ID: 1021667400

View in Genome Browser
Species Human (GRCh38)
Location 7:22998649-22998671
Sequence CTGTGGAGATGGAGAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 786
Summary {0: 1, 1: 0, 2: 17, 3: 105, 4: 663}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021667400_1021667404 -5 Left 1021667400 7:22998649-22998671 CCATCTGCTCTCCATCTCCACAG 0: 1
1: 0
2: 17
3: 105
4: 663
Right 1021667404 7:22998667-22998689 CACAGCAACGCCCTGAGTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 145
1021667400_1021667403 -6 Left 1021667400 7:22998649-22998671 CCATCTGCTCTCCATCTCCACAG 0: 1
1: 0
2: 17
3: 105
4: 663
Right 1021667403 7:22998666-22998688 CCACAGCAACGCCCTGAGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021667400 Original CRISPR CTGTGGAGATGGAGAGCAGA TGG (reversed) Intronic
900146142 1:1159608-1159630 CTGTGGACATGGAGAGTGGCGGG - Intergenic
900236641 1:1594749-1594771 CCATGGAGCTGGAGCGCAGATGG - Intergenic
900726932 1:4222669-4222691 CTGTGACGATGGAGTGCAGGAGG + Intergenic
900802324 1:4745089-4745111 CTGTGGAGGGGAAGAGCAGCTGG - Intronic
900943778 1:5817866-5817888 CTGTGGAGCTGGACAGATGAGGG - Intergenic
901150455 1:7097805-7097827 CTCTGGAGATGGAAAGTAGATGG + Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902070982 1:13737415-13737437 CAGTGGTGATGGAGACCATATGG + Intronic
902190748 1:14761348-14761370 CTGAGGTGATAGAGAACAGAGGG - Intronic
902450038 1:16491092-16491114 ATGTGGGGATGGGGAGCTGATGG + Intergenic
902632386 1:17712851-17712873 CTGAGGAGATGGAATGCAGATGG + Intergenic
902973403 1:20071538-20071560 CTGTGAAGAGAGAGAGCACACGG + Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903573073 1:24320689-24320711 CTGTGAACATGAAGAGCTGAAGG - Intronic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
903673702 1:25051561-25051583 AGGTGGAGGTGGAGTGCAGAGGG - Intergenic
903930408 1:26858846-26858868 CAGTGGAGGTAGAGAGCAAATGG + Intergenic
904461529 1:30683605-30683627 CTCTGGAAATGGAGAGCATCTGG - Intergenic
905120630 1:35679246-35679268 CTGTGGAGAGGCAGACCAGGAGG - Intergenic
905223699 1:36466201-36466223 CTATGGAGATTGGGAGGAGAGGG + Exonic
905304939 1:37011079-37011101 CTCTGGAGTTGGAAAGCACATGG - Intronic
905473204 1:38208169-38208191 CTGCTGGGATGGAGACCAGAGGG + Intergenic
905878236 1:41447188-41447210 TTCTGGGGAAGGAGAGCAGAAGG - Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906160569 1:43646140-43646162 CTGTGTAGAATGAGAGAAGAGGG + Intergenic
906666315 1:47624596-47624618 CTATGGGGAAGGAGAGCAAAGGG - Intergenic
906819485 1:48914127-48914149 CTGTGGAGAACGAGAAGAGAAGG + Intronic
907528640 1:55070549-55070571 CTGCTGAGTTGGAGAGAAGAGGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
908644835 1:66266015-66266037 CTGTGGAGACAGAGAAAAGAAGG - Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
910655472 1:89614125-89614147 CTCAGGAGTTGGAGAGCAGCTGG - Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
911001041 1:93165943-93165965 TTATGGAGATAGAGAGTAGAAGG - Intronic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
911968110 1:104393894-104393916 TTGTGTAGATGGAGAGTAGAAGG + Intergenic
912582565 1:110734005-110734027 ATGGGGAGGTGGAGAGGAGAAGG + Intergenic
912606530 1:110995594-110995616 TTATGGAGATAGAGAGTAGAAGG - Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916029418 1:160863093-160863115 TTGTGGAGGTGGAGTGGAGAGGG + Intergenic
916146220 1:161742478-161742500 TTATGGAGATAGAGAGTAGAAGG + Intergenic
916395995 1:164387868-164387890 CTTTGGAGATGAAGAGCTCAAGG - Intergenic
916401754 1:164457105-164457127 TTATGGAGATAGAGAGTAGAAGG + Intergenic
916435063 1:164770392-164770414 CTGAGGAGTTGGAGCACAGAAGG - Intronic
916489065 1:165285615-165285637 CAGTGGAGATGGTGAACAGCTGG - Intronic
916670688 1:167016944-167016966 CCATGGAGATAGAGAGTAGAAGG + Intronic
916755076 1:167761636-167761658 CTAGGGAAATGGAAAGCAGATGG + Intronic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
916825077 1:168435244-168435266 CTGGGGGGATGGAGAGCAACAGG - Intergenic
916993160 1:170266503-170266525 TTATGGAGATAGAGAGTAGAAGG - Intergenic
917225908 1:172782064-172782086 TTATGGAGATAGAGAGTAGAAGG - Intergenic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918445049 1:184609124-184609146 CTCTGGAGAGGGAGAGGTGAGGG - Intronic
918656862 1:187037654-187037676 TTGTGGTAATTGAGAGCAGAAGG - Intergenic
919148923 1:193669952-193669974 TTGTGGAGATAGACAGTAGAAGG - Intergenic
919272383 1:195364605-195364627 TTGTGGACATAGAGAGTAGAAGG + Intergenic
919479858 1:198074944-198074966 CTGTAGAGAAGGAGTGCTGATGG + Intergenic
919830324 1:201536394-201536416 CTGTGGAGGAGGGGAACAGAGGG + Intergenic
920180175 1:204127550-204127572 CTTTGAGGATGGAGAGAAGACGG - Exonic
920265029 1:204715397-204715419 CTTTGGAGATGCAAATCAGAAGG + Intergenic
920550172 1:206854047-206854069 CCATGGAGATAGAGAGTAGAAGG + Intergenic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
920716759 1:208347332-208347354 CAGAGGAGATGGAGAACAGCTGG + Intergenic
921226425 1:213024595-213024617 CTTGGGAGATGGAGAGAAAAGGG - Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
923264841 1:232304456-232304478 CCCTGGAGATAGAGAGCAAATGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923467442 1:234261951-234261973 CTGTGGAGATAGAAAGGTGAAGG - Intronic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
924133735 1:240940372-240940394 CTGTGGATCTGGAGACCAGGTGG - Intronic
924789647 1:247233404-247233426 CCATGGAGATAGAGAGTAGAAGG + Intergenic
924811022 1:247402160-247402182 CTGATGAGATGGAGAGGTGAAGG + Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063836189 10:10016172-10016194 TCGTGGAGATAGAGAGTAGAAGG - Intergenic
1063972474 10:11390853-11390875 CAATGGAGATAGAGAGTAGAAGG + Intergenic
1064833072 10:19493191-19493213 TTATAGAGATGGAGAGGAGAAGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065787569 10:29230383-29230405 CTGTGGAGATAGGAGGCAGAGGG - Intergenic
1065978316 10:30863836-30863858 CGGTGGAAGTGGAGAGCACAAGG - Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069701308 10:70428434-70428456 GTGTGTGGATGGATAGCAGAGGG + Exonic
1069746027 10:70715575-70715597 CTGCTGAGGTGGAGAGCTGAAGG + Intronic
1069800847 10:71080602-71080624 ATGTGATGATGGAAAGCAGATGG - Intergenic
1070640423 10:78164944-78164966 CTGTCCATATGGACAGCAGAAGG - Intergenic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1072076188 10:91976413-91976435 CTCTGGAGGTGGGGAGCAGGAGG + Intronic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072354637 10:94595347-94595369 ATATGTAGATGAAGAGCAGATGG + Intronic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1072920290 10:99571139-99571161 CCATGGAGATAGAGAGTAGAAGG + Intergenic
1073328844 10:102657900-102657922 CTGGGAAGATGGTGAGGAGAAGG - Exonic
1073848327 10:107585486-107585508 CTGTGGAGAGGGGGCCCAGAAGG + Intergenic
1074658487 10:115622003-115622025 GTGTGGAAGGGGAGAGCAGAGGG + Intronic
1075122143 10:119672164-119672186 CTGAGGAGGTGCACAGCAGAAGG + Intronic
1075960891 10:126567036-126567058 CTGTGAACATGGAGCTCAGAGGG + Intronic
1076377171 10:129998963-129998985 TTATGGAGATAGAGAGTAGAAGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1077470658 11:2758848-2758870 CTGTAGGGATGGAGATCAGATGG + Intronic
1077475453 11:2788192-2788214 CTGTGGAGAAGGAGCCCAGGAGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078597621 11:12702056-12702078 CTGTGTAAATGGAGAGCTGAAGG + Intronic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1082131459 11:48494869-48494891 CTGTGTATTTGAAGAGCAGATGG + Intergenic
1083378051 11:62242218-62242240 CTGTGGAGCTGCAGAGCCCAGGG - Exonic
1083533290 11:63445027-63445049 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1083725017 11:64623386-64623408 CCTTGGAGCTGGAGAGGAGAGGG - Intronic
1083883663 11:65560298-65560320 TGGTGGAGAGGGAGAGCCGAAGG + Intergenic
1084018638 11:66403346-66403368 ATGTGAAGATAGAGAGAAGAAGG + Intergenic
1084030525 11:66478095-66478117 TTCTGGAGATGAAGAGAAGAAGG + Intergenic
1084138637 11:67207812-67207834 CTGAGGAGTTTGAGAGCAGCCGG + Intronic
1084515133 11:69633911-69633933 CTGTGAAGATGCAGGGCAGGTGG + Intergenic
1085305325 11:75482517-75482539 CTGTGGGGATGGCGAGAAAAGGG - Intronic
1085553745 11:77400487-77400509 CAGTGCAGATGGGTAGCAGATGG - Intronic
1085858136 11:80198977-80198999 CTATGGAGAGGGAGAGATGAGGG - Intergenic
1085948747 11:81304240-81304262 GTGGGGGGATGGAGAGCATAGGG - Intergenic
1086286395 11:85256342-85256364 ATGGGGAGCTGGAAAGCAGATGG - Intronic
1086952419 11:92904875-92904897 CTTTCAAGATGGAGAGCTGAGGG + Intergenic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1087416768 11:97866523-97866545 CCATGGAGATAGAGAGTAGAAGG - Intergenic
1087653261 11:100892939-100892961 CACTGGAGATGGAGAACAGGTGG + Intronic
1088551949 11:111022159-111022181 CTGTGCACTTGGAAAGCAGATGG - Intergenic
1088755122 11:112879146-112879168 CTGTTGTGATGGACAGCGGAAGG + Intergenic
1088913273 11:114208123-114208145 CTATGGTGCTGGAGACCAGAAGG - Intronic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1089723830 11:120455177-120455199 CTGAGGACATGGAGAAGAGATGG + Intronic
1090443181 11:126741180-126741202 AAGTGGAAATGGAGAACAGAAGG - Intronic
1090694479 11:129224560-129224582 CTGTGGAGCTGCAGATCAGAGGG - Intronic
1090791691 11:130095522-130095544 ATGTGGAGATAAAGAGCAGGTGG + Intronic
1091152386 11:133341007-133341029 CTGTGAAGAAGAAGAGAAGAAGG - Intronic
1091204253 11:133808722-133808744 CTGTGGAGATGCAGTGATGATGG - Intergenic
1091618237 12:2066304-2066326 TTGGGGAGAGAGAGAGCAGAGGG + Intronic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092091709 12:5809122-5809144 GTGGGGAGAGGGAGTGCAGATGG + Intronic
1092229871 12:6770369-6770391 CTGTGGAGAGGGAGAGAATGGGG - Intronic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1093620972 12:21288473-21288495 TCATGGAGATAGAGAGCAGAAGG + Intronic
1093688430 12:22082723-22082745 TTGTGGAGAGAGAGAGGAGATGG - Intronic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1094186499 12:27648808-27648830 CCATGGAGATAGAGAGTAGAGGG + Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094718654 12:33038740-33038762 CTTTGGAGATGGAGAAAGGAAGG - Intergenic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095733978 12:45536112-45536134 ATGGGTAGGTGGAGAGCAGATGG - Intergenic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096025112 12:48353562-48353584 CCATGGAGATAGAGAGTAGAAGG - Intergenic
1096675601 12:53224139-53224161 CTGTGCTCATGGAAAGCAGAGGG - Intronic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1097021173 12:56021664-56021686 CTGAGGAGATGGAGAGGATGGGG + Intronic
1097052842 12:56233821-56233843 CTGTTGAGAGGGAGATTAGATGG + Intronic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1097669237 12:62516280-62516302 TGGTGGAGATGGGGAGCAGGGGG + Intronic
1097825500 12:64171405-64171427 CACTGGGGATGGAGAGCTGATGG + Intergenic
1098201289 12:68058654-68058676 CTGGGGAGAGGGAGAGCATCAGG - Intergenic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099763688 12:86954395-86954417 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1100220688 12:92501907-92501929 ATGTGTAGCTAGAGAGCAGAAGG + Intergenic
1100569749 12:95836956-95836978 GGGAGGAGATGGAGAGGAGAGGG + Intergenic
1100995882 12:100300676-100300698 TCATGGAGATGGAGAGTAGAAGG - Intronic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101467314 12:104961096-104961118 ATGTGGAGGAGGAGATCAGAAGG + Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103425578 12:120830519-120830541 GTGGGGAGGGGGAGAGCAGAGGG + Intronic
1103499734 12:121392079-121392101 CTCTGCAGCTGGAGAACAGATGG - Intronic
1103587706 12:121968428-121968450 GTGTGGATATGTGGAGCAGAGGG - Intronic
1103606295 12:122088186-122088208 CCCTGGAGAGGGACAGCAGAGGG - Intronic
1104531151 12:129572304-129572326 GTGTGGAGCTGGCGGGCAGAGGG + Intronic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1108165774 13:47691833-47691855 GTGTGAAGATGGAGAAGAGAGGG - Intergenic
1110610759 13:77485273-77485295 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111706747 13:91759553-91759575 TCATGGAGATGGAGAGTAGAAGG - Intronic
1112358970 13:98699293-98699315 ATGTGGAGAAGGGGAACAGAGGG - Intronic
1112972186 13:105273911-105273933 CTATGGGGCTGAAGAGCAGATGG - Intergenic
1113406563 13:110046316-110046338 CTGTGGAGAGGGGGAGTAGGAGG + Intergenic
1114624388 14:24119356-24119378 CTGGGGAAATGGAGAGCAAGGGG - Intronic
1114637501 14:24195978-24196000 CCGGGGAGATGGAGCGCAGGCGG + Intronic
1114794081 14:25692667-25692689 TTGTGAAGATGGAGAGCAAGGGG + Intergenic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115949292 14:38701718-38701740 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1117161004 14:52989542-52989564 TTATGGAGATAGAGAGTAGAAGG - Intergenic
1117454833 14:55886591-55886613 AGGGGGAGATGAAGAGCAGAAGG - Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118334981 14:64845587-64845609 CTGTAGAGATGAAAAGCAAAAGG + Intronic
1118916351 14:70110369-70110391 CTATGGACATAGAGAGTAGAAGG - Intronic
1119145402 14:72309191-72309213 CTGGGGAGGTGCAGAGCAAAGGG - Intronic
1119203453 14:72776497-72776519 CTGTGGAGATGGACTCCAGGGGG + Intronic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1120045676 14:79802892-79802914 GTGTGGAGAAGGAGAGCATCAGG + Intronic
1120049353 14:79847234-79847256 GTGTGGAGATGGAGATTGGAAGG - Intronic
1121095613 14:91216162-91216184 CTCTTGAGGTGGAGAGCAGGAGG + Intronic
1121321699 14:92995273-92995295 CTGTGGAGTGGGTGAGCAGAGGG - Intronic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121798538 14:96754987-96755009 CTAAGCAGATGCAGAGCAGATGG + Intergenic
1121937963 14:98037776-98037798 CTGCCGAGATGGAGGGCAGTGGG - Intergenic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1123096503 14:105769426-105769448 CCGTGGAGTGGGAGAGCAGCGGG - Intergenic
1123685525 15:22794593-22794615 CTGTGGAGATGTGGAGGGGAAGG + Intronic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1124004653 15:25786074-25786096 GTGGGGAGAAGGAGAGCTGAGGG + Intronic
1124370850 15:29103886-29103908 CTGCGGAGTTGGCGAGCTGATGG - Intronic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1126132275 15:45353289-45353311 TTGCGGAGATGGGGAGAAGAGGG + Intergenic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126463815 15:48942057-48942079 CTATGAAGATGGACAGCAGCAGG + Intronic
1126575577 15:50193159-50193181 CGGTGGAGATGAAGATCAGCTGG - Intronic
1126669596 15:51104215-51104237 CCGTGGAGATGGAAAGGAAAGGG - Intronic
1127492703 15:59480047-59480069 TGGTGGAGATGGGGAGAAGATGG + Intronic
1127576046 15:60293409-60293431 CTGGGAAGATGGAGAACAAAAGG + Intergenic
1128234719 15:66059668-66059690 GAGTGGAGAGGGTGAGCAGAGGG + Intronic
1128885671 15:71285085-71285107 CTCTGAAGATGTAGAGCGGATGG - Intronic
1129030236 15:72612386-72612408 GTGGGGAGATGAAGAGCATAAGG - Intergenic
1129324928 15:74794823-74794845 ATGTGATCATGGAGAGCAGAAGG - Intronic
1129545951 15:76395030-76395052 TCATGGAGATGGAGAGTAGAAGG - Intronic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130985717 15:88843289-88843311 CTCTGGGGATGCAGAGCAGGGGG + Intronic
1131673632 15:94648681-94648703 CTGTGTTGATGGAGAGGTGAAGG - Intergenic
1131950019 15:97672037-97672059 TTGTGGACATAGAGAGTAGAAGG - Intergenic
1132146577 15:99433071-99433093 CTGGGCAGCTGGAGGGCAGAAGG - Intergenic
1133172927 16:3992864-3992886 TTTGGCAGATGGAGAGCAGATGG + Intronic
1134793388 16:17011751-17011773 TTATGGAGATAGAGAGTAGAAGG - Intergenic
1135299835 16:21316433-21316455 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1135511454 16:23088101-23088123 CAGTGAAGATGGAGAGCACAGGG + Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136517872 16:30778711-30778733 CTATGGACATGGAGGTCAGATGG - Exonic
1136532729 16:30880580-30880602 CTGGGGAGTTGGAGATGAGAAGG + Intronic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1138158890 16:54734699-54734721 CTGTGGAGGTGAATAGAAGAGGG - Intergenic
1138529532 16:57627607-57627629 CTCTGGAGCTGGAATGCAGACGG + Intronic
1139380389 16:66527023-66527045 CAGAGGAGAGCGAGAGCAGAAGG - Intronic
1139422298 16:66856168-66856190 TTGAGGAGATGGTGAGGAGAGGG + Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140608509 16:76570172-76570194 CTGTGGAGATGGATCACATAGGG - Intronic
1141886484 16:86895787-86895809 CTGGGAAGAGGGAGAGAAGAGGG + Intergenic
1141909009 16:87045793-87045815 CTGGGGAGATGGGTAGGAGATGG - Intergenic
1142016372 16:87750320-87750342 CTGTGGAGATGCAGCACTGAGGG - Intronic
1142207272 16:88789841-88789863 CTATGGAGACAGACAGCAGAGGG + Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1143032259 17:3974297-3974319 CTGTAGAGATGGAGGCAAGAGGG - Intergenic
1143789989 17:9287155-9287177 GTCAGGAGATGGAAAGCAGATGG + Intronic
1144213819 17:13037157-13037179 CACTGGAGATGAAGAGCAGATGG + Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144322869 17:14147460-14147482 CCATGGAGATAGAGAGTAGAAGG + Intronic
1144472606 17:15558183-15558205 CTGTTGGGATCGAGAGCAGAAGG - Intronic
1144628751 17:16858877-16858899 CAGAGGAGATGCAGTGCAGAGGG - Intergenic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1144923875 17:18786508-18786530 CTGTTGGGATCGAGAGCAGAAGG + Intronic
1145160325 17:20569450-20569472 CAGAGGAGATGCAGTGCAGAGGG - Intergenic
1146312242 17:31778461-31778483 CTGTGTGGATGCAGAGCTGAGGG - Intergenic
1146530546 17:33604341-33604363 GAGTGGACATGGAGAGCAGGTGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146833641 17:36091976-36091998 CAGTGGAGCTGCAGAGCAGTGGG + Intergenic
1146848231 17:36198815-36198837 CAGTGGAGCTGCAGAGCAGTGGG + Intronic
1146949988 17:36899345-36899367 CTGTGGAGATGGAATTCAGTAGG + Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148619719 17:49025496-49025518 CTATGGTGTTGGTGAGCAGAAGG + Intronic
1148749336 17:49935588-49935610 CTGTGGAGCTGGACAGCCGGGGG + Intergenic
1148758906 17:49989378-49989400 CTTTGGAGACGGAGAGCTGGAGG - Intergenic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1149830783 17:59869967-59869989 TTTTGGAGCTGGAGAGCAAATGG + Intronic
1149964190 17:61145517-61145539 CTTTGGAGATGAAAAACAGACGG + Intronic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150829261 17:68504648-68504670 TGATGGAGATAGAGAGCAGAAGG + Intergenic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1150941251 17:69696943-69696965 CTCTGGATATTGAGAGCAGCAGG + Intergenic
1151021503 17:70622587-70622609 CTGTTGAGATGGCCAACAGATGG - Intergenic
1151425715 17:74029851-74029873 CTGTGGGGGTGGAAAGCAGCTGG + Intergenic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1154183765 18:12161707-12161729 TTGTGGAGATAGAGAGTAGAAGG - Intergenic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154437854 18:14360691-14360713 CTCTGGGGGCGGAGAGCAGAGGG - Intergenic
1155045632 18:22100666-22100688 GTGTGGAGATGGACACCAGAGGG + Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155582329 18:27323844-27323866 CTGGGGAGATGCAGAGAAGCTGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157146671 18:45170220-45170242 CTGTGAAGTTGTAGAGCAAAAGG - Intergenic
1157217806 18:45800191-45800213 CTGTGGAGGTGGAGCCAAGATGG - Intergenic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1157559839 18:48638421-48638443 ATGTGGAGAAGGGGACCAGAGGG - Intronic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1159762663 18:72448197-72448219 CTGTGGAGATATTGAGTAGATGG - Intergenic
1159979840 18:74764959-74764981 CTGAGGAGAAGGAAAGCAGGAGG + Intronic
1160133006 18:76246414-76246436 CATTGGAGATGGACAGGAGAAGG - Intergenic
1160205080 18:76824812-76824834 CTCTGGAGATGGAAAGAGGAGGG - Intronic
1160504838 18:79421244-79421266 CTGTGCAGAGGGAGAGGAGCTGG - Intronic
1161421959 19:4180910-4180932 CTGTGGGGGGAGAGAGCAGACGG + Intronic
1161443060 19:4303442-4303464 CTGGGGAGATGGAGATTACAGGG + Intergenic
1161596883 19:5155041-5155063 CTTTCGAGATGGAGAAAAGAGGG - Intergenic
1161614572 19:5262887-5262909 GTGAGGAGAAGGGGAGCAGAAGG + Intronic
1161848440 19:6725730-6725752 CTGGGAAAATGGAGAGCAGTGGG + Intronic
1161950825 19:7466982-7467004 CTGGGGAGATGGAGACCCGCGGG - Intronic
1161966254 19:7550824-7550846 CTGGGGAGAGGGAGAGGACAGGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162807218 19:13144294-13144316 CTGGGTAGCTGGAGAGTAGAGGG - Exonic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163629339 19:18409395-18409417 CTGAGGAGTTCGAGAACAGATGG - Intergenic
1163889315 19:19996920-19996942 ATGTGGAGAAGGAGAGCACAGGG - Intergenic
1164227475 19:23258531-23258553 CTGAGGAGTTTGAGACCAGATGG - Intergenic
1164248023 19:23451277-23451299 GTGAGGAGAGGGAGAGCATAAGG - Intergenic
1165407732 19:35641375-35641397 GTCTGGAGAAGGAGAGCAGTGGG + Intergenic
1166709801 19:44929405-44929427 CTGTGGGGAAGTAAAGCAGAAGG + Intergenic
1167236607 19:48319448-48319470 CTTTGGAGATGGGGAGCATACGG - Exonic
1167612305 19:50513417-50513439 CTGGGGAGAGGGAAAGGAGAGGG + Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1167776305 19:51559909-51559931 CTCTGGACATGGTGAGAAGATGG - Intergenic
1167867105 19:52337256-52337278 CTGATGACAAGGAGAGCAGAGGG + Intronic
1167958857 19:53090136-53090158 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1167971758 19:53192313-53192335 CTGGTGACAAGGAGAGCAGAGGG - Intronic
1168340683 19:55621588-55621610 CGCTAGTGATGGAGAGCAGAGGG - Exonic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925384983 2:3455531-3455553 TCATGGAGATGGAGAGCAGGAGG - Intronic
925811701 2:7707787-7707809 TTGAGGAGAAGGAGAGTAGAGGG - Intergenic
926075004 2:9935435-9935457 AAGGGGAGAGGGAGAGCAGATGG + Intergenic
926114982 2:10207265-10207287 CCATGGAGATGGAGAGAAAAGGG - Intronic
926404600 2:12538315-12538337 CTGAGGATATATAGAGCAGAAGG - Intergenic
926681271 2:15665761-15665783 CTCAGGAGAGTGAGAGCAGAGGG - Intergenic
927466138 2:23338101-23338123 GTGTGGAGAGGGAGAGTGGATGG + Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
927721699 2:25387379-25387401 CTGAGGAGAGGCAGAGCAGATGG + Intronic
927847924 2:26480821-26480843 CTGTGGAGCTGGTGAGCTCAGGG + Exonic
928461128 2:31473659-31473681 CTGAGGAGGTGGTTAGCAGAGGG + Intergenic
928660851 2:33500451-33500473 CGGTGGAGATGAAGGGCAGTGGG + Intronic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
928932972 2:36644662-36644684 TTATGGAGATGGAGAATAGAAGG + Intronic
929324307 2:40588874-40588896 TCGTGGAGATAGAGAGTAGAAGG + Intronic
929498768 2:42471452-42471474 CCATGGAGATAGATAGCAGATGG + Intronic
929671391 2:43878628-43878650 CTTTGGAGTTAGAGGGCAGAAGG + Intergenic
929811215 2:45190688-45190710 ATGGGGAGATGGAGAGCAACAGG - Intergenic
929922476 2:46182408-46182430 CACTGGAGAGGGAGAACAGATGG + Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930857453 2:56033922-56033944 CTGTGGAGAAGGGTATCAGAGGG - Intergenic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932207142 2:69893214-69893236 CTGGGGAGAGGGAGAGCATTGGG + Intergenic
932344734 2:70988256-70988278 CTGTGAAGCTTAAGAGCAGATGG - Exonic
932891734 2:75602800-75602822 CTGTACAGCTGGAGAACAGAGGG + Intergenic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
934539821 2:95164672-95164694 TTATGGAGATGGAGAGTAGAAGG + Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935341004 2:102059890-102059912 CTGCGGAGGTGGACTGCAGATGG + Intergenic
935442542 2:103118390-103118412 TCATGGAGATAGAGAGCAGAAGG + Intergenic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
935830689 2:106998104-106998126 CTCGGGAGGTGGAGGGCAGAAGG + Intergenic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936267311 2:111020395-111020417 CTCTGGGGATGGAGAGCTGGTGG + Intronic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
937153401 2:119701437-119701459 TTGAGGGGATTGAGAGCAGAGGG + Intergenic
937220884 2:120342838-120342860 CTGTGGAAAGGGAGAGAATATGG - Intergenic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937262986 2:120598223-120598245 TTGTGGAGAAGCAGTGCAGAGGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937916891 2:127103678-127103700 CTGGGGAGAAGGACAGCTGAGGG - Intronic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938605067 2:132883682-132883704 CCAGGGAGATGGAAAGCAGAGGG - Intronic
938777019 2:134550896-134550918 CTCTGGAGATATAGAGCGGAAGG + Intronic
938821509 2:134964878-134964900 TTCAGGAGCTGGAGAGCAGAAGG + Exonic
939086417 2:137724176-137724198 CCATGGAGATAGAGAGTAGAAGG + Intergenic
940314456 2:152312794-152312816 TCATGGAGATAGAGAGCAGAAGG - Intergenic
940555434 2:155221099-155221121 CTATAGAGATAAAGAGCAGAAGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
940906284 2:159172877-159172899 CGGTGGAGCTGGAGAGCTGCTGG + Intronic
940907902 2:159185220-159185242 CTATGGACATGGAGGGCAAATGG + Intronic
942568210 2:177287658-177287680 CTGTGATGAAGTAGAGCAGAGGG - Intronic
942733532 2:179083986-179084008 CCATGGAGATAGAGAGTAGAAGG - Intergenic
943436571 2:187871037-187871059 CTGGGGAGAAGGGTAGCAGAAGG + Intergenic
943700195 2:190980990-190981012 CTGGGGAGGGAGAGAGCAGATGG - Intronic
944897841 2:204183719-204183741 CTATGGAGAGAGAGAGCGGATGG - Intergenic
945566011 2:211400586-211400608 TTATGGAGATAGAGAGTAGAAGG + Intronic
945643117 2:212455592-212455614 CTTTGGTGATGGAAAGCAGCAGG - Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
945983875 2:216339306-216339328 GGGTGGAGATGAGGAGCAGAGGG - Intronic
946171327 2:217897730-217897752 ATGTAGAGGTGGTGAGCAGATGG + Intronic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
948119886 2:235522226-235522248 CTGTGGACAGGGAGTCCAGATGG + Intronic
948188535 2:236040874-236040896 CTGTGTAGCTGGAGACCACATGG + Intronic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
948334737 2:237199133-237199155 TTTTGGAGAGGGAAAGCAGATGG + Intergenic
948477280 2:238228113-238228135 CTGGTGAGATGGGGAACAGAAGG + Intronic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948846394 2:240684678-240684700 CTGTGGAGAATGAGCTCAGACGG + Intergenic
948847468 2:240690055-240690077 CTGTGGAGAATGAGCTCAGACGG - Intergenic
1168814618 20:728230-728252 CGGTGGGGGTGGGGAGCAGACGG + Intergenic
1169213848 20:3782810-3782832 CCCTGGAGTTGGAGACCAGAAGG - Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170818082 20:19731950-19731972 TCATGGAGATGGAGAGTAGAAGG - Intergenic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171244506 20:23600738-23600760 CTGAGGAGCTGCAGTGCAGAGGG + Intergenic
1171823613 20:29876186-29876208 CTCTGGAGCTGGAGAGCCGGGGG + Intergenic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1173614550 20:44394324-44394346 ATGGGGAGATGGAGATCAGAGGG - Intronic
1173648060 20:44646022-44646044 CTGGGGAGGTGGAGAGGAGCAGG - Intronic
1174050630 20:47765027-47765049 ATTTGGAGGTGGAGAGAAGATGG - Intronic
1174230266 20:49040558-49040580 CTGATGTGCTGGAGAGCAGATGG + Intergenic
1174533083 20:51230112-51230134 CTGTGGAGTTGGATAGCATAAGG + Intergenic
1174683797 20:52434194-52434216 CTGTGTAGAAAGAGAGCAGTTGG + Intergenic
1175048328 20:56128264-56128286 CTGTGCCCATGGAGAGCACAAGG + Intergenic
1175216355 20:57393367-57393389 CCGTGGAGATGAAGTGGAGAGGG + Intronic
1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG + Intergenic
1175291955 20:57881897-57881919 CTGTGGGGAGGGATAGCGGAGGG - Intergenic
1175428173 20:58883672-58883694 CTGCTGAGTGGGAGAGCAGAGGG + Intronic
1175708238 20:61197285-61197307 CTGGGGAGAGAGAGTGCAGAGGG - Intergenic
1176182375 20:63756719-63756741 GTGTGGTGATTGAGGGCAGAGGG - Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1176222534 20:63976821-63976843 CTGCGGAGATGAAGAACAGAGGG + Intronic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1177605055 21:23367250-23367272 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1178644336 21:34373028-34373050 CTGTCTGGATGCAGAGCAGAGGG - Intergenic
1178748300 21:35274976-35274998 TGGTTGAGAGGGAGAGCAGAAGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179545979 21:42112456-42112478 CTGGGGAGATACAGAGCAGCTGG - Intronic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179996695 21:44977510-44977532 CTCTGGGGGCGGAGAGCAGAGGG + Intergenic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1181910737 22:26236205-26236227 CTTTGGAGTTTGAGGGCAGATGG + Intronic
1182181113 22:28349110-28349132 CTTTGGAAAAGCAGAGCAGAAGG + Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183046095 22:35221447-35221469 CTGGGAAGATGGAGCGAAGAAGG + Intergenic
1183197296 22:36362261-36362283 CTATGGAGTAGGAGATCAGAGGG - Intronic
1183271653 22:36866041-36866063 CTGTGGAGACGCTTAGCAGAGGG - Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183468496 22:37992763-37992785 CTGTGGTGACTGGGAGCAGACGG - Intronic
1183777032 22:39972948-39972970 GTGTGGAGTTGGTGGGCAGATGG + Exonic
1184068638 22:42135112-42135134 CTGTGGTGATGGATAACAGCTGG - Intergenic
1184754717 22:46509315-46509337 ATGAGGAGATGGGGTGCAGAGGG + Intronic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950694972 3:14691924-14691946 TCATGGAGATGGAGAGCAGATGG - Intronic
950890443 3:16399820-16399842 CCGTGGAGAGGGAGAGGACAAGG - Intronic
952433668 3:33250091-33250113 CCATGGAGATAGAGAGCAGAAGG - Intergenic
952785150 3:37146462-37146484 CTGTGGAGAGGGAGCACAGTGGG - Intronic
953549301 3:43888791-43888813 TCGTGGAGATAGAGAGTAGAAGG + Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953666430 3:44929314-44929336 CTGTGCAGATGGAGTGCACCTGG + Exonic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954304381 3:49717739-49717761 CTGTGCAGGGGCAGAGCAGAAGG + Exonic
954617654 3:51977850-51977872 GTCTGGAGAGGGAGAGGAGAGGG - Exonic
955202694 3:56865133-56865155 CTGTGGGGATGGCGAGCACATGG + Intronic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956767605 3:72497072-72497094 CTTGGGAGTTGGAGAGCACATGG - Intergenic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
958129992 3:89406171-89406193 ATTAGGAGATGGAGAGGAGAAGG + Intronic
958515834 3:95114252-95114274 CTCTGGAGACAGAGAGCACAGGG - Intergenic
958740171 3:98059614-98059636 TTGTTGAGATGGAGACTAGATGG + Intergenic
959306411 3:104671831-104671853 CTATGGTAATGGTGAGCAGATGG + Intergenic
960427628 3:117528351-117528373 TCCTGGAGATGGAGAGTAGAAGG - Intergenic
960540903 3:118861397-118861419 CTATGGACATAGAGAGTAGAGGG - Intergenic
961061630 3:123833491-123833513 CTGAGGATAGGGAGAGCAGCAGG - Intronic
961372453 3:126439963-126439985 GGGAGGAGCTGGAGAGCAGAAGG - Intronic
961479757 3:127172123-127172145 GTATGGGGAGGGAGAGCAGAGGG + Intergenic
962338650 3:134562305-134562327 CTGTGGAGAGAGAGAGGAGCAGG + Exonic
962908803 3:139829129-139829151 CTCAGGAGAAGGAGAGCAGCAGG + Intergenic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
962931350 3:140040506-140040528 CTTGGGAGGTGGAGAGAAGAAGG + Intronic
963606449 3:147415581-147415603 GTGTGGAGGTGCAGAGCAGGTGG + Exonic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
964180155 3:153874022-153874044 CTCTGGAGATAGAGAACAGAAGG + Intergenic
965768634 3:172157588-172157610 ATTTAGAGATGGAGAACAGATGG - Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966669344 3:182509337-182509359 TTGTGGGGCTGGAGAGCAAAGGG + Intergenic
966728539 3:183130971-183130993 CTTTCCAGGTGGAGAGCAGAGGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967266402 3:187695974-187695996 CTGTGGAGACAGACAGCAGGTGG + Intergenic
967293354 3:187943062-187943084 CTGTGCAGGCGGAGTGCAGACGG - Intergenic
967701064 3:192592729-192592751 CTCTGGAGATAAAGAGAAGATGG - Intronic
967875739 3:194267496-194267518 CTGTGACGAAAGAGAGCAGAGGG - Intergenic
967954665 3:194869076-194869098 CGCTGGAGATGGGGAGAAGAAGG + Intergenic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
968454570 4:690419-690441 GTGAGGAGAAGGAGAACAGAAGG - Intergenic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968943640 4:3652400-3652422 CGGAGGGGAAGGAGAGCAGAAGG - Intergenic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG + Intronic
970479452 4:16458561-16458583 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
973158053 4:46982409-46982431 ATGTGAACATGGAGAGAAGATGG + Intronic
973236800 4:47914393-47914415 CTTTGGAGATGGACCGAAGAGGG + Exonic
973762170 4:54127687-54127709 TTGTGGAGATAGAGAGTAGAAGG - Intronic
975369598 4:73569057-73569079 CTTGGGAGAAGGAGAGCACAAGG - Intergenic
975520026 4:75290527-75290549 CTATGGAGATGTAAGGCAGAGGG - Intergenic
975589475 4:75986034-75986056 CTGTAGAGAAGGAAAGCACAGGG - Intronic
975912955 4:79290451-79290473 CTGATGAGAGAGAGAGCAGAGGG - Intronic
977477477 4:97530826-97530848 CTTTGGGGAGGGAGAGCAGGGGG + Intronic
977765122 4:100788520-100788542 ATCTGGAGATGGGGAGGAGATGG - Intronic
978026554 4:103882610-103882632 CCATGGAGATAGAGAGTAGAAGG - Intergenic
978445471 4:108776149-108776171 CTCTGGAGATGGAGGGCTCAAGG + Intergenic
978547217 4:109883905-109883927 TTGTGGACATAGAGAGTAGAAGG + Intergenic
979427593 4:120586620-120586642 CCATGGAGATAGAGAGTAGAAGG + Intergenic
979915383 4:126426274-126426296 CTATGGAGATAGAGAGTAGAAGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981280938 4:142957799-142957821 CAGAGGAGATGGAGGGCGGATGG - Intergenic
981759183 4:148174609-148174631 CTGGGGAGACGCAGAGCAAAGGG - Intronic
982341038 4:154299216-154299238 CTGTGGACATGTAGAAGAGAAGG - Intronic
983790161 4:171786717-171786739 GTCTGGAGATCGTGAGCAGATGG - Intergenic
984367198 4:178814587-178814609 CTGTGGAAATGAAGAACAGCTGG + Intergenic
984627569 4:182024862-182024884 TTATGGAGATAGAGAGTAGAAGG - Intergenic
985042173 4:185902429-185902451 CTGTGCAGTTGGAGAGTAAATGG + Intronic
985741078 5:1617845-1617867 CTGTGCAGCTGGAGATCTGATGG - Intergenic
985741314 5:1618952-1618974 CTGTGCAGCTGGAGACCTGACGG - Intergenic
985960306 5:3297415-3297437 CTGTGGAGAAGGAAAGGATAGGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987801395 5:22701329-22701351 CTGTGGAGTTGGAGAACATTAGG - Intronic
987978072 5:25042147-25042169 CTGAGGAAATGGAGAGCAACAGG - Intergenic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
988324577 5:29746201-29746223 CTGTGGACATGGACTGCTGATGG - Intergenic
989098045 5:37799006-37799028 CAGAGAAGATGGAGGGCAGAGGG + Intergenic
989111600 5:37912204-37912226 CCATGGAGATAGAGAGTAGAAGG + Intergenic
990140406 5:52696828-52696850 CTATGGAGATGGAGAGGATGGGG - Intergenic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
990932307 5:61106726-61106748 TTATGGAGATAGAGAGTAGAAGG - Intronic
992027168 5:72681613-72681635 CTGCTGAGATGAAGACCAGAAGG - Intergenic
992770402 5:80042135-80042157 CTGAGGACATGGCCAGCAGATGG + Intronic
993195794 5:84743656-84743678 CTATGGAGAGTGAGAGTAGAAGG - Intergenic
993787316 5:92159265-92159287 CTGAGGAGATGGAGAGTGGTGGG - Intergenic
993875376 5:93300333-93300355 TTTTTGAGATGGAGAGCAAAAGG - Intergenic
994021054 5:95026477-95026499 CAATGGAGATAGAGAGTAGAAGG - Intronic
994265433 5:97710599-97710621 CCATGGAGATAGAGAGTAGAAGG + Intergenic
994419086 5:99509923-99509945 CTGTTGAGAAATAGAGCAGACGG + Intergenic
995134741 5:108668954-108668976 CTGGGGAGATGGAGAAAATATGG - Intergenic
995459355 5:112386903-112386925 GAGTGGGGATGGATAGCAGAAGG - Intronic
995679636 5:114702604-114702626 CTGTGGAAATAGATAACAGAAGG + Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996496845 5:124168140-124168162 CTGGGGAGAGGGAGAGCATCAGG - Intergenic
996688280 5:126309362-126309384 TCATGGAGATAGAGAGCAGAAGG + Intergenic
997505196 5:134411647-134411669 CCATGGAGAGGGAGAGCAGCTGG + Exonic
998091696 5:139374827-139374849 ATGAGGAGATGGAGAGCATCTGG - Intronic
998149553 5:139748966-139748988 CTGTTGGGATGGAGTGCAGGTGG + Intergenic
998152478 5:139765175-139765197 GTGTGAAGATAGCGAGCAGAAGG - Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
1000043514 5:157502796-157502818 CTGTGGAGAAGAAGAGGTGAGGG - Exonic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1001680375 5:173552728-173552750 GAGTGGAGATGGAGAACAGCTGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002586657 5:180252959-180252981 ATGTGGAGAAGTAGAGCTGAGGG + Intronic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003499442 6:6692140-6692162 CTTTGGTGATGGAGTGTAGAAGG + Intergenic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1004054326 6:12120222-12120244 CTGCGTAGATGGAGATCCGAAGG + Exonic
1005152948 6:22773385-22773407 CTAAGGAGAGGAAGAGCAGAGGG - Intergenic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006576539 6:35050678-35050700 CTGTGCAGATGGGGAGAAGCCGG - Intronic
1006650388 6:35546183-35546205 CTGTGGGGAGGGAGAGCATCAGG + Intergenic
1006748607 6:36362679-36362701 CTGGGGAGATGGAGAAAAGGTGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007236941 6:40397303-40397325 ATGTGGAGTTGGAAGGCAGAGGG - Intronic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1009447966 6:63765826-63765848 TCATGGAGATAGAGAGCAGAAGG - Intronic
1010040621 6:71378663-71378685 CTGTGGAGATGGAGAAGTCATGG + Intergenic
1010187730 6:73162553-73162575 ATGTGTAGTTGGAGAACAGAGGG + Intronic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011457408 6:87566873-87566895 ATGTGGACAAGGAAAGCAGACGG + Intronic
1011532152 6:88334546-88334568 TCGTGGAGATAGAGAGTAGAAGG + Intergenic
1012028857 6:94032361-94032383 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1012043905 6:94244704-94244726 GTGTGGGGATGGGGAGCAAATGG - Intergenic
1012247043 6:96937717-96937739 CTGTGAGGATGGAGGGTAGAGGG - Intronic
1012454847 6:99392527-99392549 GTGTGTAGGTGGAGGGCAGAAGG - Intronic
1012475793 6:99613802-99613824 CCGGGGGGACGGAGAGCAGAGGG - Exonic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1012953688 6:105545659-105545681 GTGTGGATGAGGAGAGCAGAAGG - Intergenic
1012979642 6:105816122-105816144 CTGTGTAGGTGGATACCAGAAGG - Intergenic
1013032383 6:106346588-106346610 CCATGGAGATAGAGAGTAGAAGG - Intergenic
1013687799 6:112605801-112605823 TCGTGGAGATAGAGAGTAGAAGG + Intergenic
1014109790 6:117607772-117607794 TTGTGGCCATGGTGAGCAGAGGG + Intergenic
1014339689 6:120188402-120188424 TTGTGGAGACGGAGAGTAGAAGG + Intergenic
1014685175 6:124488662-124488684 ATGTTGAGATGATGAGCAGATGG + Intronic
1016034320 6:139370533-139370555 ATGTGGAGATGCAGAGCCCAAGG - Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016542039 6:145177540-145177562 TTATGGATATAGAGAGCAGAAGG + Intergenic
1016974982 6:149798671-149798693 GTGTGAAGATAGAAAGCAGATGG + Intronic
1017032786 6:150238687-150238709 GTGCTGAGATGCAGAGCAGAAGG - Intronic
1018988826 6:168658097-168658119 ATGGGGAGATGGAGAGCAGGTGG + Intronic
1019106632 6:169673077-169673099 TGATGGAGATGGAGAGGAGATGG + Intronic
1019734465 7:2644013-2644035 CTCTGCAAGTGGAGAGCAGAGGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021884196 7:25122455-25122477 TTATGGAGATGGTGAGCACAAGG - Exonic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022548893 7:31217651-31217673 CTGAGGAGAGGGAGAGATGAGGG + Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1023203075 7:37719935-37719957 CTTTGGAAATGGGGAGCAGCAGG + Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023877432 7:44294654-44294676 TTGGGGAGATGAGGAGCAGAGGG - Intronic
1025072441 7:55912216-55912238 ATGAGGCGATGGAGAGCACATGG - Intronic
1026603585 7:71797108-71797130 ATGTGGAGATTGAAGGCAGAGGG - Intronic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1028026262 7:85844326-85844348 TTACGGAGATAGAGAGCAGAAGG + Intergenic
1028225687 7:88250052-88250074 TCGTGGAGATAGAGAGTAGAAGG - Intergenic
1028354065 7:89885365-89885387 ATATGGAGATAGAGAGTAGAAGG - Intergenic
1028897585 7:96059736-96059758 CTGTGAAGATGGAGGACAGAGGG + Intronic
1029347369 7:99988146-99988168 GTGTGGAGATGTGGAGCAGCTGG - Intergenic
1029488773 7:100859029-100859051 CCCTGGAGAGGGGGAGCAGAGGG - Exonic
1029853069 7:103484762-103484784 CTGAGGACATGGAGAGGACATGG + Intronic
1030109853 7:106017901-106017923 CAGTGGAGATGGAGTACAGGAGG - Exonic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032411382 7:131695421-131695443 TGGTGGAGATGGACAGCAGCTGG + Intergenic
1032444276 7:131968144-131968166 CAGAGGAGAGGCAGAGCAGAAGG - Intergenic
1033271971 7:139940153-139940175 CTTTGCATATGAAGAGCAGAGGG + Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033652815 7:143355167-143355189 CTGTGGGGTTGGAGAGCACTTGG - Exonic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1034255936 7:149724712-149724734 CTGTGAAGATGGAGAACAGCTGG + Exonic
1034445594 7:151112550-151112572 CTCTGGAGACGGAGAGGGGATGG - Intronic
1034469203 7:151246649-151246671 CTGTGGAGACTGAGAGGAGGCGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035167636 7:157000715-157000737 GCGAGGAGAGGGAGAGCAGAGGG + Intronic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1037620137 8:20556225-20556247 CTGTGGACACTGTGAGCAGAGGG + Intergenic
1037620148 8:20556294-20556316 CTGTGGACATTGTGAGCAGAGGG + Intergenic
1037620160 8:20556363-20556385 CTGTGGACATTGTGAGCAGAGGG + Intergenic
1037644758 8:20783251-20783273 CTGTGCAGATGGCGAGGGGATGG + Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1038402531 8:27296304-27296326 CTGGGGAGAGGGAGAGCATCAGG - Intronic
1039044664 8:33439052-33439074 AGGTTGAGATGCAGAGCAGAAGG - Intronic
1039236446 8:35507563-35507585 TCATGGAGATAGAGAGCAGAAGG + Intronic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039924494 8:41916599-41916621 CTACGGTGACGGAGAGCAGAAGG - Intergenic
1039983071 8:42425506-42425528 CCGTGTAGTTGGAGAGCAGATGG - Intronic
1040460591 8:47644094-47644116 CTGTGAAGATGGAGTGCTGGTGG + Intronic
1041945264 8:63433698-63433720 CAGGGAATATGGAGAGCAGAGGG + Intergenic
1042212505 8:66394887-66394909 CTGGTGTGATGGAGGGCAGAAGG + Intergenic
1042685744 8:71438644-71438666 ATGTGGAGAGTGTGAGCAGATGG + Intronic
1042807012 8:72781964-72781986 CTGGGGAGAGGGAGAGCATCAGG + Intronic
1042955020 8:74240438-74240460 TCATGGAGATGGAGAGTAGAAGG - Intronic
1043028928 8:75106656-75106678 CTGTGGAGATGGCTGGCAGTTGG + Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1046776832 8:118173321-118173343 TTATGGAGGTGGAGAGCAGAAGG + Intergenic
1047803122 8:128330781-128330803 CTGGGGAGCTTGAGAGCGGATGG - Intergenic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048907637 8:139103883-139103905 CCCTGGAGATGGATAGCTGAAGG + Intergenic
1049046885 8:140159422-140159444 CTAAGGAGTTGGAGAGCAGTGGG - Intronic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049151603 8:141038590-141038612 CTGGGGAGGAGGAGAGCAGCGGG - Intergenic
1049202401 8:141346734-141346756 CCTTGCAGATGGAGTGCAGATGG - Intergenic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050121134 9:2308375-2308397 CCATGGAGATAGAGAGTAGAAGG - Intergenic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051432704 9:16996544-16996566 CTATGGACATAGAGAGTAGAAGG + Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1052208564 9:25872672-25872694 TCATGGAGATGGAGAGTAGAAGG - Intergenic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1053036623 9:34832084-34832106 CAGTGGAGATAAGGAGCAGATGG + Intergenic
1054983119 9:71230276-71230298 TTGTGCAGATCGAGAGCAGAAGG + Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055347335 9:75352697-75352719 CTTTGGAGATGAAGAGTAAAGGG + Intergenic
1056069935 9:82975756-82975778 TTGTGAAGCTGGAAAGCAGATGG - Intergenic
1056180520 9:84078153-84078175 ATATGGAGATGGAGAGTAGAAGG + Intergenic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1057268843 9:93635919-93635941 CTGGGGAGGTGGGGAGGAGACGG + Intronic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG + Intronic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1059118285 9:111618232-111618254 GTGGGGAGAGGGAGAGGAGAGGG + Intergenic
1059475408 9:114542687-114542709 GTGGGCAGATGGTGAGCAGATGG - Intergenic
1059540528 9:115125904-115125926 TCATGGAGATAGAGAGCAGAAGG + Intergenic
1059900076 9:118914522-118914544 TTATGGAGATAGAGAGTAGAAGG - Intergenic
1059940040 9:119349770-119349792 CTGTGGAGGGGAAGTGCAGAGGG + Intronic
1061271281 9:129544840-129544862 CTGGGGAGGTGGAGAGTAGGAGG - Intergenic
1061852498 9:133424294-133424316 AGGGGGAGAGGGAGAGCAGAGGG - Intronic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1185936159 X:4258662-4258684 ATGTAGAGAAGGAGAGCTGATGG - Intergenic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1186710068 X:12184787-12184809 TCGTGGAGATAGAGAGTAGAAGG + Intronic
1187102106 X:16204192-16204214 CCATGGAGATAGAGAGTAGAAGG + Intergenic
1187243992 X:17537897-17537919 CTGAGCAGATGGGGATCAGAGGG + Intronic
1187309992 X:18132787-18132809 CTGTGGTGAGGGACACCAGAAGG + Intergenic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187724551 X:22188940-22188962 TCGTGGAGATAGAGAGTAGAAGG - Intronic
1187985272 X:24803279-24803301 CTGGAGAGAAGGAGAGCACACGG + Intronic
1188575090 X:31639259-31639281 CTGTGGAGAGGGAATGAAGATGG + Intronic
1188633726 X:32401525-32401547 CTATGGAGATAGAGAGTAGAAGG + Intronic
1189552002 X:42102851-42102873 CTGGGGAGAAGGAGAGCATGGGG - Intergenic
1189750634 X:44217654-44217676 CCATGGAGATAGAGAGTAGAAGG + Intronic
1189868313 X:45354448-45354470 CCCTGGAGATAGAGAGTAGAAGG - Intergenic
1190467139 X:50736390-50736412 CTGGGGAGATGGAGAGCGTTAGG - Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191189025 X:57646153-57646175 TCATGGAGATAGAGAGCAGAGGG + Intergenic
1191800975 X:65079051-65079073 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192021657 X:67399104-67399126 CTGAGAAGAGGAAGAGCAGAAGG - Intergenic
1192156684 X:68752057-68752079 CTGTGGAGTCAGTGAGCAGATGG + Intergenic
1192417116 X:70991373-70991395 CCCTGGAGATAGAGAGTAGAAGG - Intergenic
1192722328 X:73712114-73712136 CCGAAGAGATGGAGAGCATAAGG + Intergenic
1193707275 X:84837128-84837150 CCATGGAGATAGAGAGCAGAAGG + Intergenic
1193842392 X:86422848-86422870 TCATGGAGATGGAGAGTAGAAGG - Intronic
1194213700 X:91101060-91101082 ATGTGGAGATGGAGAACATTTGG - Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195938859 X:110150297-110150319 CTGTGGCAATGGGGAGCACAAGG + Intronic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1196521356 X:116676416-116676438 GTGTTGTGTTGGAGAGCAGAGGG + Intergenic
1196626605 X:117884412-117884434 CTGTGGAGATAGAGAATAGAAGG + Intergenic
1196729198 X:118924072-118924094 TTATGGAGATAGAGAGTAGAAGG - Intergenic
1197300547 X:124774862-124774884 CTGTGAAGAGGGAGATAAGAGGG - Intronic
1197452163 X:126632785-126632807 TCATGGAGATGGAGAGAAGAAGG - Intergenic
1197494303 X:127158647-127158669 CTGGGGAGAGGGAGAAAAGATGG + Intergenic
1197623043 X:128772750-128772772 GCATGGAGATAGAGAGCAGAAGG - Intergenic
1197680539 X:129378807-129378829 AATTGGGGATGGAGAGCAGAGGG + Intergenic
1198263306 X:134985999-134986021 CTCTGTACCTGGAGAGCAGAGGG + Intergenic
1198311640 X:135430529-135430551 TTGTGGAGATAGAGTGCTGAGGG + Intergenic
1198316013 X:135467201-135467223 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198798872 X:140429525-140429547 CCGTGGAGATAGACAGTAGAAGG + Intergenic
1199099230 X:143779471-143779493 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1199195421 X:145023807-145023829 TCATGGAGATGGAGAGTAGAAGG + Intergenic
1199370031 X:147036433-147036455 TCATGGAGATAGAGAGCAGAAGG - Intergenic
1199964417 X:152807671-152807693 ATGAGGAGCTGGAAAGCAGAAGG + Intergenic
1200760783 Y:7036881-7036903 CTTTGGAAAAGGAGAGCAGTAGG + Intronic
1201720473 Y:17090723-17090745 ATGTAGAGATGGAGAGCTGATGG - Intergenic