ID: 1021646394

View in Genome Browser
Species Human (GRCh38)
Location 7:22793741-22793763
Sequence CTTTCCAAACTGATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021646394_1021646397 17 Left 1021646394 7:22793741-22793763 CCATGTTTCATCAGTTTGGAAAG No data
Right 1021646397 7:22793781-22793803 CACATGACTCAGCAAAGGTATGG No data
1021646394_1021646400 27 Left 1021646394 7:22793741-22793763 CCATGTTTCATCAGTTTGGAAAG No data
Right 1021646400 7:22793791-22793813 AGCAAAGGTATGGACAAAAGGGG No data
1021646394_1021646398 25 Left 1021646394 7:22793741-22793763 CCATGTTTCATCAGTTTGGAAAG No data
Right 1021646398 7:22793789-22793811 TCAGCAAAGGTATGGACAAAAGG No data
1021646394_1021646396 12 Left 1021646394 7:22793741-22793763 CCATGTTTCATCAGTTTGGAAAG No data
Right 1021646396 7:22793776-22793798 GATAACACATGACTCAGCAAAGG No data
1021646394_1021646399 26 Left 1021646394 7:22793741-22793763 CCATGTTTCATCAGTTTGGAAAG No data
Right 1021646399 7:22793790-22793812 CAGCAAAGGTATGGACAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021646394 Original CRISPR CTTTCCAAACTGATGAAACA TGG (reversed) Intergenic
No off target data available for this crispr