ID: 1021647179

View in Genome Browser
Species Human (GRCh38)
Location 7:22799861-22799883
Sequence GGTAATTGCAGTCCTGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021647179_1021647183 5 Left 1021647179 7:22799861-22799883 CCTTGGCCAGGACTGCAATTACC No data
Right 1021647183 7:22799889-22799911 TGACTAACAGTGAAAAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021647179 Original CRISPR GGTAATTGCAGTCCTGGCCA AGG (reversed) Intergenic
No off target data available for this crispr