ID: 1021642683

View in Genome Browser
Species Human (GRCh38)
Location 7:22755383-22755405
Sequence CAAGGGTTGCCAACAACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021642675_1021642683 29 Left 1021642675 7:22755331-22755353 CCTATGAAGACTGGCTGATATTG No data
Right 1021642683 7:22755383-22755405 CAAGGGTTGCCAACAACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021642683 Original CRISPR CAAGGGTTGCCAACAACTAC TGG Intergenic