ID: 1021663182

View in Genome Browser
Species Human (GRCh38)
Location 7:22942524-22942546
Sequence AACGGCCTGGAGTATTCTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021663182_1021663188 -3 Left 1021663182 7:22942524-22942546 CCACCAGAATACTCCAGGCCGTT 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1021663188 7:22942544-22942566 GTTGGGTTTTCAAATGTGAGAGG 0: 1
1: 0
2: 2
3: 21
4: 231
1021663182_1021663189 1 Left 1021663182 7:22942524-22942546 CCACCAGAATACTCCAGGCCGTT 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1021663189 7:22942548-22942570 GGTTTTCAAATGTGAGAGGTTGG 0: 1
1: 0
2: 3
3: 25
4: 234
1021663182_1021663190 2 Left 1021663182 7:22942524-22942546 CCACCAGAATACTCCAGGCCGTT 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1021663190 7:22942549-22942571 GTTTTCAAATGTGAGAGGTTGGG 0: 1
1: 0
2: 0
3: 25
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021663182 Original CRISPR AACGGCCTGGAGTATTCTGG TGG (reversed) Exonic
901954172 1:12771939-12771961 AAAGGCCTGGAGGATTCTCTGGG + Intergenic
903767490 1:25744076-25744098 AAGGGCCTGGAAGAATCTGGGGG - Intronic
905619223 1:39427677-39427699 AACTGCCTGCAGCATTCTAGAGG + Intronic
908763317 1:67532051-67532073 ATCACCCTGGATTATTCTGGTGG + Intergenic
910865392 1:91783606-91783628 AACTTCCTGTAGGATTCTGGTGG + Intronic
920153232 1:203926494-203926516 AACTGCCTACAGTATTCTGTAGG - Intergenic
1065178708 10:23104031-23104053 AAGGGACTGGATTATTCTGCTGG + Intronic
1072977745 10:100074039-100074061 AATAACCTGGAGTATTGTGGGGG - Intronic
1074087902 10:110222569-110222591 ATAGGCCTGGGGTATTCTGGGGG + Intronic
1075024600 10:118975324-118975346 AACAGCCTGGATTATCCAGGTGG - Intergenic
1077279271 11:1734750-1734772 CAGGGCCTGGAGAAGTCTGGAGG - Exonic
1078571548 11:12462299-12462321 ATTGGCCTGGATTATTCAGGTGG + Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1092773898 12:11924517-11924539 AATTGCCAGGAGAATTCTGGGGG + Intergenic
1101152947 12:101900721-101900743 AACGGGCTGGAGCAATTTGGAGG + Intronic
1101714621 12:107299946-107299968 AACGGTCATGAGTATTTTGGGGG - Intergenic
1103567158 12:121822656-121822678 AGAGGCCTGGAGTATGCGGGGGG - Exonic
1104743307 12:131194416-131194438 AAAGGCCTGGTGGATTCAGGGGG + Intergenic
1107187987 13:37546683-37546705 AATGGGCTGCAGTATACTGGTGG + Intergenic
1108156269 13:47588283-47588305 ACCATCCTGGACTATTCTGGAGG + Intergenic
1112733868 13:102396056-102396078 AAGGGCATGGAGTTTTCTGAGGG - Intronic
1113240935 13:108336179-108336201 AACTGACTGGTGTTTTCTGGAGG - Intergenic
1125134687 15:36328175-36328197 AATGGCCTAGACTATTTTGGAGG + Intergenic
1132108465 15:99084307-99084329 AACGGAATGGAGTTTTTTGGGGG + Intergenic
1134168290 16:11948021-11948043 AACGGGCTGGAGAATGCAGGGGG - Intronic
1135113783 16:19709627-19709649 AAGGGCCTGGAGTGATCTGTAGG - Intronic
1135912480 16:26574047-26574069 ATCGTCCTGGATTATCCTGGTGG + Intergenic
1142438941 16:90082035-90082057 CATGGCCCGGAGTAATCTGGAGG + Intronic
1144477031 17:15597271-15597293 AACTGCCTGGCATATTCTAGTGG + Intronic
1144791411 17:17861433-17861455 TTCTGCCTGGAGTCTTCTGGAGG - Intronic
1147112981 17:38277519-38277541 AATGGCCTGGATCATTCTGGGGG - Intergenic
1148130659 17:45260895-45260917 AAAGGCCTGCGGTACTCTGGGGG - Intronic
1148416641 17:47511708-47511730 AATGGCCTGGATCAGTCTGGGGG + Intergenic
1150273297 17:63880618-63880640 AAAGGCCTGGAGGATTCACGAGG + Exonic
1150277612 17:63910008-63910030 AAAGGCCTGGAGGATTCACGAGG + Intronic
1150278904 17:63917606-63917628 AAAGGCCTGGAGGATTCACGAGG + Intronic
1150388095 17:64776130-64776152 ATGGGCCTGGAGGATTATGGTGG + Intergenic
1154103637 18:11500260-11500282 AACAGGCTGGATTATTCAGGAGG + Intergenic
1165391290 19:35540375-35540397 GAGGGCCTGGGGTCTTCTGGGGG + Intronic
926362478 2:12102834-12102856 TACGGCCTGCAGGATTCTGAGGG - Intergenic
927917381 2:26945780-26945802 CACAGCCTGGAGTTTACTGGGGG + Intronic
933304257 2:80577617-80577639 CCTGGCCTGGATTATTCTGGAGG - Intronic
935320708 2:101886310-101886332 AACAGCCTGGATTGTGCTGGTGG - Intronic
938436611 2:131286982-131287004 AAGGGGGTGGAGGATTCTGGAGG - Intronic
947460176 2:230297487-230297509 AAAGGAGTGGAATATTCTGGGGG - Intronic
948296395 2:236863835-236863857 ATGGGCCTGGAGGACTCTGGAGG + Intergenic
948953453 2:241270312-241270334 ACCAGTCTGGAGTTTTCTGGAGG - Intronic
1176187913 20:63791601-63791623 AACGAGCTGAAGTCTTCTGGAGG + Intronic
1181387076 22:22554203-22554225 AATGGCCTGGAGAATTCTTTGGG - Intronic
1183864406 22:40692832-40692854 AACGGCCTGGATTAGGGTGGTGG + Intergenic
1184806908 22:46800958-46800980 ACCCACCTGGAGCATTCTGGAGG + Intronic
950303102 3:11898926-11898948 CACAGCCTGGGGTATTCTGAAGG - Intergenic
950538790 3:13597670-13597692 CACGACCCTGAGTATTCTGGTGG - Intronic
950933616 3:16816048-16816070 AACAGTTTGGAGTATTTTGGGGG - Intronic
954081738 3:48216275-48216297 AGAGGACTGGAGTATTCAGGAGG + Intergenic
955057187 3:55465332-55465354 AACCACCTGGAATATTCTGCAGG - Intergenic
956961736 3:74410766-74410788 AACAGGCTGGTGTTTTCTGGTGG - Intronic
975961040 4:79905748-79905770 AAAGGACGGGAGTATTCTGTTGG - Intronic
979018533 4:115465813-115465835 AATGGCCTGGAGTCTTGTGATGG + Intergenic
985856121 5:2428931-2428953 GAGGTCCTGGAGAATTCTGGAGG - Intergenic
996700642 5:126447243-126447265 AAAGGCCAGGAGTTTTCTGCTGG - Intronic
998205164 5:140152587-140152609 AACGGTCTGGAGAATCCTTGAGG - Intergenic
1008217129 6:48806479-48806501 GCTGGCCTGCAGTATTCTGGAGG + Intergenic
1009890740 6:69678092-69678114 AATAGCCTGGTGTTTTCTGGAGG + Intronic
1011338553 6:86286528-86286550 AAGGGCCTGCAGTCTTTTGGGGG - Intergenic
1019328603 7:451958-451980 AGCGGCCTGGAGGTCTCTGGGGG + Intergenic
1019358716 7:594214-594236 AATGGCCTGGTGTCTTCTAGGGG - Intronic
1020032794 7:4944583-4944605 GCCGGGCTGGACTATTCTGGTGG - Intronic
1020875688 7:13690918-13690940 AACTGCCTGCATTATTCTGTTGG - Intergenic
1021663182 7:22942524-22942546 AACGGCCTGGAGTATTCTGGTGG - Exonic
1028162431 7:87500587-87500609 ATCATCCTGGATTATTCTGGTGG - Intergenic
1032892934 7:136219197-136219219 AACTGCCTGCAGTGTCCTGGAGG - Intergenic
1036384673 8:8268832-8268854 AAAGGCTTTGAGTATGCTGGGGG - Intergenic
1036794973 8:11749247-11749269 GACAGCCTGGATCATTCTGGTGG - Intronic
1039840050 8:41286595-41286617 GATGGCCTGGAGCATTCTAGTGG - Intronic
1047698472 8:127427126-127427148 AACTGCCTTGAGGTTTCTGGAGG - Intergenic
1048208288 8:132433117-132433139 AACCTCCTGGAGAATTCAGGAGG - Intronic
1048219355 8:132527167-132527189 AACAACCTGGAGAATGCTGGAGG + Intergenic
1052322175 9:27179940-27179962 AAAGACCTGGAAGATTCTGGAGG - Intronic
1053667152 9:40324467-40324489 CAGGGGCTGGAGGATTCTGGAGG - Intronic
1054378298 9:64464495-64464517 CAGGGGCTGGAGGATTCTGGAGG - Intergenic
1054517458 9:66051816-66051838 CAGGGGCTGGAGGATTCTGGAGG + Intergenic
1057175263 9:92992700-92992722 TACTGCCTGGAGCATTCTGGAGG + Intronic
1061503381 9:131016475-131016497 AAAGGCCAGGAATATTCTTGTGG - Intronic
1189226908 X:39420635-39420657 CAGGGCCTGGAATATTATGGGGG - Intergenic
1190994057 X:55587306-55587328 ATTGGCCTGTAGTTTTCTGGTGG - Intergenic
1192167736 X:68836266-68836288 AAATGCCTGGAGAATTCTAGAGG + Intronic
1193549667 X:82875608-82875630 CACTGCCAGGAGTAATCTGGTGG - Intergenic
1195734024 X:107994903-107994925 AAAGGCCTGGATTACTTTGGGGG - Intergenic
1199883119 X:151992123-151992145 AAGGGTATGGAGTATTTTGGGGG + Intergenic
1200697886 Y:6377074-6377096 AACGGCCTGAAGTGGTCTTGGGG - Intergenic
1201036226 Y:9787625-9787647 AACGGCCTGAAGTGGTCTTGGGG + Intergenic