ID: 1021642675

View in Genome Browser
Species Human (GRCh38)
Location 7:22755331-22755353
Sequence CAATATCAGCCAGTCTTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021642675_1021642680 12 Left 1021642675 7:22755331-22755353 CCTATGAAGACTGGCTGATATTG No data
Right 1021642680 7:22755366-22755388 TATAAGCCAGGGAATACCAAGGG No data
1021642675_1021642683 29 Left 1021642675 7:22755331-22755353 CCTATGAAGACTGGCTGATATTG No data
Right 1021642683 7:22755383-22755405 CAAGGGTTGCCAACAACTACTGG No data
1021642675_1021642679 11 Left 1021642675 7:22755331-22755353 CCTATGAAGACTGGCTGATATTG No data
Right 1021642679 7:22755365-22755387 CTATAAGCCAGGGAATACCAAGG No data
1021642675_1021642677 0 Left 1021642675 7:22755331-22755353 CCTATGAAGACTGGCTGATATTG No data
Right 1021642677 7:22755354-22755376 GAGAGAAGCATCTATAAGCCAGG No data
1021642675_1021642678 1 Left 1021642675 7:22755331-22755353 CCTATGAAGACTGGCTGATATTG No data
Right 1021642678 7:22755355-22755377 AGAGAAGCATCTATAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021642675 Original CRISPR CAATATCAGCCAGTCTTCAT AGG (reversed) Intergenic