Browser
Species Human (GRCh38)
Location 7:22751963-22751985
Sequence GATGCTGTTGCCCCAAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021642406_1021642408 18 Left 1021642406 7:22751963-22751985 CCAAAATTTGGGGCAACAGCATC No data
Right 1021642408 7:22752004-22752026 TTAATGATCGCCATTCTAACTGG 0: 5197
1: 15176
2: 5986
3: 5036
4: 6665
1021642406_1021642410 28 Left 1021642406 7:22751963-22751985 CCAAAATTTGGGGCAACAGCATC No data
Right 1021642410 7:22752014-22752036 CCATTCTAACTGGAATGAGATGG 0: 20
1: 2185
2: 16799
3: 8439
4: 5264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021642406 Original CRISPR GATGCTGTTGCCCCAAATTT TGG (reversed) Intergenic
No off target data available for this crispr