ID: 1021656902

View in Genome Browser
Species Human (GRCh38)
Location 7:22881706-22881728
Sequence AAGAAAGACTGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021656902_1021656913 17 Left 1021656902 7:22881706-22881728 CCCTCTTCCCTCCAGTCTTTCTT No data
Right 1021656913 7:22881746-22881768 CCTCAAACGTTCTCTTTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021656902 Original CRISPR AAGAAAGACTGGAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr