ID: 1021644456

View in Genome Browser
Species Human (GRCh38)
Location 7:22774936-22774958
Sequence CTGTACACCTAGCTGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021644456_1021644467 29 Left 1021644456 7:22774936-22774958 CCATGTCCCAGCTAGGTGTACAG No data
Right 1021644467 7:22774988-22775010 GGATGCCACATAAGGAAGAATGG No data
1021644456_1021644462 8 Left 1021644456 7:22774936-22774958 CCATGTCCCAGCTAGGTGTACAG No data
Right 1021644462 7:22774967-22774989 GGCCTGGAGCCAGGCCATTCTGG No data
1021644456_1021644460 -8 Left 1021644456 7:22774936-22774958 CCATGTCCCAGCTAGGTGTACAG No data
Right 1021644460 7:22774951-22774973 GTGTACAGATGCTATTGGCCTGG No data
1021644456_1021644468 30 Left 1021644456 7:22774936-22774958 CCATGTCCCAGCTAGGTGTACAG No data
Right 1021644468 7:22774989-22775011 GATGCCACATAAGGAAGAATGGG No data
1021644456_1021644465 21 Left 1021644456 7:22774936-22774958 CCATGTCCCAGCTAGGTGTACAG No data
Right 1021644465 7:22774980-22775002 GCCATTCTGGATGCCACATAAGG No data
1021644456_1021644461 -1 Left 1021644456 7:22774936-22774958 CCATGTCCCAGCTAGGTGTACAG No data
Right 1021644461 7:22774958-22774980 GATGCTATTGGCCTGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021644456 Original CRISPR CTGTACACCTAGCTGGGACA TGG (reversed) Intergenic
No off target data available for this crispr