ID: 1021645037

View in Genome Browser
Species Human (GRCh38)
Location 7:22781707-22781729
Sequence TTGGCCAGTGCCTGGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021645037_1021645042 2 Left 1021645037 7:22781707-22781729 CCTTCCATCCAGGCACTGGCCAA No data
Right 1021645042 7:22781732-22781754 AAGCTGTATTTGCTTGGCTCTGG No data
1021645037_1021645041 -4 Left 1021645037 7:22781707-22781729 CCTTCCATCCAGGCACTGGCCAA No data
Right 1021645041 7:22781726-22781748 CCAAAAAAGCTGTATTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021645037 Original CRISPR TTGGCCAGTGCCTGGATGGA AGG (reversed) Intergenic
No off target data available for this crispr