ID: 1021647706

View in Genome Browser
Species Human (GRCh38)
Location 7:22802545-22802567
Sequence CAGGGGGAGGAGAAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021647706_1021647725 19 Left 1021647706 7:22802545-22802567 CCAGCCCCCTTCTCCTCCCCCTG No data
Right 1021647725 7:22802587-22802609 AAGGGTGCCAGGAGGCAGACTGG No data
1021647706_1021647720 1 Left 1021647706 7:22802545-22802567 CCAGCCCCCTTCTCCTCCCCCTG No data
Right 1021647720 7:22802569-22802591 TGCTAAGGCGCATGGCCCAAGGG No data
1021647706_1021647715 -7 Left 1021647706 7:22802545-22802567 CCAGCCCCCTTCTCCTCCCCCTG No data
Right 1021647715 7:22802561-22802583 CCCCCTGGTGCTAAGGCGCATGG No data
1021647706_1021647721 8 Left 1021647706 7:22802545-22802567 CCAGCCCCCTTCTCCTCCCCCTG No data
Right 1021647721 7:22802576-22802598 GCGCATGGCCCAAGGGTGCCAGG No data
1021647706_1021647722 11 Left 1021647706 7:22802545-22802567 CCAGCCCCCTTCTCCTCCCCCTG No data
Right 1021647722 7:22802579-22802601 CATGGCCCAAGGGTGCCAGGAGG No data
1021647706_1021647719 0 Left 1021647706 7:22802545-22802567 CCAGCCCCCTTCTCCTCCCCCTG No data
Right 1021647719 7:22802568-22802590 GTGCTAAGGCGCATGGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021647706 Original CRISPR CAGGGGGAGGAGAAGGGGGC TGG (reversed) Intergenic
No off target data available for this crispr