ID: 1021668771

View in Genome Browser
Species Human (GRCh38)
Location 7:23014063-23014085
Sequence CAGTGAGAGGAGGGGGAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1585
Summary {0: 1, 1: 1, 2: 22, 3: 136, 4: 1425}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021668771_1021668784 28 Left 1021668771 7:23014063-23014085 CCATCTTCCCCCTCCTCTCACTG 0: 1
1: 1
2: 22
3: 136
4: 1425
Right 1021668784 7:23014114-23014136 CTGCCGCCAGCCTCTCTGACAGG 0: 1
1: 0
2: 1
3: 22
4: 224
1021668771_1021668777 -6 Left 1021668771 7:23014063-23014085 CCATCTTCCCCCTCCTCTCACTG 0: 1
1: 1
2: 22
3: 136
4: 1425
Right 1021668777 7:23014080-23014102 TCACTGACTGACAACCCAGCCGG 0: 1
1: 0
2: 1
3: 7
4: 101
1021668771_1021668778 -5 Left 1021668771 7:23014063-23014085 CCATCTTCCCCCTCCTCTCACTG 0: 1
1: 1
2: 22
3: 136
4: 1425
Right 1021668778 7:23014081-23014103 CACTGACTGACAACCCAGCCGGG 0: 1
1: 0
2: 0
3: 14
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021668771 Original CRISPR CAGTGAGAGGAGGGGGAAGA TGG (reversed) Exonic
900088159 1:908527-908549 GAGGGAGGGGAGGGGGAGGAGGG + Intergenic
900324885 1:2103859-2103881 CAGTGGGAGGAGAGGGGTGAAGG + Intronic
900361383 1:2290664-2290686 CAGGAGGAGGAGGAGGAAGAGGG + Intronic
900540640 1:3200974-3200996 GAGGAAGAGGAGGGGGAGGAAGG + Intronic
900631039 1:3635469-3635491 CAGTGAGAGCATGAGGAAAAAGG + Intronic
900700779 1:4047477-4047499 CAGGGAGAGGAAGGGGAGGAAGG + Intergenic
901193399 1:7425872-7425894 CAGGGAGAAGATGGGGAAGCTGG - Intronic
901224156 1:7602012-7602034 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
901295476 1:8157879-8157901 GAGGAAGAGGAGGAGGAAGAAGG + Intergenic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901441792 1:9282522-9282544 CAAGGAGGGGAGGGGGAAGGAGG - Intergenic
901638462 1:10681236-10681258 CAGGGTGAGGATGGGGATGAGGG - Intronic
901877554 1:12175512-12175534 CAGCGAGAGGAGGGGCCAGCAGG - Intronic
902471506 1:16649784-16649806 CAGTGAGGGGAATGGGGAGAAGG - Intergenic
902487303 1:16757661-16757683 CAGTGAGGGGAATGGGGAGAAGG + Intronic
902528895 1:17077668-17077690 CACTGAGTGGAGGGAGAAGGAGG + Intronic
902584321 1:17428811-17428833 AAGTGAGGTGAGAGGGAAGATGG + Intronic
902653850 1:17854113-17854135 CAGGGAGGGGAGGATGAAGAGGG - Intergenic
902689469 1:18101232-18101254 GAGGGAGGGGAGGGAGAAGAAGG - Intergenic
902689627 1:18102173-18102195 GAGTGAGAGCAGGGGAAGGAGGG + Intergenic
902783234 1:18717459-18717481 CGAGGAGAGGAGGGGCAAGAAGG - Intronic
902841247 1:19075339-19075361 TAGTGAGAGGAGGAGGAGGTGGG - Intronic
902929933 1:19723810-19723832 CTGTGAGAGGAGGGTGAAGCGGG + Intronic
903688753 1:25153992-25154014 CAGAGAGATGAGGTGGAAGGAGG - Intergenic
903696424 1:25210787-25210809 CAGGGAGGGGAGGGGGGCGAAGG - Intergenic
903858921 1:26353778-26353800 CAGGGAGAGGATGGGCAGGAAGG - Intronic
904138011 1:28329023-28329045 AAGTGAGAAGAGGAGGAAGTTGG + Exonic
904205021 1:28848676-28848698 CTGTGAGAGGTGGGGAAGGAAGG + Intronic
904474445 1:30755947-30755969 GAGTGACAGCAGGGGGCAGATGG - Intronic
904499959 1:30908095-30908117 CACTGGGAGGTGGGGGAACAGGG + Intronic
904597974 1:31658598-31658620 CAGTGAGAGGGGAGGAAAGCAGG + Intronic
905294980 1:36948575-36948597 AAGGGAGAGGAAGGGTAAGAAGG + Intronic
906153821 1:43602635-43602657 CAGAGAGAAGAGTGGGAAGCAGG - Intronic
906240567 1:44239787-44239809 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
906661480 1:47585921-47585943 CAGCCAGAAGAGGAGGAAGAGGG + Intergenic
906676753 1:47698772-47698794 CAGTGGGTGGAGGGGGGCGAGGG - Intergenic
906687563 1:47772324-47772346 CAGAGAGAGGAGCAGGACGAAGG + Intronic
906943149 1:50273365-50273387 CAGTGAGAGATGGGCAAAGAAGG + Intergenic
907091286 1:51728750-51728772 CTGGGAGAGGCGGGGGAAGGAGG - Intronic
907328028 1:53653604-53653626 CAGTGGGGTGAGGGGGAGGAGGG - Intronic
907459018 1:54594224-54594246 CAGGGAGAGGTGGGGAAAGGAGG - Intronic
907526160 1:55055312-55055334 CAGAGAGTGGCGGGGGAAGTTGG + Intronic
907703233 1:56810051-56810073 GAGAAAGAGGAGGGGGAAGAGGG + Intronic
907787297 1:57625347-57625369 GAGTGAGATAAGGGGGGAGATGG - Intronic
908162654 1:61426283-61426305 CAGTCAAAAAAGGGGGAAGAGGG - Intronic
908262445 1:62349510-62349532 AAAGGAGAGGAGGGGGAAGTGGG + Intergenic
908926451 1:69260647-69260669 CAGAGGGTGGAGGGGGAAGGAGG + Intergenic
908933805 1:69348878-69348900 CAGTGAAAGGAGAGGAAAAATGG + Intergenic
909097330 1:71304050-71304072 CAGGAAGGAGAGGGGGAAGAAGG + Intergenic
909213889 1:72860835-72860857 AAGTGAGATGAGGGGGCAAATGG - Intergenic
909458682 1:75882416-75882438 AAGTGGGGGGAGGAGGAAGAGGG - Intronic
909524384 1:76606561-76606583 CAGAGGGTGGAGGGGGAGGAGGG + Intronic
909525662 1:76619857-76619879 TAGGCAGAGGAGGGAGAAGAAGG - Intronic
909686539 1:78355188-78355210 GAGGGAGAAGAGGAGGAAGAGGG - Intronic
910115117 1:83723586-83723608 AAGTGAGAGAAAGGGCAAGACGG - Intergenic
910257675 1:85264575-85264597 GAGTGAGATGAGAGGGAGGAAGG + Intergenic
910332918 1:86096648-86096670 CAGAGAGAGAAAGGGGAAGTAGG - Intronic
910425948 1:87120190-87120212 CTGTGAGAGGAGGTGGGAGTGGG - Intronic
910486692 1:87722609-87722631 CAGGGAGTTGAGTGGGAAGATGG - Intergenic
910745373 1:90568717-90568739 CAGAAAGAGGAGTGGGAAGGTGG - Intergenic
911224543 1:95290890-95290912 CAGAGGGAGGACGGGGAATAGGG - Intergenic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
912303106 1:108536814-108536836 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303109 1:108536823-108536845 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303112 1:108536832-108536854 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303115 1:108536841-108536863 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303133 1:108536896-108536918 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303136 1:108536905-108536927 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912564759 1:110579746-110579768 CACTGAGTGGAGGTGGAAAAAGG + Intergenic
912565780 1:110586218-110586240 CAGTGAGGCGAGGTGGAAGAGGG - Intergenic
912735327 1:112145106-112145128 CAGGGGGAGGATGGGGCAGAAGG + Intergenic
912883599 1:113445161-113445183 GAGGGAGAGAAAGGGGAAGAGGG + Intronic
912993253 1:114510228-114510250 CAGTGAGAGAAGGGGGATTTGGG - Intronic
913072330 1:115310900-115310922 GAGTGGGAGGAGGAGGAGGAAGG + Intronic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913240507 1:116825881-116825903 CCCTGAGAGGTGGGAGAAGAGGG - Intergenic
914452883 1:147808440-147808462 CAGTGGTTGGATGGGGAAGAAGG - Intergenic
915358738 1:155273045-155273067 TAGGGAGATGAGGGGGAAGGAGG - Intronic
915427351 1:155837662-155837684 GAGGGAGAGTAGGGGGATGAGGG - Intronic
915603154 1:156935175-156935197 CAGGGACAGGGTGGGGAAGAGGG + Exonic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916188769 1:162158885-162158907 AAGTGAGAGAAGAGGGAATATGG + Intronic
916216943 1:162403938-162403960 CAGTGAGAGGGGGAGGATTAGGG + Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917618247 1:176768223-176768245 CAGGGGGAGGTGGGAGAAGAAGG - Intronic
918015848 1:180632021-180632043 TATGGAGAGGAGGAGGAAGATGG + Exonic
918092671 1:181310873-181310895 GAGTAAAAGGAGGGGGAAGTGGG - Intergenic
918106416 1:181419199-181419221 CAGGGGGAAGAGGGAGAAGATGG - Intronic
918239539 1:182609582-182609604 CAGGGAGAGGTGGAGGAAGCTGG - Intergenic
919046865 1:192463561-192463583 TAGTGAGAGGGAGGGAAAGACGG - Intergenic
919543428 1:198880278-198880300 AAGTGAGTAGAGGGAGAAGAAGG + Intergenic
919849227 1:201661318-201661340 CAGTGAGAGGCTTGGGAGGAAGG - Intronic
920124511 1:203682977-203682999 CAGCGAGAGGAGGAAGAGGATGG - Exonic
920419331 1:205820465-205820487 CAGGGAGAGGAGGGGAGGGAAGG - Intergenic
920552000 1:206869803-206869825 CAGAGTGAGGTGGGGGAAGAAGG - Intergenic
920688571 1:208128638-208128660 GAAAGAGAGGAGGGGGAAAAAGG - Intronic
920730743 1:208481728-208481750 CAGTGACAGTGGGGAGAAGAAGG - Intergenic
921155488 1:212434962-212434984 CAGAGAGAGGAGGGGAGCGAGGG + Intronic
921351657 1:214242340-214242362 CAGCAAGAGCAGGAGGAAGAAGG - Intergenic
921541654 1:216423553-216423575 AAGAAAGAGGAGGGGCAAGAGGG - Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922342436 1:224668793-224668815 TGGTGAGAGGAGGGGGAACCTGG + Intronic
922356127 1:224778002-224778024 TAGAGAGAGGGGTGGGAAGAAGG - Intergenic
922427679 1:225514742-225514764 TAGGGAGAGGAGGGGGAGGAGGG + Exonic
922446386 1:225701387-225701409 GACTGAGAGGAGGAGGCAGAAGG + Intergenic
923051985 1:230395760-230395782 GAGTGTGAGGAGGGGGGAGGAGG - Intronic
923299719 1:232630084-232630106 GAGCGAGAGGAGGAGGAGGACGG - Intergenic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923482417 1:234397397-234397419 GATGGGGAGGAGGGGGAAGAGGG + Intronic
923482427 1:234397416-234397438 AGGGGGGAGGAGGGGGAAGAGGG + Intronic
923482436 1:234397435-234397457 AGGGGGGAGGAGGGGGAAGATGG + Intronic
923482572 1:234397724-234397746 GAGAGGGAGGAGGGAGAAGAGGG + Intronic
923482581 1:234397740-234397762 AAGAGGGGGGAGGGGGAAGAGGG + Intronic
923482631 1:234397833-234397855 GAGGGAGGGGAGGGGGAGGAGGG + Intronic
923624292 1:235601610-235601632 CTGTGAGAGGAAGGGGAGCATGG - Intronic
923713570 1:236406195-236406217 CTGTGATAGGAGGAGGGAGAAGG + Intronic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
924167185 1:241296170-241296192 GAGAGGGAGGAGGAGGAAGAAGG + Intronic
924802311 1:247336359-247336381 ATGTGAGAGCAGGAGGAAGAGGG + Intergenic
924936461 1:248776166-248776188 AAGTCAGAGGAGGGGGCGGATGG + Intergenic
1062987478 10:1782487-1782509 GAGAGAGAGGAGGGAGAGGAGGG + Intergenic
1063058077 10:2524011-2524033 CAAAGCGAGGAGGGGGAGGAGGG - Intergenic
1063173371 10:3529760-3529782 CAGTCAGAGGAAGAGGAGGAGGG - Intergenic
1063348058 10:5329627-5329649 GAGTTAGAGGAAGGGGAAGGGGG - Intergenic
1063432862 10:6006195-6006217 CAGTGAGAGGAGATGAAGGAGGG + Intergenic
1063623799 10:7671125-7671147 CAGAGGAAGGAGGGGGAACAAGG + Intergenic
1063687778 10:8254958-8254980 CAAAGAGGGGAGAGGGAAGATGG - Intergenic
1063790979 10:9447525-9447547 GAGAGAGAGGAAGGGGAAGGGGG - Intergenic
1063876479 10:10484193-10484215 CAGAGAGAGGAGGGGGAGGGAGG - Intergenic
1063929292 10:11013015-11013037 CAGGAAGAGGAGGGGGAGGATGG - Intronic
1063967721 10:11359798-11359820 AGGGGAGAGGAGGGAGAAGAAGG + Intergenic
1063972193 10:11389027-11389049 GAGGCAGAGGTGGGGGAAGAGGG - Intergenic
1064086457 10:12349459-12349481 GAGGGGGAGGAGGGGGAGGAGGG + Intergenic
1064272682 10:13879723-13879745 AAGGGAGAGGAGGAGGGAGAAGG - Intronic
1064283741 10:13973689-13973711 AAGTGAGGGGAGGGGAAGGAAGG + Intronic
1064529851 10:16297117-16297139 GAATGAAAGGAAGGGGAAGAGGG + Intergenic
1064834027 10:19505091-19505113 GAGGCAGAGGAGGAGGAAGAGGG + Intronic
1065034612 10:21624977-21624999 CAGTAAGAGGAAGAGGAGGAAGG - Intronic
1065409562 10:25409146-25409168 GTGTGAGAGGAGGGGTAAAAAGG - Intronic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065510990 10:26478332-26478354 CAGTGAGTGGGGCGGGAGGATGG + Intronic
1065708752 10:28495283-28495305 AAGGGAGAGGAGGGAGGAGAAGG + Intergenic
1065722754 10:28642447-28642469 CAGAGAGGGGAGAGGGGAGAAGG - Intergenic
1066276614 10:33875196-33875218 GAGTGGGAGGAAGGGGAAGAGGG + Intergenic
1067095798 10:43298750-43298772 CAGTGGGAGGTGGGGGAACCAGG - Intergenic
1067216152 10:44305601-44305623 CAGAGGCAGGAAGGGGAAGAGGG + Intergenic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1067532663 10:47085752-47085774 CGGAGAGAGGAGTGGGGAGATGG + Intergenic
1067574933 10:47403127-47403149 GAGGGAGAGGAGGGGGAGGAGGG + Intergenic
1067578271 10:47421170-47421192 CTGTGGGAGGAGGGGGCAGCCGG + Intergenic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1068448340 10:57152707-57152729 CAGTAAGGGGAGGGGTAAGTGGG + Intergenic
1068756947 10:60666389-60666411 CTGGGAGGGGAGGGGGAATAGGG + Intronic
1069265699 10:66454797-66454819 GAATGAGAGGAGGGAGAGGAGGG + Intronic
1069265704 10:66454806-66454828 GAGGGAGAGGAGGGGGAGGAGGG + Intronic
1069265709 10:66454815-66454837 GAGGGGGAGGAGGGGGAGGAGGG + Intronic
1069628287 10:69881411-69881433 CAGTGAGGGGTGGGAGCAGAGGG + Intronic
1069751571 10:70748518-70748540 CAGGGTGAGGGTGGGGAAGAGGG - Intronic
1069764950 10:70848920-70848942 GATTGAGAGTAAGGGGAAGAAGG - Intronic
1069771739 10:70904815-70904837 CAGGGAGTGGAGGAGGAAGCTGG + Intergenic
1069929137 10:71870441-71870463 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1069929140 10:71870450-71870472 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1069929143 10:71870459-71870481 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1069929146 10:71870468-71870490 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1069941968 10:71962710-71962732 GAGAGAGGGGAGGGGGGAGAGGG + Intergenic
1069960129 10:72074681-72074703 CAGTGAGAGAAGGAGGCAGCAGG + Intronic
1070282464 10:75059671-75059693 CAGTGTGAGGAGGGGCAGGCCGG + Intergenic
1070312541 10:75284149-75284171 CAGAGAGGGGAGGGAGAAGAAGG + Intergenic
1070383752 10:75904972-75904994 CAGTGGAAGGAGGGGAGAGAGGG + Intronic
1070440882 10:76441941-76441963 CAGAGAGACGAGGTGGCAGATGG - Intronic
1070487558 10:76945038-76945060 AAGTGAGAGGAGAGGGAAAGAGG + Intronic
1070698538 10:78581595-78581617 GAGTGAGACTAGTGGGAAGAAGG - Intergenic
1070702453 10:78613525-78613547 AAGGGAGGGGAGGGGGAATAGGG + Intergenic
1071709242 10:88032940-88032962 CAATGAGATGAGTGGGAAAATGG + Intergenic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1072242635 10:93511458-93511480 CAGTGAGAAGAGGTGGCATAAGG + Intronic
1072340456 10:94443278-94443300 CAGGGAGAGGAGGAGGCACATGG - Intronic
1072394475 10:95024685-95024707 GAGTGGGGGGAGGGGGAAGGGGG + Intergenic
1072455043 10:95568086-95568108 GAGAGAGAGGAGGAAGAAGAAGG + Intergenic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1073137914 10:101229903-101229925 CAGTGGGGTGAGGGGCAAGAGGG - Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073243538 10:102073845-102073867 CAGAGAGATGAGGAAGAAGATGG + Intergenic
1073371645 10:102995153-102995175 GAGGGGGAGGAGGAGGAAGAGGG - Intronic
1073371652 10:102995171-102995193 GAGGGGGAGGAGGAGGAAGAGGG - Intronic
1073556467 10:104457063-104457085 CCATGAGCCGAGGGGGAAGAGGG + Intergenic
1073580045 10:104656990-104657012 AAGTTAGAAGATGGGGAAGAAGG - Intronic
1073597767 10:104817549-104817571 AAGGGAGAGGAGGGGGGAGGGGG - Intronic
1073730465 10:106281482-106281504 GAGTGAGAAGAGAGGGTAGAAGG + Intergenic
1073759831 10:106617291-106617313 CAGAGAGAGGAGGAGGCAGAAGG - Intronic
1073849348 10:107596207-107596229 GAGAGAGAGGTGGGGGAAAAGGG - Intergenic
1073894920 10:108144334-108144356 CAGAGGGAGGAGGGGGGGGAAGG - Intergenic
1074452935 10:113574130-113574152 CAGTGAGGGGAGTGGAAAGGAGG - Intronic
1074453149 10:113575670-113575692 TAGTGAGAGGAGAGGCGAGAAGG - Intronic
1074524674 10:114253254-114253276 GGGGGAGAGGAGGGGGGAGACGG - Intronic
1074800382 10:116994507-116994529 CAGAGAGAGAAGGGGAAAGAGGG + Intronic
1074829282 10:117237425-117237447 AAGTGAGTGGAGGGAGAGGAGGG + Intergenic
1075301698 10:121330580-121330602 AAGTGAGGGGAGGGGGGAGAGGG - Intergenic
1075550908 10:123391614-123391636 CAGTCTGAGTTGGGGGAAGAGGG + Intergenic
1075582621 10:123633802-123633824 AAGGCAGAGGAGGGAGAAGAGGG + Intergenic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1075924270 10:126237449-126237471 CAGTGAGAGGAAGGGGGAGCGGG - Intronic
1076120414 10:127932588-127932610 CAGAGACAGGAGGGTGGAGAAGG + Intronic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076172613 10:128334754-128334776 CAGGCAGATGAGGGGGAACATGG + Intergenic
1076282035 10:129254699-129254721 GAGTGAGAGGAAGGGGTTGAGGG - Intergenic
1076319021 10:129564659-129564681 GAAGGAGAGGAGGGGGAGGAAGG - Intronic
1076412623 10:130262723-130262745 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076412846 10:130264164-130264186 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076486451 10:130822155-130822177 GAGGGAGAGGAAGGGAAAGAGGG + Intergenic
1076718180 10:132378421-132378443 CAGGGAGAAGAGGGAGAACAGGG - Exonic
1076770521 10:132660767-132660789 CAGTCAGAACTGGGGGAAGATGG + Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077163290 11:1123296-1123318 CAGAGAGAGGAGGCAGAAGGAGG - Intergenic
1077233662 11:1469713-1469735 CCGGGAGAGGAGGGGTGAGAGGG + Intronic
1077332163 11:1988514-1988536 GAGGGAGAGGAGGGGGCAGGAGG + Intergenic
1077488897 11:2851460-2851482 CAGGGTGAGGATGGGGAAGCTGG - Intergenic
1077850273 11:6069332-6069354 CGGTGAGAGGGCTGGGAAGATGG + Intergenic
1078461015 11:11515443-11515465 CAGAGAGAGCAGGGGGAATCGGG - Intronic
1078470504 11:11582269-11582291 CAGAGAGTGGAGGGAGAAAAGGG + Intronic
1078609337 11:12806521-12806543 CCCTGGGAGGAGGAGGAAGATGG + Intronic
1078741073 11:14066822-14066844 GACTGAGAAGAGGGAGAAGAGGG - Intronic
1079005461 11:16788746-16788768 CAGAGAGGAGAGGAGGAAGATGG - Exonic
1079253110 11:18802129-18802151 CACTGAAAAGAGGGGAAAGAGGG - Intergenic
1079298027 11:19252107-19252129 CAGTGGGAGGTCGGGGAAGGGGG - Intergenic
1079712702 11:23707204-23707226 CAGAGAGAGGAGGAGCAAGATGG + Intergenic
1080102556 11:28476207-28476229 CAGTGTGAAGAGGGGGACAATGG - Intergenic
1080352496 11:31401485-31401507 TAGGCAGAGGAAGGGGAAGAGGG - Intronic
1080874699 11:36265131-36265153 CAGTGACAGGATGAGGAAGAAGG - Intergenic
1080922323 11:36721454-36721476 CAGTGAGAGAAGGGGGATAAGGG - Intergenic
1081263063 11:40985011-40985033 CAGTGAGAGGAGGCTGAGGCAGG - Intronic
1081493176 11:43582370-43582392 CAATGAGTGGAGGGGGAGGAGGG - Intronic
1081812944 11:45923355-45923377 CAGTGTGCGGAGGGGGCAGCAGG - Intronic
1082004412 11:47411848-47411870 CAGTGAGTGGGGTGGGATGAAGG + Intronic
1082988067 11:59184971-59184993 CAGAGAGAGGAGGGGGAAAGGGG - Intronic
1083168916 11:60910483-60910505 TTGAGACAGGAGGGGGAAGAGGG - Intergenic
1083250543 11:61464008-61464030 AGGAGAGAGGAGAGGGAAGAGGG - Intronic
1083295872 11:61715455-61715477 CAGGGGGATGGGGGGGAAGAAGG - Intronic
1083544437 11:63538192-63538214 GAGGGAGAGGAGGGTGAGGAAGG + Intronic
1083553728 11:63609644-63609666 CAGAGAGAGAAGGAGGAGGAGGG + Intronic
1083933925 11:65860646-65860668 CAGGGCGGGGCGGGGGAAGAGGG - Exonic
1084476082 11:69390565-69390587 GAGGGAGAGGAGGAGGAGGAGGG + Intergenic
1084596154 11:70118190-70118212 GAGGGGGAGGAGGGGGAAGAGGG - Intronic
1084840870 11:71846186-71846208 CAGTCAGGGGATGGGGAGGAGGG - Intergenic
1084908634 11:72369403-72369425 GTGGGGGAGGAGGGGGAAGAGGG - Intronic
1084941476 11:72615519-72615541 GAGTGTGGGGAGGGGGAGGATGG + Intronic
1084953272 11:72678329-72678351 AAGGAAGAGGAGGGGGAAGTCGG - Intergenic
1085068842 11:73523050-73523072 CAATGAGAGGAGGGGGCTGCTGG + Intronic
1085362491 11:75903093-75903115 AAGAGAGAGGAGGAGGAGGAAGG - Intronic
1085431543 11:76454918-76454940 CAGTATTAGGAGGGGGAGGAGGG - Intronic
1085547347 11:77332314-77332336 GCGTGAGAGGAAGGGGGAGAGGG + Intronic
1086602840 11:88656268-88656290 CAGTGAGAAGAGGGAGAAATTGG - Intronic
1086737885 11:90329831-90329853 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1087076989 11:94134662-94134684 GAGGGAGAGAAGGAGGAAGAGGG - Intronic
1088542911 11:110931696-110931718 AAATGGGAGGAGGGGAAAGAAGG - Intergenic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088694573 11:112355843-112355865 CAGTGAGAGGAGGTGCCAGCAGG + Intergenic
1088728995 11:112664217-112664239 CAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1088807442 11:113365376-113365398 GAGTGGGAGGGAGGGGAAGAAGG - Intronic
1088827802 11:113510357-113510379 CAGAGAGTGGAAGGGGAATAGGG + Intergenic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1088966333 11:114725402-114725424 CAGTGAGATGAGGAAGAAGGAGG - Intergenic
1089055276 11:115580080-115580102 GAGTGAGGGGTGGGGGAACATGG + Intergenic
1089254048 11:117184702-117184724 CTGTGATAGGAGGGGAAAGAAGG + Intronic
1089327367 11:117666560-117666582 GAGAGAGAGGAGTGGGAAGTTGG - Intronic
1089398813 11:118152820-118152842 GAGCGAGAGGAGGGGGAGGGAGG + Exonic
1089508336 11:118979683-118979705 CCCTGCGAGGAGGGGGAAGTGGG + Intronic
1089558518 11:119330438-119330460 GAGAGAGAGGAGGGGGAAGAAGG - Intergenic
1089905227 11:122031424-122031446 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1089928859 11:122288140-122288162 CAGTGAGAGGAGGGGGACGTAGG + Intergenic
1090502961 11:127279711-127279733 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1090580511 11:128153822-128153844 CAAAGAGAGGAGGGGCAACAGGG + Intergenic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090732031 11:129580457-129580479 CAGTGAGGGGCCGGGGAAGGAGG + Intergenic
1090781395 11:130010189-130010211 CAGGAAGAGAAAGGGGAAGAGGG + Intergenic
1090785635 11:130044877-130044899 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1090785638 11:130044886-130044908 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1090785641 11:130044895-130044917 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1090817183 11:130308812-130308834 TAGGGAGTGGAGTGGGAAGATGG - Intronic
1202815144 11_KI270721v1_random:43690-43712 GAGGGAGAGGAGGGGGCAGGAGG + Intergenic
1091493578 12:952976-952998 AAGGGAGGGGAGGGGGGAGAGGG + Intronic
1091590257 12:1838490-1838512 CAGGGAGAGGAAGTGGCAGAAGG + Intronic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1091603128 12:1929918-1929940 GAGGGGGAGGAGGAGGAAGAGGG + Intergenic
1091635636 12:2194410-2194432 TGCTCAGAGGAGGGGGAAGAGGG - Intronic
1091800718 12:3323050-3323072 GAAGGAGAGGAGGGAGAAGAAGG + Intergenic
1091891116 12:4055368-4055390 AAGGGAGAGCAGGGGGAAGCTGG - Intergenic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092019207 12:5186467-5186489 CACATAGAGGAGAGGGAAGAAGG - Intergenic
1092796097 12:12111343-12111365 GAGGAAGAGGAGGAGGAAGAAGG + Intronic
1092850187 12:12619067-12619089 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
1093125252 12:15321712-15321734 CAGGCAGAGGAGGAGGAAGAGGG + Intronic
1093282594 12:17212565-17212587 GAGAGAGAGGAAAGGGAAGAGGG - Intergenic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1093802038 12:23385528-23385550 CAGGGAAAGGAGGGGAAAAAAGG + Intergenic
1093844280 12:23949802-23949824 GAGAGAGAGGAGGGGAAGGAGGG - Intronic
1094083832 12:26566475-26566497 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
1094129903 12:27063588-27063610 CAGGAGGAGGAGGAGGAAGAAGG - Intronic
1094234389 12:28146890-28146912 GAGGAAGAGGAGGGGGGAGAAGG - Intronic
1094491662 12:30964426-30964448 GAGGAAGAGGAGGAGGAAGAGGG - Intronic
1095585295 12:43843163-43843185 GAGGGGGAAGAGGGGGAAGAGGG - Intronic
1095728372 12:45476809-45476831 CAGTCAAAGGAGGAAGAAGAGGG - Intergenic
1095947481 12:47761698-47761720 CAGTCAGAGGAGGGTGGAGGCGG - Intronic
1095947813 12:47763743-47763765 CAGTGATGGGAGGGAGAGGAGGG + Intronic
1096101716 12:48973813-48973835 CAATGACAGGAGGGGGAAAGTGG + Intergenic
1096258655 12:50077668-50077690 CAGAGAGAGATGGGGGAAAAGGG + Intronic
1096411322 12:51379022-51379044 AAGTGAGATGATGTGGAAGAAGG - Intronic
1096453982 12:51770275-51770297 CAGTGAGAGGGAGGAGAAAAGGG - Intronic
1096489309 12:52005114-52005136 AGGTGGGAGGAGGGAGAAGAAGG + Intergenic
1096578456 12:52569447-52569469 CAGTGGGAGGAGGAGACAGAGGG + Intronic
1096608808 12:52787703-52787725 CAGAGAGAGGGTGGAGAAGAGGG - Intergenic
1096692996 12:53332738-53332760 AAGGGGGAGGAGGAGGAAGAAGG + Intronic
1096793892 12:54061974-54061996 GAGGAAGAGGAGGGGGAGGAGGG - Intergenic
1096799680 12:54101901-54101923 AAGGCAGAGGAGGAGGAAGAAGG - Intergenic
1096951800 12:55480104-55480126 GAGGGAGAGGAAGAGGAAGAGGG + Intergenic
1097064374 12:56309988-56310010 CAGAGACAGGAAGGGGAAAATGG - Exonic
1097068773 12:56339636-56339658 CAGTGAATGGAGTAGGAAGAGGG + Intronic
1097182173 12:57177777-57177799 CAGGTAGAGGAGGCGGAAGCAGG + Intronic
1097185869 12:57196024-57196046 CAGTCTGGGGAGGGGGCAGAGGG - Intronic
1097196226 12:57243698-57243720 CTGGGAGAGGAGGGGTAGGAAGG - Exonic
1097261826 12:57724879-57724901 CATGGAGAGGGGTGGGAAGATGG - Intronic
1097368480 12:58746240-58746262 AAGTGAGAGGAGGGGAAGGTGGG + Intronic
1097376074 12:58844459-58844481 GAGGGAAAGGAAGGGGAAGAAGG + Intergenic
1097845735 12:64363528-64363550 CTTTGCGAGGAGGAGGAAGAGGG + Intronic
1097867177 12:64568535-64568557 GAGACAGAGGAAGGGGAAGAAGG - Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098489567 12:71059697-71059719 CGGGGAGAGGTGGGGGATGAAGG + Intronic
1098905687 12:76159908-76159930 TAGTAGGAGGAGGGGGATGAAGG - Intergenic
1098917866 12:76275899-76275921 CAGAGAGAGGGGAGGGAGGAAGG + Intergenic
1098995736 12:77117401-77117423 CTTAGAGAGCAGGGGGAAGATGG - Intergenic
1099040866 12:77653245-77653267 CAGTGATAGAAAGGGGAACAGGG - Intergenic
1099617172 12:84950811-84950833 GAGTGGGAGGAGGGTGAGGATGG + Intergenic
1099758366 12:86885702-86885724 CAGAGAGAAGAGGGGAAAGTTGG - Intergenic
1100067668 12:90669668-90669690 CAGTGAAAAGAGGAAGAAGAGGG - Intergenic
1100309304 12:93378767-93378789 CAGCGAGAGGAGGGTGGAAATGG + Intronic
1100550679 12:95644186-95644208 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1100550684 12:95644195-95644217 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1100703558 12:97175920-97175942 CAGAGAGATGAAAGGGAAGAAGG - Intergenic
1100857204 12:98768050-98768072 CAGTGAGAACTTGGGGAAGAGGG - Intronic
1101893718 12:108738562-108738584 TAGTGAGAAGTGGGGGGAGAGGG - Intergenic
1102045244 12:109825770-109825792 AAATCAGAGGAGGGGGAAGAGGG + Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102390344 12:112544477-112544499 CAGTGGGGGTAGGGGAAAGAGGG + Intergenic
1102518955 12:113467473-113467495 CAGTCAGGGAAGGGAGAAGAGGG - Intronic
1102560250 12:113756953-113756975 CAGAGATGGGAGGGAGAAGAGGG - Intergenic
1102658611 12:114505077-114505099 CATTGAGTGGTGGGGGAGGAAGG + Intergenic
1102745273 12:115244104-115244126 CAGGGAGAGGAAGGGAGAGAGGG + Intergenic
1102840348 12:116113694-116113716 CAGTGAGTGGAGGAGGAAGAGGG + Intronic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103005088 12:117414632-117414654 CAGGAAGAGGAGGAGGAAGGAGG - Intronic
1103023692 12:117556707-117556729 AAGTGAGAGGACAGGGAAGGAGG + Intronic
1103191943 12:119008947-119008969 CAATGAGAGGAGGGAGGGGAAGG - Intronic
1103237684 12:119386979-119387001 GAGAGAGTTGAGGGGGAAGAGGG - Intronic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1104071972 12:125353721-125353743 CAGTGAGCTGTGGGGGATGAAGG - Intronic
1104088400 12:125494819-125494841 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
1104163751 12:126206050-126206072 CTGTGAGAGAAGGGGTATGATGG + Intergenic
1104225064 12:126823530-126823552 CGGAGAGAGGAGAGGGAACAAGG - Intergenic
1104250906 12:127092840-127092862 CAGGGAGAGAATGGGGAACAAGG + Intergenic
1104282718 12:127392455-127392477 AAGGGAGAGGAGGAGGAAAAAGG + Intergenic
1104376625 12:128268879-128268901 GTGAGAGAGGGGGGGGAAGAAGG + Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104545654 12:129710807-129710829 CATTGAGAGGAGGCGGCGGAAGG - Intronic
1104644278 12:130486062-130486084 CAGTGGCTGGAGGGGGATGAGGG - Intronic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1104653143 12:130552230-130552252 CAGCCAGAGTAGGGGGTAGAGGG + Intronic
1104707414 12:130957901-130957923 CAGTGAGAGGAGGACGAGGAAGG - Intronic
1104962767 12:132495988-132496010 GAGGGAGGGGATGGGGAAGAGGG - Intronic
1105446575 13:20462196-20462218 TAGTGGGAGGAGGGGGCAGGAGG + Intronic
1105451263 13:20502335-20502357 CTGAGTGAGGAGGGGGAAGCGGG - Intronic
1105595871 13:21837405-21837427 CAGTGAGAGAAAGGGGCAGGGGG - Intergenic
1105853812 13:24358620-24358642 CAGTCAGAGAAGGGGACAGAGGG + Intergenic
1105969905 13:25418996-25419018 AAGAGAAGGGAGGGGGAAGAAGG + Intronic
1106243102 13:27925535-27925557 GAGGAAGAGGACGGGGAAGAAGG - Exonic
1106333067 13:28756945-28756967 CAGTGAGAGTAGAGGAGAGAAGG - Intergenic
1106559762 13:30838130-30838152 CAGTGACAAGAGTGGAAAGAAGG + Intergenic
1106841150 13:33686006-33686028 CAGAAAGAGGGTGGGGAAGATGG + Intergenic
1107421131 13:40247849-40247871 TAGAGAGAGGATGGGGATGAGGG + Intergenic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1107932302 13:45316289-45316311 GAGGGGGAGGAGGGGGAGGAGGG + Intergenic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1109036785 13:57273049-57273071 CACTGAAAGGTGGGGGAATAAGG + Intergenic
1109206386 13:59487520-59487542 CAGTGAGAGAGGGAGCAAGAGGG + Intergenic
1109237266 13:59839843-59839865 CAGTGAGTAGATGGGAAAGATGG + Intronic
1109933436 13:69246457-69246479 CAGTCAGAGTAGGGGGCTGATGG - Intergenic
1110292181 13:73819983-73820005 CAGAGAGAGGAGGCAGAGGAGGG + Intronic
1110298150 13:73894051-73894073 TAGTGAGAGACAGGGGAAGATGG + Intronic
1110428152 13:75392601-75392623 GAGGAGGAGGAGGGGGAAGAAGG - Intronic
1110761777 13:79238626-79238648 AAGAAAGAGGAGGAGGAAGAGGG + Intergenic
1110867632 13:80414530-80414552 GATTGGGAGGAGGGTGAAGATGG + Intergenic
1110903384 13:80853885-80853907 CAGTGAGAGAAGGGAGAAATTGG - Intergenic
1111713995 13:91854533-91854555 TAGTTTGGGGAGGGGGAAGAGGG - Intronic
1111830364 13:93321958-93321980 GAGGTGGAGGAGGGGGAAGAAGG - Intronic
1111915048 13:94351939-94351961 CAAGGAGAGGAGAGAGAAGAAGG + Intronic
1112311079 13:98318019-98318041 AAGAGGGAGGAGGAGGAAGAAGG - Intronic
1112585051 13:100711717-100711739 GAGAGAGAGGAGGAGGAAGAGGG - Intergenic
1112626569 13:101111459-101111481 CAGAAGGAGGAGGGGCAAGAGGG - Intronic
1112667542 13:101593748-101593770 CAGAGACGGGAGGAGGAAGATGG + Intronic
1113146056 13:107208877-107208899 GAGGGGGAGGAGGGGGAGGAAGG - Intronic
1113331795 13:109334514-109334536 CAGAGAGGGGCAGGGGAAGAAGG - Intergenic
1113339918 13:109412432-109412454 CAGTGTGAGGGAGGGGAAGAGGG - Intergenic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113643305 13:111973696-111973718 CAGAGAGAGGAGGAGAGAGATGG - Intergenic
1113695255 13:112341671-112341693 GAGAGAGAGGCGGGGGGAGAGGG - Intergenic
1113754762 13:112803769-112803791 CAGGGAGGGGAGGGAGAGGAAGG - Intronic
1113822261 13:113222921-113222943 CCATGAGAGGAGGTGGATGAGGG + Intronic
1113909734 13:113836371-113836393 GATGGAGAGGAGGGGGAGGAGGG + Intronic
1114287946 14:21262985-21263007 CAGTGTGGGGAAGGGGATGAGGG + Intronic
1114317515 14:21522399-21522421 AGGAGAGAGGAGGGGGAAGAAGG + Exonic
1114673721 14:24428229-24428251 GAGGGTGGGGAGGGGGAAGAAGG - Intronic
1115217488 14:31026896-31026918 GAGTGACAGGAAGGGAAAGAGGG - Intronic
1115498275 14:34027420-34027442 AGGGGAGGGGAGGGGGAAGAAGG + Intronic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1115697764 14:35919055-35919077 GGGAGAGAGAAGGGGGAAGAAGG + Intronic
1115838570 14:37439291-37439313 GATAGAGAGGAGGAGGAAGAGGG + Intronic
1116043612 14:39715999-39716021 CATTAAGAGCAAGGGGAAGAGGG - Intergenic
1116056208 14:39866657-39866679 GAGGGAGAGCAGGAGGAAGAAGG + Intergenic
1116065871 14:39982380-39982402 CAGGGAGAGGAGAGGAAAAAGGG + Intergenic
1116142518 14:41016647-41016669 CACTGAGAGGAGGGGCCAGCTGG - Intergenic
1116810283 14:49533514-49533536 CAGTGAGAGGAAGAGGTAGGAGG - Intergenic
1117008919 14:51450545-51450567 CAGTGAGATGTGGGCTAAGATGG + Intergenic
1117225341 14:53652831-53652853 TAGTAAGAAGAAGGGGAAGATGG - Intergenic
1117617271 14:57546404-57546426 AAGTGAGAGGAAAGGGAGGAAGG + Intergenic
1117761661 14:59035422-59035444 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1117834344 14:59786633-59786655 AAGAGGGAGGATGGGGAAGAAGG + Intronic
1117842154 14:59870819-59870841 GAGGAAGAGGAGGGGGGAGAAGG - Exonic
1118171884 14:63396019-63396041 AAGAGAGGGGAGGGGGAAGATGG + Intronic
1118317892 14:64736920-64736942 CAGTGAGCGGGGGAGGAGGAGGG + Intronic
1118548577 14:66922782-66922804 TAGTAGGAGGAGGGGAAAGAGGG - Exonic
1118640398 14:67787047-67787069 TAGTAAGGGGTGGGGGAAGATGG + Intronic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1118878509 14:69805763-69805785 CACTGAGGGGCGGGGGAAGCAGG + Intergenic
1118973151 14:70654242-70654264 CAGAGAGAGCTGGGGGATGAGGG - Intronic
1118979071 14:70701601-70701623 TAGGGAAAAGAGGGGGAAGAGGG + Intergenic
1119074341 14:71621037-71621059 CAGGGGCAGGAGGGAGAAGATGG - Intronic
1119087161 14:71749299-71749321 CAGTGAGAGGAGTGGGGAACAGG - Intergenic
1119123030 14:72097671-72097693 CCGGCAGAGGAGGGGGAGGAAGG - Intronic
1119180390 14:72601062-72601084 GAGGGGGAGGAGGAGGAAGAAGG + Intergenic
1119235131 14:73013304-73013326 CATTGAGAAGAGGGGCAAAATGG + Intronic
1119442547 14:74637994-74638016 GAGAGAGAGAAGGGGGAAGTGGG + Intergenic
1119850161 14:77861293-77861315 AAGGGGGAGGAGGAGGAAGAGGG - Intronic
1120306945 14:82782845-82782867 CAGACAGAGGAGGAGGAAGAAGG - Intergenic
1121254638 14:92522185-92522207 CTAACAGAGGAGGGGGAAGAAGG - Intronic
1121306978 14:92912674-92912696 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121699957 14:95945114-95945136 AAGTGAGAGAAGGGAGCAGAGGG - Intergenic
1121800323 14:96769123-96769145 AAGGGAGAGGGGAGGGAAGAAGG - Intergenic
1121840286 14:97128451-97128473 CAGGGAGGGGAGGGGGAGGGGGG + Intergenic
1121957263 14:98225909-98225931 AAGAGAGAGAAGGGGAAAGAAGG - Intergenic
1122126327 14:99580463-99580485 CAGTGAGGGGAGGGGGGGAAGGG + Intronic
1122160360 14:99779869-99779891 CAGTGAGAGGAAGGAGACGGGGG + Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122448142 14:101782901-101782923 GAGGGAGGGGAGGGGGAAGGGGG - Intronic
1122651678 14:103230046-103230068 GAGAGAGAGGAGGGGGAATGAGG + Intergenic
1122741172 14:103872307-103872329 CAGGGAGGGGCGGGGGAAGCTGG - Intergenic
1122842591 14:104473623-104473645 CAGTCAGAGGCAGGGGCAGAGGG + Intergenic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1124347463 15:28932146-28932168 CAATGAGATGAGGGGTAGGAGGG + Intronic
1124619366 15:31265170-31265192 CAGGGAGTGGAGGGGGCAGAGGG + Intergenic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1125198619 15:37077712-37077734 CCGAGAGGGGAGGGGGAAGGGGG + Intronic
1125367343 15:38932317-38932339 CAGTGAGGGGAGGCTGAGGATGG + Intergenic
1125686187 15:41564649-41564671 CAGAGAGAGGGGGAGGGAGAGGG + Intronic
1125861375 15:43004363-43004385 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1126157636 15:45580312-45580334 CAATGAAAGCAGGGGGAAAAAGG + Intergenic
1126354154 15:47777114-47777136 CAGTTAGAGCAGTGGTAAGAAGG + Intergenic
1126524019 15:49630185-49630207 TGGTGAGAGGAGAAGGAAGAAGG + Intronic
1126540056 15:49812583-49812605 AATTAAGAGGAGGAGGAAGAAGG - Intergenic
1126623756 15:50666424-50666446 GAATGAGAGAAGGGAGAAGAAGG + Intronic
1126785394 15:52174450-52174472 CTGTGGGAGGAAGGGGAAAATGG + Intronic
1126799253 15:52285407-52285429 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1126799272 15:52285465-52285487 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1127124905 15:55802359-55802381 CAGAGAGAGGAGTGGGAGGTGGG + Intergenic
1127129179 15:55844186-55844208 AAGGGAGAGGAAGGGAAAGAAGG + Intronic
1127137562 15:55940506-55940528 GAGAGAGAGAAGGGGGAGGAGGG - Intronic
1127566499 15:60194280-60194302 CAGGAAGAGGAGAGGGAACAGGG - Intergenic
1127620020 15:60724894-60724916 CAGTGTGAGGAGCGGGGAGGAGG - Intronic
1127815953 15:62608922-62608944 AAGTCAGAGGAGGGATAAGATGG + Intronic
1127819199 15:62640370-62640392 CAGAGAGAAGAGGGGGACGGTGG + Intronic
1127907576 15:63387646-63387668 CAGAGAGGGAAGGGGGAGGAAGG + Intergenic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1128130701 15:65225332-65225354 CAGTGAGAGGAACCGGAAGCTGG + Intergenic
1128249106 15:66152380-66152402 CAGTGAGAGGAAGGGTGAGGAGG - Intronic
1128425950 15:67542704-67542726 CGGCGAGAGGAGGAGGAGGAAGG - Exonic
1128819756 15:70641177-70641199 CAGGCAGAGAAGGGTGAAGATGG + Intergenic
1128886590 15:71293802-71293824 AAGGGAGAGGAGGTGTAAGATGG + Intronic
1129000019 15:72325026-72325048 GAGAGAGAGGAGAGGGGAGATGG - Intronic
1129522696 15:76195939-76195961 CAGAGAGAGGAGGAGCAGGAGGG - Intronic
1129535794 15:76312705-76312727 CAGTGAGAGAAGAGGGCAGTGGG - Intergenic
1129665312 15:77576322-77576344 GAGGAGGAGGAGGGGGAAGAGGG + Intergenic
1129697781 15:77750257-77750279 TAGTGAGAGTAGGGGAGAGAAGG - Intronic
1129907967 15:79203023-79203045 CAGTGAGAGGCAGAGGAATAAGG + Intergenic
1130068405 15:80626253-80626275 CAGAGAAAGGAGGTGGAAGGAGG - Intergenic
1130669252 15:85895974-85895996 CAGAGAGAAGAAGGGGCAGAGGG - Intergenic
1130721016 15:86386078-86386100 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
1130731195 15:86493853-86493875 CAGTCAGGGGAGGGGGAAGTGGG - Intronic
1130959805 15:88652342-88652364 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
1131123845 15:89841414-89841436 CAGGGAGAGGACAGGGAAGCTGG + Intronic
1131519197 15:93100509-93100531 CAGTGAGATGAGGAGCAATAAGG + Intergenic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1131797533 15:96034838-96034860 CAGTGAGAGAAGGCTGCAGAGGG - Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132284369 15:100650439-100650461 CAGGGATAGGAGGAGGCAGAGGG + Exonic
1132978432 16:2721609-2721631 GAGGGCGAGGAGTGGGAAGAGGG + Intergenic
1133011414 16:2914042-2914064 GAGTGATAGGAGCGGGAGGAGGG - Intronic
1133023583 16:2977732-2977754 CAGTGCTAGGCGGGGGGAGAGGG - Intronic
1133324453 16:4934868-4934890 CACTAAGGGGAGGGGGCAGAGGG + Intronic
1133417285 16:5616532-5616554 GAGGGAGAGGAAAGGGAAGAGGG - Intergenic
1133443721 16:5841996-5842018 CAGGGAGAGGAGGATGAGGATGG - Intergenic
1133548087 16:6827640-6827662 AAGGGTGAGGAGGGGGAAGGAGG - Intronic
1133640531 16:7712627-7712649 GGGTGAGGGGAGGGGCAAGAGGG + Intronic
1133647247 16:7775856-7775878 AGGGGAGAGCAGGGGGAAGAGGG + Intergenic
1133742298 16:8660827-8660849 GAGGGGGAGGAGGGGGAGGAGGG + Intergenic
1134047983 16:11115252-11115274 AAAGGAGAGGAGGGGGAAGGAGG + Intronic
1134122742 16:11596544-11596566 CAGAGAGGGGAGGAGGCAGAGGG + Intronic
1134208795 16:12259046-12259068 GAGAGAGAGGAGGGGGAATCTGG - Intronic
1134240458 16:12502216-12502238 CAGTGAGGGGCGGTGGAGGAGGG + Intronic
1134316782 16:13126408-13126430 CAGAGAGAGGAAGAGGAAGAGGG + Intronic
1134771182 16:16811175-16811197 CAGTGAGAGGTGCAGGAAAAAGG - Intergenic
1134980358 16:18603494-18603516 CAGGGAGGGGAAGGGGAAGAAGG + Intergenic
1135381186 16:21997417-21997439 CTGTCAGAGGAGGGGGAGGCAGG + Intronic
1135383078 16:22009479-22009501 GAAAGAGAGGCGGGGGAAGAGGG - Intronic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1135619656 16:23944942-23944964 CAGAGAGAGGAGGGGACTGAGGG + Intronic
1135639884 16:24110133-24110155 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
1135639887 16:24110142-24110164 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
1135695328 16:24581361-24581383 CGGTGGGGGGAGGGGGAAGATGG - Intergenic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1136102196 16:28004331-28004353 CAGTGGCTGGAGGGGGATGAGGG + Intronic
1136287364 16:29252438-29252460 CACTGAGGGGAAGGGGCAGAGGG - Intergenic
1136316798 16:29459229-29459251 GAGTGAGTGGAGGGGAAAGGTGG - Intergenic
1136431373 16:30198571-30198593 GAGTGAGTGGAGGGGAAAGGTGG - Intronic
1136542715 16:30937304-30937326 CAGCAAGGGGAGGGGGAGGAGGG - Intronic
1136610302 16:31361940-31361962 CCGTGAGGGGAGGGGGAGCAGGG + Intronic
1136641443 16:31568904-31568926 CGCTGGGAGGAGGAGGAAGAAGG - Intergenic
1137557076 16:49477335-49477357 GAGGGGGAGGAGGGGGAGGAGGG + Intergenic
1137715547 16:50596107-50596129 CAGTGAGAGCAGTGAGAAGCAGG + Intronic
1137928263 16:52562423-52562445 GAGAGAGAGGTGGGGGAGGAGGG - Intergenic
1138028041 16:53538518-53538540 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1138028044 16:53538527-53538549 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1138028047 16:53538536-53538558 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1138028050 16:53538545-53538567 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138104481 16:54280399-54280421 CCCTGAGAGGAGGGAGATGAGGG + Intergenic
1138116289 16:54363041-54363063 GGGTGAGAGCAAGGGGAAGAGGG - Intergenic
1138222372 16:55263572-55263594 CGGAGAGAGGAAGGAGAAGAGGG - Intergenic
1138237639 16:55398525-55398547 CAGAGATAGGAAGGGAAAGAGGG + Intronic
1138276828 16:55741049-55741071 CGGTCAGAGGAGGGTGAGGATGG + Intergenic
1138320207 16:56105189-56105211 CCCTTACAGGAGGGGGAAGATGG + Intergenic
1138358567 16:56406062-56406084 GAGAGAGAGGAGGGGGAGGGGGG + Intronic
1138817156 16:60215653-60215675 CATGTAGGGGAGGGGGAAGATGG + Intergenic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1139328441 16:66169416-66169438 AAGAGAGAGGTGGGGAAAGAAGG + Intergenic
1139492064 16:67291521-67291543 CAGTGTGAGGAGGGGGAGAGGGG + Intronic
1139706941 16:68747307-68747329 CAGAAAGAGGAGGGAGGAGAGGG + Intronic
1139721890 16:68862836-68862858 TTGTGAGAGGAGCGGAAAGAAGG - Intronic
1139820890 16:69720396-69720418 AAGTGAGAGGAAGGGAGAGAGGG + Intronic
1139868957 16:70088283-70088305 CAGTGAGAATAGGGGGGAGATGG - Intergenic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1140046470 16:71443085-71443107 CAATGACTGGAGGGTGAAGAAGG - Intergenic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140333074 16:74076533-74076555 CAGTGGGAGGGAGGGAAAGAAGG - Intergenic
1140386430 16:74543889-74543911 CAGTGAGAATAGGGGGGAGATGG + Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140485060 16:75287185-75287207 CAGAGATAGGAGGGGTTAGAAGG + Intergenic
1140692615 16:77498829-77498851 GAGTCAGAGGCGGGGGAGGAAGG + Intergenic
1140993903 16:80242524-80242546 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1140993906 16:80242533-80242555 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1140993909 16:80242542-80242564 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1141186263 16:81789772-81789794 GAGGGAGAGGAGGGGGAAGGTGG - Intronic
1141210172 16:81972379-81972401 AAGTGGGGGGAGGGGGAAGAAGG - Intergenic
1141427141 16:83951884-83951906 CAGGGAGAGAAGGAGGAAGGAGG - Intronic
1141514591 16:84535184-84535206 GAGGAAGAGGAGGGGAAAGAGGG - Intronic
1141609169 16:85171386-85171408 CACGGTGAGGAAGGGGAAGAAGG - Exonic
1141619594 16:85229873-85229895 CAGGGTGAGAAGGGGGTAGAGGG + Intergenic
1141625358 16:85258634-85258656 CTGTGGGAGGAGGAGGGAGAGGG + Intergenic
1141637337 16:85321316-85321338 AGGAGAGAGGAGGGCGAAGAAGG + Intergenic
1141667758 16:85474655-85474677 AAAGGAGAGGAGGGGGAAGAGGG - Intergenic
1141683069 16:85555331-85555353 CAGAGAGAGGGGGTGGAAGGAGG - Intergenic
1141703628 16:85653308-85653330 AAGTGGGAGGAGGAGGAGGAGGG - Intronic
1141743856 16:85913103-85913125 CAGTCAGGGGAGGGAGAGGAGGG - Intronic
1141891769 16:86930911-86930933 GAGGGGGAGGAGGGGGAAGAAGG - Intergenic
1142254385 16:89006850-89006872 GAGGGAGGGGAGGGGGGAGATGG - Intergenic
1142313090 16:89325436-89325458 GAGAGAGAGGAGAGGGGAGAGGG - Intronic
1142353137 16:89588871-89588893 CAGGGGGGTGAGGGGGAAGACGG - Intronic
1142374026 16:89697673-89697695 CAGAGAGAGGAAGGAGAAGGCGG + Exonic
1142507939 17:377233-377255 CAGAGAGAGTGGGGAGAAGAGGG + Intronic
1142540477 17:654926-654948 CAGTGAGAGCAGCGGCCAGAGGG - Intronic
1142582299 17:949693-949715 CAGGGAGAGGAGGAGGCAGGGGG - Intronic
1142781624 17:2185746-2185768 TAGTGAGAAGACGGGGACGAGGG + Intronic
1142875304 17:2848897-2848919 AAGACAGAGGAGGGGGAAGAGGG - Intronic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142913372 17:3113610-3113632 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1142913375 17:3113619-3113641 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143065082 17:4240814-4240836 CAGTGAGAGGTGGGAAAAGCAGG - Intronic
1143153087 17:4819010-4819032 GAGTGAGAGGAGGTGGGACAGGG + Intronic
1143373786 17:6455702-6455724 AAGGGAGGGGAGGGGGAAGAGGG + Intronic
1143646761 17:8235238-8235260 CAGTGGGAGGGGGGACAAGAAGG - Exonic
1143851790 17:9818281-9818303 AAGAGAGAGAAGGGGGAAGGTGG + Intronic
1143965828 17:10755969-10755991 GAGAGAGAGGAAGGGAAAGAGGG - Intergenic
1144580437 17:16456077-16456099 GAGGGAGAGGAGGAGGAGGAAGG + Intronic
1144695670 17:17302443-17302465 GAGTGGGAGGAGGGTGAGGATGG + Intergenic
1144746726 17:17620905-17620927 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1144768759 17:17747364-17747386 CTGTCAGAGGATGTGGAAGATGG + Intronic
1144834676 17:18150677-18150699 GACTGAGGGGAGGGGGCAGAAGG - Exonic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1146282611 17:31554784-31554806 CAGTGAGTGGTGGGGGAGGGGGG - Intergenic
1146526509 17:33571522-33571544 CAGTGACAGGAGCTGGGAGAGGG - Intronic
1146634318 17:34492834-34492856 CAGTGAGGGGAAGCTGAAGATGG + Intergenic
1146926789 17:36751032-36751054 CGGTGACAGGAGGAGGAAGGAGG + Intergenic
1147167919 17:38603189-38603211 CAGGGAAGGGAGGGGGGAGAGGG + Intronic
1147178563 17:38671554-38671576 TTGTGGGAGGAGGAGGAAGAAGG - Intergenic
1147269354 17:39256691-39256713 CAGTGAGAGGAGGGGTTTAAAGG - Intergenic
1147278244 17:39336956-39336978 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1147313031 17:39606325-39606347 GAGGAAGAGGAGGAGGAAGAAGG - Exonic
1147313468 17:39607777-39607799 GAGAGAGAGGGGGGAGAAGAGGG + Exonic
1147553408 17:41461056-41461078 AGGTGAGTGGAGAGGGAAGAGGG - Intronic
1147930429 17:43977176-43977198 CAGGGAGAGGGAGGGGGAGAGGG + Intronic
1148063627 17:44853186-44853208 CAGAGAGAGGAGGGTAGAGAAGG + Intronic
1148462376 17:47846119-47846141 CTGTGAGATGAGGGGGAGGAAGG + Exonic
1148860867 17:50603781-50603803 CAGAGAGGGGAAGGGGCAGAGGG - Intronic
1149052967 17:52328792-52328814 GAGGAAGAAGAGGGGGAAGAGGG - Intergenic
1149358059 17:55864607-55864629 CAGTATGAGGAGGTGGAATAAGG - Intergenic
1150157720 17:62868361-62868383 CAGTGGGAGGAGTAGGAATAGGG - Intergenic
1150614516 17:66758972-66758994 CAGTGATAGAAGGGATAAGAGGG + Intronic
1151145232 17:72034398-72034420 TGGGGAGAGGAGGGGGAAGCAGG - Intergenic
1151630738 17:75309261-75309283 CAGTGGGGAGAGGGGGACGAAGG + Intergenic
1151683481 17:75633867-75633889 GAGGGAGAGGAGGAGGAAGGAGG + Intronic
1151765356 17:76130876-76130898 TGGTGAGAGCAGGAGGAAGAGGG - Intergenic
1152204886 17:78969332-78969354 CAATGAGATCAGGAGGAAGAAGG - Intergenic
1152249290 17:79203247-79203269 CTGGCAGAGGATGGGGAAGAGGG + Intronic
1152558007 17:81064138-81064160 GAATGAGAAGAGGAGGAAGAAGG - Intronic
1152640130 17:81445833-81445855 CATTGGGAGGACTGGGAAGAGGG - Intronic
1152657389 17:81526293-81526315 CCGTGAGCGGTGGGGGAAGCCGG - Intergenic
1152726976 17:81952315-81952337 GAGGGAGAGGAGGGGAGAGAGGG + Intergenic
1152844276 17:82590161-82590183 CAGAGAGAGGAGGTGGCAGATGG + Intronic
1152942284 17:83178959-83178981 CAGGGAGAGGAGGCAGAAGCCGG - Intergenic
1153092705 18:1366586-1366608 GAGGGAGAGAAGGAGGAAGAGGG - Intergenic
1153185227 18:2478801-2478823 GAGAAAGAGGAGGAGGAAGAAGG + Intergenic
1153185250 18:2478905-2478927 AAGAGGGAGGAGGAGGAAGAAGG + Intergenic
1153276552 18:3373455-3373477 TAGTGAGAGGAGGAGCGAGAGGG + Intergenic
1153519947 18:5942113-5942135 AACTGAGAGGAGAGGGGAGAAGG + Intergenic
1153737108 18:8082529-8082551 CAGAGAGAGAAGGGGAGAGAGGG - Intronic
1153913232 18:9722082-9722104 GAGGGAGAGGAGGGTGTAGAAGG + Intronic
1153957837 18:10113291-10113313 CAGTGAGAGAAGGGAAAGGAGGG - Intergenic
1154026161 18:10709253-10709275 CAGTGACTGGCGAGGGAAGATGG + Intronic
1154072248 18:11163144-11163166 CAATGAGAGGAGGAGGGGGAGGG - Intergenic
1154115632 18:11610582-11610604 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154120079 18:11644797-11644819 CTGTGAGAGGACAGGGAAGGTGG + Intergenic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1154157991 18:11959024-11959046 GAGAGAGAGGAGAGGGGAGAGGG - Intergenic
1154318373 18:13324521-13324543 CAGTGGCAGAACGGGGAAGAGGG + Intronic
1154338980 18:13487899-13487921 CACTGAGAGCAAGGGGGAGATGG + Intronic
1155163114 18:23211501-23211523 CAGTGCAGGGAGGGGCAAGAGGG - Intronic
1155198909 18:23500793-23500815 CAGTCTGAGGAGTGTGAAGAAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155615941 18:27721480-27721502 AAGAGAGAGGAGGGAGGAGAAGG + Intergenic
1155676223 18:28432226-28432248 CTGTCAGAGGAGGGGCAAGTGGG - Intergenic
1155679980 18:28476519-28476541 TAGTGAGAGGTGGTGGGAGATGG + Intergenic
1155871059 18:31028866-31028888 CAGGGAGATGAGGCTGAAGAGGG - Intronic
1156454925 18:37287527-37287549 AAGAGAGAGGAGGAAGAAGAGGG - Intronic
1156463222 18:37333317-37333339 GAGGGAGTGGAGGGGGAGGAGGG - Intronic
1156463238 18:37333353-37333375 AAGGGAGAGGAGGGGGAAGAGGG - Intronic
1156492012 18:37501899-37501921 TGGTGAGAGAAGGGGGAAAATGG - Intronic
1156658265 18:39313457-39313479 CAGCAAGAGGAGAGGGGAGAAGG - Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1156975402 18:43216083-43216105 GTGTGAGAGAAGGGGCAAGAAGG + Intergenic
1157099655 18:44717710-44717732 CAGTGAGAGGAGGGAAGAAATGG - Intronic
1157114825 18:44852790-44852812 CAGTGAGGGGAAGGAGAAGCTGG - Intronic
1157442973 18:47724425-47724447 CTGGGAGAGGCAGGGGAAGATGG - Intergenic
1157451988 18:47795711-47795733 AAGTACGATGAGGGGGAAGATGG + Intergenic
1157763898 18:50283474-50283496 CAGTGAGAGGTGGGGGGTTAAGG - Intronic
1157826109 18:50813846-50813868 GGGTGGGAGGAGGGTGAAGATGG + Intronic
1158219956 18:55140304-55140326 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1158431909 18:57396759-57396781 GGGTGAGAGGAAGGGGAAGAAGG + Intergenic
1158505608 18:58044197-58044219 CGGTGGGAGGAGGCGGAGGAGGG + Intergenic
1159877375 18:73827573-73827595 GAGGAAGAGGAGGAGGAAGAAGG + Intergenic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1160265290 18:77336503-77336525 CAGTGGGAGGAGGTGGAAGGGGG + Intergenic
1160395010 18:78564401-78564423 TAGGGAGAGGAGGGGGAGAAGGG - Intergenic
1160438753 18:78872355-78872377 ACCTGAGTGGAGGGGGAAGATGG + Intergenic
1160478473 18:79216389-79216411 CAGAGAGGGGAGGGTGGAGAGGG - Intronic
1160629856 18:80239210-80239232 CAGGGAGAAGAGGGGGTCGAAGG + Intronic
1160965734 19:1746195-1746217 GAGGGAGAGGAGGAGGAGGATGG + Intergenic
1160965775 19:1746310-1746332 GAGGGAGAGGAGGAGGGAGATGG + Intergenic
1160965798 19:1746366-1746388 GAGGGAGAGGAGGAGGAGGATGG + Intergenic
1160975516 19:1790503-1790525 CAGAGGAGGGAGGGGGAAGAGGG - Intronic
1161022239 19:2015786-2015808 TAGGGGGAGGAGGGGGAGGAGGG + Intronic
1161253100 19:3291753-3291775 GAGAGGGAGGAGGGGGAACATGG + Intronic
1161257301 19:3316494-3316516 CAGAGTGAGGAGGGGGAGAAAGG + Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161422015 19:4181152-4181174 CAGGGAGAGGGAGGAGAAGAGGG - Intronic
1161431214 19:4233432-4233454 CTGGTAGAGGAGGGGGAAGAAGG - Intronic
1161459929 19:4390532-4390554 TAGGGAGAGGAGGGGAGAGAAGG + Intronic
1161480000 19:4505665-4505687 CATTGAGATGATGAGGAAGATGG - Intronic
1161619213 19:5289585-5289607 CAGAGGGAGGAGGGGGAGAAAGG - Intronic
1161620358 19:5293922-5293944 GAGGGAGAGGAGGAGGGAGAGGG + Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161625608 19:5324834-5324856 CAGTGTGAGGATGGGGATGATGG - Intronic
1161684817 19:5697520-5697542 GAGGGAGGAGAGGGGGAAGAGGG + Intronic
1161756428 19:6137456-6137478 CAGAGTGAGGAGGGGGAGGGAGG + Intronic
1161934391 19:7362636-7362658 TGGTGAGGGGAGGGGGAAGATGG - Intronic
1162142123 19:8591355-8591377 CAGGGAGAGGAGGGAAGAGAGGG + Intronic
1162301179 19:9846051-9846073 CAGGGAGAGGAGGGGTGGGAGGG + Intronic
1162502076 19:11059837-11059859 GAGAGTGAGGAGGAGGAAGAGGG + Exonic
1162549733 19:11351736-11351758 GAAGGAGAGGAGGGGGATGAGGG + Intronic
1162556955 19:11392984-11393006 CTGTGACAGGAAGAGGAAGAAGG + Intronic
1163004509 19:14389149-14389171 GAGGGAGAGGAAGGGGAAGAGGG + Intronic
1163004519 19:14389175-14389197 GGGGGAGAGGAAGGGGAAGAGGG + Intronic
1163026037 19:14512918-14512940 CAGTGTGAGGAGTGGGACGGTGG - Intergenic
1163329401 19:16627382-16627404 AGCCGAGAGGAGGGGGAAGAAGG + Intronic
1163350974 19:16776993-16777015 GAGGGAAAGGAGAGGGAAGAGGG + Intronic
1163580343 19:18135059-18135081 CAGGGAGAGAAGCAGGAAGAGGG + Intronic
1163591181 19:18194932-18194954 CGGGGAGAGGCGGGGGATGAGGG - Intronic
1163611532 19:18304392-18304414 GAGAGAGAGGAGGGGGATGGGGG + Intergenic
1163611563 19:18304475-18304497 GAGTGAGAGGAGGGGGATGGGGG + Intergenic
1163627856 19:18401132-18401154 CAGTGAGAGGTGGGGGGAGGGGG - Intergenic
1163686652 19:18715658-18715680 CACTGAGAAGCAGGGGAAGAGGG - Intronic
1163779571 19:19239443-19239465 GAGGGAGAGGAGGGGGAGGGAGG - Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164292430 19:23880275-23880297 GAGGCAGAGGAGGGGGAAGAAGG + Intergenic
1164562682 19:29303761-29303783 CACTGAGATTAGGGGTAAGAGGG - Intergenic
1164972184 19:32542014-32542036 CAGTGGGAGGAGGGTAAGGATGG + Intergenic
1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG + Intronic
1165148532 19:33748023-33748045 CAGGAAGAGGAGGTGGATGAGGG + Intronic
1165157000 19:33795371-33795393 CAGTGGGAGGAAGGTGAAGTGGG - Intergenic
1165245589 19:34496718-34496740 GAGTGAGGGCAGGGGGAAGAGGG + Intronic
1165384790 19:35503969-35503991 CAGAGTGAGGAGGGAGCAGAGGG - Intronic
1165423722 19:35734351-35734373 CAGTGAGAGCAGGTGGCACAGGG + Intronic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1165850932 19:38849980-38850002 CAATGAGAGGCGGGGGGAGGCGG - Exonic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1166100788 19:40570411-40570433 GTGTGAAGGGAGGGGGAAGAGGG - Intronic
1166184220 19:41128847-41128869 GAGAGGGAGGAGGGGGAGGAGGG + Intergenic
1166219285 19:41354360-41354382 CAGTGGGAGGAGGGGGCAACAGG + Intronic
1166250921 19:41570363-41570385 CAGTGAGAGGATGGGCAGGTGGG - Intronic
1166563903 19:43751692-43751714 CACTGGGAGGAAGGGGCAGAAGG - Intronic
1166584620 19:43934954-43934976 CTGTGGGAGGTGGGGGAAGGCGG + Exonic
1166773434 19:45298117-45298139 CAGTGTGAGGAGGGAGGTGAGGG - Intronic
1166832572 19:45647543-45647565 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1166832575 19:45647552-45647574 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1167011847 19:46813741-46813763 GAGGGAGAGGAGGGAGAGGAAGG - Intergenic
1167128450 19:47568213-47568235 CAGGGAGAGAAGGGAGAAGGTGG - Intergenic
1167295572 19:48646926-48646948 GAGGGAGAGGAGGGGGAGGAGGG + Intergenic
1167435256 19:49475208-49475230 GAGACAGAGGAGGGGGGAGATGG + Intronic
1167473561 19:49688136-49688158 CAGGGAGAGGTGGGGCATGAGGG - Intronic
1167508586 19:49883920-49883942 CAGGGACAGGATGGGAAAGAAGG + Intronic
1167608009 19:50492145-50492167 CAGGGAGAGGAAGGGGAGGCAGG + Intergenic
1167686511 19:50960048-50960070 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1168206270 19:54852609-54852631 GCGTGAGAGGTGGAGGAAGAGGG + Intronic
1168296660 19:55380333-55380355 AAGGGAGGGGAGGGGGAAGGGGG - Intronic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
1168517069 19:57017533-57017555 CAGAGGGAGAAGGGGGATGAGGG - Intergenic
1202703905 1_KI270713v1_random:6579-6601 CAGTGAGGGGAATGGGGAGAAGG - Intergenic
925024896 2:599877-599899 CACCCAGAGGAGAGGGAAGAGGG + Intergenic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925199246 2:1952894-1952916 AAGGGAGAGGAAGGGAAAGAAGG - Intronic
925241315 2:2332236-2332258 CAGTCAGTGAAGGGGGAAAAGGG - Intergenic
925363606 2:3296154-3296176 CAGGGAGAGGAGGGGCTGGATGG - Intronic
925902045 2:8515818-8515840 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
925902050 2:8515827-8515849 GAGAGGGAGGAGGGGGAGGAGGG - Intergenic
926059173 2:9794519-9794541 CAGTGAGGGATGGAGGAAGATGG - Intergenic
926177535 2:10609224-10609246 CACTGAGTCGAAGGGGAAGATGG + Intronic
926184741 2:10680306-10680328 GAGGGAGAAGAGGGAGAAGAGGG + Intronic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926401485 2:12501612-12501634 CAGTCAGTGGAGGGGCAGGAAGG - Intergenic
926415248 2:12643241-12643263 CAGTTAGAGGTGGGGGAAGCTGG + Intergenic
926498612 2:13622788-13622810 CAGTGAGTGGAGTGGGAAGGTGG + Intergenic
926756279 2:16238685-16238707 GAATGAAAGGAGAGGGAAGAAGG - Intergenic
926828383 2:16932772-16932794 CAGTCAGAAAAGGGGGAAGAGGG - Intergenic
927258492 2:21061835-21061857 CAGTGAGATGTGAGGGAAGAGGG + Intergenic
927599725 2:24430397-24430419 GAGAGAGAGGAGAGGGGAGAAGG - Intergenic
927667722 2:25043623-25043645 AAGTGGGAGGAGGGGGAGGTTGG + Intronic
927949608 2:27158807-27158829 GAGGGAGAGCAGGCGGAAGAGGG + Intergenic
928029439 2:27766174-27766196 CAGTGACAGGGGTGGGGAGAGGG - Intergenic
928129971 2:28642337-28642359 CACTGAGAGGAGAGTGGAGAGGG + Intronic
928174689 2:29025817-29025839 CTGAGACAGGAGGGAGAAGAGGG - Intronic
928402269 2:30987713-30987735 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
928467607 2:31537371-31537393 CCATGGGAGGAGGGGGAAGGAGG - Intronic
928680790 2:33700273-33700295 CAGTGGGAGGAGGGTGCAGGTGG - Intergenic
928693136 2:33821102-33821124 AAGTGAGAGAAAGGTGAAGAAGG - Intergenic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929115269 2:38438683-38438705 GAATGGCAGGAGGGGGAAGATGG - Intergenic
929453934 2:42053459-42053481 CAGGGAGAGGGAGGGGAGGAAGG + Intronic
929806716 2:45152882-45152904 CATTGTGGGGAGGGGGCAGAAGG + Intergenic
930672319 2:54164152-54164174 CATTCAGAGGAGAGGGAAGGTGG + Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
931055039 2:58460325-58460347 CATTGAGAAGAGGAAGAAGATGG - Intergenic
931083016 2:58796876-58796898 AAGGGAGAGGAAGAGGAAGAGGG - Intergenic
931280078 2:60783063-60783085 CAGTGAGAGGGAGGGAAAAAAGG + Intronic
931485085 2:62682842-62682864 CAGTGAGTGGAGGGTGCAGTGGG - Intronic
931590687 2:63880182-63880204 CAGAAAGAGGAGAGGGAGGAGGG - Intronic
931743126 2:65266688-65266710 CACTGAGAGGAGGGGAGGGATGG + Intronic
931763894 2:65437834-65437856 CTTTGGGAGGAGGGGGAAGGAGG + Intergenic
931822182 2:65963204-65963226 CGGTGAGGGGAGGGGGGAGGGGG - Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932340935 2:70962302-70962324 CAGTGAGAGGAGCAGTGAGAGGG + Intronic
932452127 2:71817877-71817899 CTGTGAGAGGATGTTGAAGATGG - Intergenic
932708541 2:74046250-74046272 GAGAGAGAGAAGGGGGAAAAAGG - Intronic
933060487 2:77730988-77731010 CAGTGTGAGGATGTGGAAGTGGG - Intergenic
933496248 2:83053635-83053657 GAGAAAGAGGAGGAGGAAGAGGG + Intergenic
933619361 2:84519628-84519650 AAGGAAGAGGAGGGGAAAGAAGG - Intronic
933811091 2:86033192-86033214 CAGTGACAAAAAGGGGAAGAGGG - Intronic
933946010 2:87286702-87286724 CAGTGAGGGGAGAGGAAAGCAGG + Intergenic
934020566 2:87947367-87947389 TAGTGAGAGGAGGGGCCAGCTGG + Intergenic
934653263 2:96104224-96104246 AAGGAGGAGGAGGGGGAAGAGGG - Intergenic
934745188 2:96754811-96754833 CACTGAGATGAAGGGGAAGGAGG + Intergenic
934883491 2:98004688-98004710 AAGGGAGAGGAGGAGGAGGAGGG - Intergenic
935122882 2:100197804-100197826 AAGGGAGAGGGCGGGGAAGAGGG - Intergenic
935147443 2:100405474-100405496 CAGAGAGAGGATGGGGCAGGAGG + Intronic
935152546 2:100450688-100450710 AAGGGAGGGGAGGGGGAACAGGG - Intergenic
935227354 2:101064412-101064434 CAGTGTGTGGAGGGGGATGGAGG + Intronic
935622799 2:105144034-105144056 GAGGGAGAGGAGGAGGAGGACGG - Intergenic
936334201 2:111574884-111574906 CAGTGAGGGGAGAGGAAAGCAGG - Intergenic
936471952 2:112806636-112806658 AAGCGAGAGATGGGGGAAGAGGG - Intergenic
936960035 2:118063249-118063271 GAGTGGGAGGAGGGTGAGGATGG - Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937358116 2:121211212-121211234 GAGGGAGAGGAGGAGAAAGAAGG + Intergenic
937429108 2:121823832-121823854 CAATGAGAAGGGGAGGAAGACGG - Intergenic
937707147 2:124934202-124934224 GAGTGAAATGAGGGGCAAGAAGG + Intergenic
937774168 2:125756060-125756082 GTGTGAGAAGAGGAGGAAGAGGG + Intergenic
937799106 2:126060702-126060724 CTGTGAGAGGAGTGGCTAGAGGG - Intergenic
937878543 2:126847240-126847262 CAGGGAGAGGGAGGGGAGGATGG + Intergenic
938120089 2:128627001-128627023 GAGGGAGAGGAGGAGGAGGAGGG + Intergenic
938187552 2:129245210-129245232 CAGAGAGATGAGCAGGAAGAGGG - Intergenic
938845715 2:135206724-135206746 GAGAGAGAGAAAGGGGAAGAGGG + Intronic
940168294 2:150799396-150799418 GAGAGAGAGGAGGGGGTAAAGGG - Intergenic
940481700 2:154240966-154240988 CAGTGGGAGGAGGCGGAATTTGG - Intronic
940854394 2:158718451-158718473 GAGTCAGAGGAAGGGGAAGCTGG - Intergenic
941269241 2:163404735-163404757 CAGTGATTGAATGGGGAAGAAGG - Intergenic
941296651 2:163747239-163747261 AAAAGAGAGGATGGGGAAGAGGG + Intergenic
941443789 2:165574243-165574265 AAGCGAGAGGAGGGGGCAGAAGG + Intronic
941653067 2:168114394-168114416 CAATGAGGGAAGGGAGAAGAAGG + Intronic
941659751 2:168183709-168183731 CAGTGAGATTAGGGAGAGGAAGG - Intronic
942113066 2:172701034-172701056 GAGGGAGAGGAGGGAGAAGAGGG + Intergenic
942994920 2:182249380-182249402 CAGTATCTGGAGGGGGAAGAGGG + Intronic
943214486 2:185013036-185013058 CACAGAGGGGAGGGGGAACAAGG - Intergenic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944394897 2:199255533-199255555 CAGGGAGTGGAAGGGTAAGAGGG - Intergenic
945175983 2:207043931-207043953 AAGAGAGAGGAGAAGGAAGAAGG + Intergenic
945194714 2:207227380-207227402 AGGTGGGGGGAGGGGGAAGATGG + Intergenic
945283023 2:208054827-208054849 GAGGTAGAGGAGGGGGAAGAGGG + Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945669196 2:212782197-212782219 GACTGAGAGGAGGGGGAAATGGG - Intergenic
946023822 2:216659927-216659949 CAGTGACAGCAGGGGGATGCTGG + Intronic
946057933 2:216917788-216917810 AAGACAGACGAGGGGGAAGATGG + Intergenic
946058789 2:216923691-216923713 CATTGCCAGTAGGGGGAAGAAGG - Intergenic
946143903 2:217714294-217714316 CAGGGAGAGGATGGAGAAGGGGG - Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946225683 2:218262999-218263021 CAGGGAGAGGAAGGAGAAGTTGG - Exonic
946395714 2:219442721-219442743 CAGTGAGGAGAAGGAGAAGATGG - Intronic
946924038 2:224608486-224608508 CAGTGAGAGAGGGAGGAAAAAGG + Intergenic
947141956 2:227027479-227027501 GAGTGGGAGGAGGGGGGAGGGGG + Intronic
947243108 2:228017832-228017854 CAGTGAGATCAAGAGGAAGACGG - Exonic
947744668 2:232501407-232501429 GTGGGAGAGGAGGAGGAAGATGG + Intergenic
947783634 2:232794046-232794068 CAGTGAGAGGAGCAGGAATTTGG + Intronic
947828533 2:233123039-233123061 CACTGAGAGGAGAGTGAAGGAGG + Intronic
947833015 2:233155133-233155155 GAAAGAGAGAAGGGGGAAGAAGG + Intronic
947835284 2:233170567-233170589 CACAGAGAGGAGGGAGCAGAAGG + Exonic
947935777 2:234002211-234002233 CAGAGCGAGGAGTGGGCAGAGGG + Intronic
947951997 2:234156205-234156227 AAGAAAGAGGAGGGGGAGGAGGG - Intergenic
948091883 2:235302043-235302065 AAGAGAGAGAAGGGGGAAGGAGG - Intergenic
948233220 2:236366798-236366820 GAGAGAGAGGAGGAGGAAGGAGG - Intronic
948356751 2:237384412-237384434 CAGAGAGAGGCGTGGGAGGAGGG - Intronic
948500801 2:238392384-238392406 GAGTTCGAGGTGGGGGAAGAGGG - Intronic
948599497 2:239100268-239100290 AAGTGAGATGATGGAGAAGAAGG - Intronic
1168750245 20:276967-276989 GAGGCAGAGGATGGGGAAGAGGG + Intronic
1168870062 20:1120064-1120086 CAGTGAGGGGTGGGGGAAAGGGG - Intronic
1168953906 20:1820955-1820977 CATTGAGAAGATGGGGAAGCTGG - Intergenic
1169001921 20:2174165-2174187 CAGCTAGAGGAAGGGGAAGCAGG + Intronic
1169073612 20:2748965-2748987 CAGTGCAGGGCGGGGGAAGAAGG + Intronic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169396373 20:5234011-5234033 GAGAGAGGGGAGGGGGAAAAAGG + Intergenic
1169801169 20:9514219-9514241 CATTGAGAGCAGGGGAGAGAAGG + Intergenic
1170158570 20:13290257-13290279 CAATATGAGGAGGAGGAAGAGGG + Intronic
1170607184 20:17883062-17883084 AAGGGAGGGGAGGGGGAAGGGGG - Intergenic
1170696599 20:18664887-18664909 AAGGAAGAGGTGGGGGAAGATGG - Intronic
1170736469 20:19017592-19017614 CTAGGAGAGGAGGGGGAAGGGGG - Intergenic
1171073440 20:22098545-22098567 CATAGAAAGGACGGGGAAGATGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171365165 20:24618053-24618075 CAGGAAGAGCCGGGGGAAGAGGG + Intronic
1172009488 20:31838039-31838061 CAGTGGGAGGATGGGGATCAGGG + Intergenic
1172010343 20:31842805-31842827 CATGGTGAGGAGGGGGAAGGAGG - Intergenic
1172060702 20:32185413-32185435 ATGTGAAAGGAGGTGGAAGAAGG + Intergenic
1172093560 20:32449776-32449798 CAGAGGGATGCGGGGGAAGAGGG + Intronic
1172104916 20:32511080-32511102 TCGTGGGAGGAGGGGGAGGAGGG - Intronic
1172402461 20:34661345-34661367 GGGTGGGAGGAGGGTGAAGATGG - Intronic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172486123 20:35298747-35298769 TACTGGGAGGAGGCGGAAGAGGG - Intergenic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1172912456 20:38420101-38420123 CAGTGGGAGTAGGGTGAACATGG - Intergenic
1172994892 20:39063274-39063296 AAGGGACAGGAGGGAGAAGAGGG + Intergenic
1173019855 20:39258049-39258071 GGGAGAGGGGAGGGGGAAGAGGG - Intergenic
1173167524 20:40696102-40696124 CAGGGAGAGGAGGGGGCTGGAGG - Intergenic
1173485688 20:43439366-43439388 CACAGAGAAGAGGGGGAAAAAGG - Intergenic
1173497469 20:43529944-43529966 CAGTGAGAGAAGGTAGCAGAGGG + Intronic
1173583662 20:44165665-44165687 CAGTGAGGGAAAGGGGAGGATGG - Intronic
1173822860 20:46030175-46030197 AACTGAGAGGAGGGGGAAAGAGG - Intronic
1173847592 20:46197883-46197905 CAGCTAGGGGAGGAGGAAGAGGG + Intronic
1173858290 20:46265307-46265329 GAGAAAGAGGAGGAGGAAGAGGG - Intronic
1173865878 20:46312464-46312486 AAGCGGGAGGAGGGGGAGGAAGG - Intergenic
1173871423 20:46344420-46344442 TAGCATGAGGAGGGGGAAGAGGG - Intergenic
1174403062 20:50286311-50286333 GACTGAGATGAGGAGGAAGAAGG - Intergenic
1174451589 20:50624192-50624214 CAGGGAGGGCAAGGGGAAGAGGG - Intronic
1174720644 20:52808427-52808449 GAGAAAGAGGAGGAGGAAGAGGG - Intergenic
1175120143 20:56710778-56710800 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1175120241 20:56711054-56711076 GAGGGAGAGGAGGGGGGAGAGGG - Intergenic
1175298882 20:57928758-57928780 AAGAGAAAGGAGGAGGAAGATGG - Intergenic
1175487387 20:59355731-59355753 GGGAGAGAGGAGGGGGGAGAGGG - Intergenic
1175487404 20:59355772-59355794 GGGAGAGAGGAGGGGGGAGAGGG - Intergenic
1175598639 20:60255270-60255292 CAGTGAGAGGGATGGGCAGAGGG + Intergenic
1175638853 20:60609829-60609851 GAGGGTGAAGAGGGGGAAGAGGG + Intergenic
1175697514 20:61113695-61113717 CAGTAGGATGAGGGGGCAGAAGG - Intergenic
1175715107 20:61250280-61250302 CAGGCAGAGGAGGGTGCAGAGGG - Intergenic
1175831609 20:61967709-61967731 CAGCAAGGGGAGGGGGAAAAGGG - Intronic
1175921387 20:62451981-62452003 GAGGGAGAGGAGGGAGAAGGGGG + Intergenic
1176142257 20:63549936-63549958 AGGTGCAAGGAGGGGGAAGATGG - Intronic
1176385266 21:6135881-6135903 CAGCGAGGGAAGGAGGAAGATGG - Intergenic
1176720429 21:10388192-10388214 GAGGGAGAAGAGGGAGAAGAAGG + Intergenic
1176940168 21:14913559-14913581 CAGTGGGAGGTGGAGCAAGATGG - Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177183185 21:17765674-17765696 TAGAGAGAGAAGGAGGAAGATGG + Intergenic
1177259190 21:18706936-18706958 AAGGGGGAAGAGGGGGAAGACGG - Intergenic
1177758288 21:25373643-25373665 GAGTGGGAGGAGGAGGAGGAGGG - Intergenic
1178117383 21:29431414-29431436 CATGGAAAGGAGGGGGTAGAGGG - Intronic
1178495751 21:33084692-33084714 GTGTGAGATGAGGTGGAAGACGG - Intergenic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1178976594 21:37226249-37226271 CAGTGTGAGGAGGGGTGGGAAGG + Intronic
1179344143 21:40540436-40540458 CAGTGTGAGGAGGGGCATGGAGG - Intronic
1179366773 21:40765981-40766003 CTGTGATAGCAGGGGTAAGAGGG - Intronic
1179465938 21:41572833-41572855 CAGTGACAGGAAGTGGATGAAGG - Intergenic
1179738207 21:43402371-43402393 CAGCGAGGGAAGGAGGAAGATGG + Intergenic
1179768209 21:43590843-43590865 CAGGGAGAGGAGCAGGAAGGAGG + Intronic
1179839936 21:44065518-44065540 CAGTGAGAGGAGGTGGCCAAAGG + Intronic
1179965278 21:44801363-44801385 CAGTGAGAGCTTGAGGAAGAAGG - Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180258742 21:46651548-46651570 CAGGCAGTGGAGGGGGAAGGCGG + Intronic
1180288896 22:10778673-10778695 GAGAAAGAGGACGGGGAAGAAGG + Intergenic
1180304720 22:11065348-11065370 CAGTGGGAGAAGGGTAAAGAGGG - Intergenic
1180855395 22:19041877-19041899 CAGTGACAGGATGAGGAAGGAGG + Exonic
1181282244 22:21728236-21728258 CATGGAGAGGAGGGGAAGGAAGG - Intronic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181422457 22:22811336-22811358 CCCAGAGAGGAGGGGGAATATGG + Intronic
1181481925 22:23205377-23205399 CCGTGAGAGGAGGAGAAGGAGGG - Intronic
1181546516 22:23605515-23605537 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1181778391 22:25176177-25176199 CAGTGAAAGAGGGGGAAAGACGG - Intronic
1182027992 22:27135389-27135411 GAGTGAGAAGAAGGGGGAGAGGG + Intergenic
1182134828 22:27891671-27891693 GAGAGAGAGGAGGAGGAAGGAGG - Intronic
1182321347 22:29480138-29480160 CAGTGAGAGGGTGGGGAGGAGGG - Intergenic
1182550931 22:31100417-31100439 CAGAAAGAGAAGGGGAAAGAAGG - Intronic
1183094563 22:35544351-35544373 GAGAGAGAGGAGGGTGGAGAGGG - Intronic
1183206936 22:36426251-36426273 CAGGGAGAGGAGGAAGAGGAAGG - Intergenic
1183342094 22:37287069-37287091 CAGGAAGAGGATGGGGAGGAGGG + Intronic
1183363980 22:37397543-37397565 CAGGGAAAGGAGGGGGAACGTGG + Intronic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183554306 22:38513253-38513275 CAGTGACAGCAGGGGGAGCAGGG - Intergenic
1183685805 22:39360803-39360825 CAGGCAGAGAAGGGGGAAGGAGG + Intronic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1183966783 22:41447007-41447029 CTGTGACAGGGAGGGGAAGACGG - Exonic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184059387 22:42073065-42073087 CAGTAGGAGGTGGGGGTAGAAGG - Intergenic
1184096356 22:42318412-42318434 CTGTGAGAGGAGAGGGGAGGAGG + Intronic
1184522630 22:45004388-45004410 GTGTGAGAGGTGGGGGATGAAGG + Intronic
1184764396 22:46564050-46564072 GGGTGAGAGGAGGGAGATGAAGG + Intergenic
1184767568 22:46579648-46579670 CAGGGAGGGGAGGGGGCACACGG - Intronic
1184890981 22:47379079-47379101 GAGGAAGAGGAGGAGGAAGAGGG + Intergenic
1185130003 22:49033483-49033505 CAGGGAGAGAGGGGTGAAGACGG - Intergenic
949214771 3:1552517-1552539 AAGGGAGAGGAGGGGAAAGTAGG + Intergenic
949302894 3:2605343-2605365 CAGTGTTAGGAGGTGGGAGAAGG + Intronic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
950177240 3:10883360-10883382 GAGTGAGAGGAGCGGGAATCTGG - Intronic
950325780 3:12108503-12108525 CGGAGATAGGAGTGGGAAGAGGG + Intronic
950344306 3:12278483-12278505 TAGTAAGAGGAGGTAGAAGAGGG - Intergenic
950417828 3:12878424-12878446 CAGTCAGAGGAGGCCCAAGAAGG - Intergenic
950622861 3:14220311-14220333 CAGTGAGAGCAGTGTGCAGATGG - Intergenic
950919828 3:16683244-16683266 AAGAGAAAGTAGGGGGAAGAAGG - Intergenic
951567229 3:24023333-24023355 CAGTGATGGGAGGGGACAGACGG + Intergenic
951719189 3:25679750-25679772 GGGAGAGAGGAGGGGGAAGGGGG + Intergenic
951845699 3:27081897-27081919 CAGTGAAATGAAGGGGTAGATGG + Intergenic
952002350 3:28800646-28800668 AAGGGAGAGGAGGAGGAAGAAGG - Intergenic
952114359 3:30161383-30161405 GGGGAAGAGGAGGGGGAAGAAGG - Intergenic
952568892 3:34689938-34689960 TAAGGAGAGGAGGGGGAAGAGGG + Intergenic
952711890 3:36439940-36439962 CTGTCAAAGAAGGGGGAAGAAGG - Intronic
952925626 3:38317250-38317272 GAGGGAGGGCAGGGGGAAGATGG - Intronic
952985055 3:38771533-38771555 CAAGGTGATGAGGGGGAAGAAGG + Intronic
953118760 3:40018676-40018698 CTGTGAGAGGAAGGGGACAAGGG - Intronic
953230157 3:41057763-41057785 CCGTGAGTGGAGAGGGAACATGG - Intergenic
953386600 3:42509845-42509867 CACAGAGAGGAGGGGGCAGGTGG - Intronic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
953435547 3:42874647-42874669 CACTGAGAGGTAGGGAAAGAGGG + Exonic
953494127 3:43371979-43372001 CAGTGAGTAGAGGGGCAGGAAGG + Intronic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
954048175 3:47951326-47951348 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
954297918 3:49684457-49684479 CAGTGAGGGGAATGGGGAGAGGG + Intronic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
954982638 3:54760357-54760379 ATGTGAGAGGCGGGGAAAGAAGG + Intronic
955128833 3:56143105-56143127 AAGTGTGAGGAGGGGGAATATGG + Intronic
955695583 3:61632798-61632820 CAGGGAGGGGAGGGGGATGAAGG - Intronic
956665416 3:71637543-71637565 GAGGGGGAGGAGGGGGAAAAGGG + Intergenic
956846536 3:73188825-73188847 GAGGGGGAGGAGGAGGAAGAAGG - Intergenic
956849702 3:73217721-73217743 AAGGGAGGGGAGGGGGAAGAGGG - Intergenic
957126764 3:76171534-76171556 CAGTCAAAGGACCGGGAAGAAGG + Intronic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
957683462 3:83469854-83469876 AGGGGAGAGGAGGGGGAAGATGG + Intergenic
957741664 3:84278659-84278681 CAGCTGGAGGAAGGGGAAGAGGG + Intergenic
958843627 3:99239067-99239089 GAGTGGGGGGAGGGGGAGGATGG - Intergenic
960225136 3:115159271-115159293 CAGGGAGAGGGGTGGGAGGATGG - Intergenic
960533476 3:118791518-118791540 AATTGAGAGGAGGAGGGAGATGG - Intergenic
961416587 3:126763311-126763333 GAGGGAGAAGAGGGGGAAAAAGG - Intronic
961532444 3:127547733-127547755 CAGCGAGAGGAGGGGAGAGGAGG - Intergenic
961587861 3:127948859-127948881 CAGTGAAAGGGGAGGAAAGAGGG + Intronic
961587992 3:127950272-127950294 CAGGGAGGGAAGTGGGAAGAAGG + Intronic
961646490 3:128395420-128395442 CATTCAGAGGAGGAGGAGGAAGG - Intronic
961659976 3:128463449-128463471 CACTGAGAGGAGTGGGGGGAGGG + Exonic
962304505 3:134273547-134273569 GAGGAAGAGGAGGGGGTAGAGGG - Intergenic
962419287 3:135214194-135214216 GCCTGAGAGGAGGGGGCAGATGG - Intronic
962876997 3:139542731-139542753 CAGAGAGATGAGGAGGAGGAAGG + Intergenic
962907151 3:139814333-139814355 CAGTGGGAGGTGGGGCAATAAGG + Intergenic
962932860 3:140053646-140053668 GAGAGAGAGGAGGGAGATGAGGG - Intronic
962975108 3:140439285-140439307 CAGTGAGAGGCCAGGGAGGAGGG + Intronic
963046952 3:141109662-141109684 GAGGAAGAGGAGGAGGAAGAGGG - Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963751149 3:149181179-149181201 CAGGGAGAGCAGGGGCCAGATGG - Intronic
963814871 3:149818434-149818456 CACTGGGAGGAAGGGGAAAAGGG - Intronic
964162354 3:153660513-153660535 CAGGGAGGGAAGGGGGAGGATGG - Intergenic
964293467 3:155207987-155208009 AAGTGAGCTGAGGGGAAAGAGGG + Intergenic
964334060 3:155636114-155636136 CAGTGAGATGTGAGGGAAGTTGG - Intronic
964374389 3:156035371-156035393 GAGGGAGAGGAGGAGGAAAAAGG - Intergenic
965179476 3:165383574-165383596 AAGTGAAAGCAGGGGGAAGCAGG + Intergenic
965380490 3:167982358-167982380 CAAGGAGAGGAGGAGCAAGATGG + Intergenic
965899945 3:173627196-173627218 GAGTGGGAGGAATGGGAAGATGG - Intronic
967072139 3:185971497-185971519 CAGTGGGGAGAGGGGGTAGAGGG + Intergenic
967322335 3:188207173-188207195 TAGTGAGAGAAGTGGGCAGATGG - Intronic
967553829 3:190831508-190831530 TAGGGAAAGGAGGGGGAAGAAGG - Intergenic
967612171 3:191520369-191520391 CAGTGAGAGGTGAGGGCAAATGG + Intergenic
967674032 3:192274568-192274590 AAGAGAGAGGAGAGAGAAGAGGG + Intronic
967953951 3:194862871-194862893 CTGGGAGAGGAGGAGGCAGAGGG - Intergenic
968284494 3:197500131-197500153 GAGTGAGGAGAGGAGGAAGAGGG + Intergenic
968442156 4:629507-629529 CAGGGAGAGGAGCTGGAAGGTGG - Intronic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968648210 4:1750175-1750197 CAGAGAGAGGAGGGGGCGGGGGG + Intergenic
968659613 4:1793640-1793662 CAGGGAGGGAAGGGGGAGGAGGG + Intronic
968883733 4:3316010-3316032 CAGTGAGTGGTGGAGAAAGATGG + Intronic
968889287 4:3359175-3359197 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
968889332 4:3359280-3359302 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
969253103 4:5982853-5982875 CAGGGAGAGGTGGATGAAGAAGG + Intronic
969454828 4:7294987-7295009 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
969454843 4:7295027-7295049 GAGGGAGAGGAGGGGGGAGGAGG - Intronic
969454859 4:7295065-7295087 GAGGGGGAGGAGGGGGAGGAGGG - Intronic
969477740 4:7431078-7431100 GAGTGAGTGGAGGGGTCAGAGGG + Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
969713559 4:8857951-8857973 CGGGGAGAGGAGGCGGAGGAGGG + Intronic
969781967 4:9412180-9412202 CAGTCAGGGGATGGGGAGGAGGG - Intergenic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970103609 4:12554761-12554783 AAGAGAGATGAAGGGGAAGATGG + Intergenic
970415151 4:15849525-15849547 CATGAAGAGGAGGAGGAAGACGG - Exonic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970597341 4:17612530-17612552 CAGAGAGAGAAGGAGGAGGAGGG + Intergenic
971183512 4:24352204-24352226 CAGAGATAGGGAGGGGAAGAGGG + Intergenic
971266584 4:25101226-25101248 AAGGGTGAGGAGGTGGAAGAGGG - Intergenic
971345736 4:25810263-25810285 CAGAGAGGGGAGGGGGGAGCTGG - Intronic
971570952 4:28210028-28210050 GAGGGGGAGGAGGAGGAAGAGGG - Intergenic
971570959 4:28210046-28210068 GAGGGGGAGGAGGAGGAAGAGGG - Intergenic
971633795 4:29031232-29031254 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
971662978 4:29444104-29444126 AAGGGAGAGGAGGAAGAAGATGG - Intergenic
971850459 4:31979211-31979233 CAGTGAGATAAGTGGGAAGGAGG + Intergenic
971893998 4:32566060-32566082 CAGTGAGAAGATGGGAAACATGG + Intergenic
972167986 4:36310863-36310885 AAGAGAGAGGAGGGAGAGGAAGG + Intronic
972205760 4:36770786-36770808 CAGAGAGGAGATGGGGAAGAGGG - Intergenic
972287458 4:37662773-37662795 AGGTGGGAGGTGGGGGAAGATGG - Intronic
972756278 4:42050359-42050381 CAGTGGGAGGAGAGGGGATAGGG + Intronic
973673359 4:53239412-53239434 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
974074296 4:57154834-57154856 CAGGGAGAGGAAAGAGAAGAGGG - Intergenic
975404150 4:73969500-73969522 AAGTGAGTGGCGGGGAAAGAGGG - Intergenic
975591396 4:76003700-76003722 CTGTGAGAAGAAGGGGAAAAAGG + Intronic
975603253 4:76125692-76125714 GAGGGAGAAGAGGGAGAAGAGGG + Intronic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
975822172 4:78282820-78282842 GAGGGAGAGAAGTGGGAAGATGG + Exonic
976561487 4:86506615-86506637 CACTGATAGGAAGGGGAGGAAGG + Intronic
976703389 4:87995519-87995541 CAGGAGGAGGAGGGGGAAAAGGG + Intergenic
976838870 4:89407798-89407820 CAGAGAGAGGACAGGAAAGAAGG + Intergenic
976938200 4:90665897-90665919 CAGTGGGAGGTGTGGGAAAAGGG + Intronic
977927445 4:102717320-102717342 CAGTGAGAGGTTGAGGAGGATGG + Intronic
977953740 4:103003039-103003061 CAGTGAGTAGAAGGGGAGGAAGG - Intronic
978281760 4:107025123-107025145 CTGAGAGAGGACTGGGAAGATGG + Intronic
978291995 4:107152554-107152576 CAGTGTGAAGAAGGGGAAGTTGG + Intronic
979125203 4:116962674-116962696 CAGTCAGAAGCGGAGGAAGAGGG - Intergenic
979279268 4:118846942-118846964 CAGGGAGGGGAGGGGAGAGAAGG + Intergenic
979529591 4:121755031-121755053 CAGTTGGAGGTGGGGGATGAGGG + Intergenic
980103353 4:128563824-128563846 TCGTGAGAGGAGGGGGAACAGGG + Intergenic
980479461 4:133368883-133368905 CAGGGAGAAGTGGGGGAAGAGGG + Intergenic
980652866 4:135743362-135743384 GAGAGAGAGGATGGGGAAGAAGG + Intergenic
980977486 4:139625006-139625028 GACAGAGAGGAGGGGGAAGGAGG + Intergenic
981038770 4:140200245-140200267 GAAGGAGAGGAGTGGGAAGAGGG + Intergenic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
982764909 4:159335207-159335229 CATAGAGAGGAAGGAGAAGATGG + Intronic
983050484 4:163040332-163040354 GAGGGAGAGGCAGGGGAAGAAGG + Intergenic
983275006 4:165606140-165606162 CAGAAAGAGGAGGTGGAAGGAGG - Intergenic
983335219 4:166383401-166383423 CAGGGAGAGGGAGAGGAAGAGGG + Intergenic
983495782 4:168441019-168441041 AGATGAGAGGAGGGGGAGGATGG + Intronic
983578948 4:169288375-169288397 CAGTGTGGGGGCGGGGAAGAAGG + Intergenic
984298223 4:177881289-177881311 CAGTTTGTGGAGGGGGAAGCAGG + Intronic
984351419 4:178599897-178599919 CAGTTAGAGGAGGGCCAAGCTGG + Intergenic
984469410 4:180147805-180147827 CTGTGAGAGGAGGATGCAGAAGG - Intergenic
984715388 4:182919684-182919706 CAGGCAGAGGAGGTGGAAGGAGG - Intergenic
984825876 4:183924307-183924329 CAGTGGGATGAGGGTGATGATGG + Intronic
985210371 4:187586457-187586479 CAGTGAGATGAGGAAGAAGCAGG - Intergenic
985385584 4:189444216-189444238 GAGGAAGAGGAGGAGGAAGAAGG - Intergenic
986035593 5:3933955-3933977 CTGAGAAAGGAGGGGTAAGAGGG + Intergenic
986172668 5:5326780-5326802 AAGTGAGGGGAGGGGCAGGAGGG - Intergenic
986671326 5:10145588-10145610 CAGCCAGAAGATGGGGAAGAGGG + Intergenic
986704160 5:10441640-10441662 CAGCCAGAGCAAGGGGAAGAGGG + Exonic
986734047 5:10655163-10655185 CAGGGAGAGAAGCGGGCAGAGGG - Intergenic
986782119 5:11075893-11075915 TAGAGAGAGGAAGGGGTAGAGGG - Intronic
986898795 5:12406008-12406030 GTGTGAGGGTAGGGGGAAGATGG - Intergenic
987278740 5:16390226-16390248 CAGTGAGAGGTGGAGACAGATGG + Intergenic
987281463 5:16418230-16418252 CAGGAACAGGAGGGAGAAGAGGG + Intergenic
987704939 5:21450779-21450801 CATTGGGAGGAGGGGGAATTAGG - Intergenic
988294141 5:29333020-29333042 CAGAGGGTGGAGGGGGAGGAAGG - Intergenic
988497764 5:31759144-31759166 CAATGGGAGGAGGTGGAGGAGGG - Intronic
988541087 5:32110686-32110708 CAATGAGATGTGTGGGAAGATGG - Exonic
988839214 5:35066732-35066754 GAGTGAGAGGAGGAGGCAGGAGG - Intronic
989000656 5:36756940-36756962 CAGTGTAAGGAAGGGGAAGTTGG + Intergenic
989632619 5:43501561-43501583 CAGGGAGTGGAGGGAGAAGCAGG + Intronic
989665213 5:43846257-43846279 GAGAGAGAGGAGGGGAAAGAGGG - Intergenic
989778289 5:45234643-45234665 AGGTGAGAGGAGGGTGAGGATGG - Intergenic
989986880 5:50711386-50711408 CAGTTAGGGGAGGAGGGAGAAGG - Intronic
990011779 5:51007845-51007867 CATTGAGAGGAGGGTAGAGATGG + Intergenic
990019452 5:51107416-51107438 CAGGTAGAGGAGAGGGGAGACGG - Intergenic
990089040 5:52018038-52018060 CAGAGACAGGAGGGGAAAAATGG + Intronic
990279126 5:54231046-54231068 CAGAAAGAGCAGGGGAAAGAGGG - Intronic
990446187 5:55896582-55896604 AAGGGAGGGGAGGGGGAAGGTGG - Intronic
990482756 5:56227947-56227969 AAGTAAGAGGTGGGGGAAGCGGG - Intronic
990887302 5:60609287-60609309 CAGTGACAGGAGGGAGGAAAAGG - Intronic
990943871 5:61230152-61230174 GGGTGAGAGGAGAGGGGAGAGGG - Intergenic
991510061 5:67366131-67366153 GAGTGAGAAGAGGAGTAAGAAGG + Intergenic
991522793 5:67519197-67519219 CAGGGAAAGGAGGGGAAAAAGGG - Intergenic
991573253 5:68077378-68077400 GACTGAGGGAAGGGGGAAGAGGG + Intergenic
991944684 5:71888697-71888719 AAATGAGAGGAGGGGAAAAAAGG + Intergenic
992023410 5:72647646-72647668 CAGTGAGATGAGGGGGAGGGAGG + Intergenic
992071691 5:73154677-73154699 AAGGGAGAGGAAGGGGAACAGGG - Intergenic
992146991 5:73860544-73860566 CATTGACAGGAGGGACAAGAGGG - Intronic
992301751 5:75389169-75389191 CAGTAAGAGAAGGGAAAAGAAGG + Intronic
992341071 5:75823945-75823967 CTGTGGGAGGAGGAGGCAGAAGG + Intergenic
992386469 5:76289423-76289445 CAGTGAGGGGTGGGGAAAGATGG + Intronic
992602426 5:78415963-78415985 CAGTGTTAGGAGGTAGAAGATGG + Intronic
993108579 5:83627834-83627856 GAGTGAGAGGAGAGAGAACAGGG - Intergenic
993685396 5:90931081-90931103 GAGAGAGAGGAGGGAGAAGGAGG + Intronic
994030510 5:95136456-95136478 GAGGGAGAGGAGAAGGAAGATGG + Intronic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994943762 5:106359072-106359094 AGGTGAGATGAGCGGGAAGAGGG + Intergenic
994985538 5:106928433-106928455 CAGAAAGAGCTGGGGGAAGATGG + Intergenic
995509348 5:112892734-112892756 CTCCGAGAGGAGGGAGAAGATGG + Exonic
995712138 5:115046679-115046701 CAGAGAGAGGCAGGGGAAGGTGG + Intergenic
995712591 5:115050346-115050368 GAGTAAGAGGAGGGGGAAAGAGG - Intergenic
995851136 5:116546835-116546857 AAGTGAGAGGAGAGGGAATCAGG - Intronic
995875776 5:116787813-116787835 CAGTGAGAGCAAGGGCAAGTTGG + Intergenic
996055119 5:118973976-118973998 GAGGAAGAGGAGGAGGAAGAAGG + Intronic
996070263 5:119123377-119123399 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
996365558 5:122696904-122696926 AAGAGAGAAGTGGGGGAAGAAGG + Intergenic
996821978 5:127639608-127639630 AAGAGAGAGGAGAGGGAAGAAGG - Intergenic
997283373 5:132662255-132662277 CAGGGAGAGGCGACGGAAGAAGG + Intergenic
997361046 5:133295120-133295142 AAGTCTGAGGAGGGAGAAGAAGG - Intronic
997434628 5:133865440-133865462 CTGTGAGAGGTGGGGGAAGGTGG + Intergenic
997530099 5:134576733-134576755 AAGTGAGAGGAGGAGGGAGATGG - Intronic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
997843522 5:137264442-137264464 GAGGGAGAGGAGGGGAAGGAAGG - Intronic
997979101 5:138458125-138458147 CAGTGAGATGGGGGTGAGGATGG + Intergenic
998171237 5:139873033-139873055 AAGTGAGAGGAGGAGGAGGAGGG + Intronic
998265118 5:140662181-140662203 CATTGAGAAGAGGAAGAAGATGG + Exonic
998565575 5:143213326-143213348 GAGTGTGGGGAGGAGGAAGAAGG - Intronic
998885213 5:146686898-146686920 CAGCGGGAGGTTGGGGAAGAAGG + Intronic
998991582 5:147823220-147823242 AAGAGAGAGGAGGAGGAGGAGGG - Intergenic
999006371 5:147984545-147984567 CAGGAAGAGGAAGAGGAAGAGGG + Intergenic
999120282 5:149204408-149204430 GAGTGAAAGGAGGAAGAAGAGGG + Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999603256 5:153290130-153290152 CTGGGAGGGGAGGGGTAAGAAGG + Intergenic
999721515 5:154402232-154402254 CAGAGGGAGAAAGGGGAAGAGGG - Intronic
999770250 5:154770191-154770213 GATGGAGAGGAGGGGGATGATGG + Intronic
1000194268 5:158942850-158942872 AAGGAGGAGGAGGGGGAAGAAGG + Intronic
1000209708 5:159098117-159098139 CAGAGTGCGGAAGGGGAAGAAGG - Intronic
1000489833 5:161897672-161897694 GAGAGAAAAGAGGGGGAAGATGG + Exonic
1000784958 5:165531722-165531744 GAGAGAGAGGATGAGGAAGAGGG + Intergenic
1000895269 5:166847605-166847627 AAGATAGAGGAGGGGGAAAATGG + Intergenic
1001016129 5:168142909-168142931 CAGTGAAAGGTGGGTGGAGAGGG - Intronic
1001029865 5:168254440-168254462 GAGGGAGAGGAAGAGGAAGAAGG + Intronic
1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG + Intergenic
1001483487 5:172104139-172104161 CAGTGGCAGGAAGGGGAGGAAGG - Intronic
1001923906 5:175622322-175622344 GAGTTTGAGGAGGGAGAAGAGGG - Intergenic
1002110622 5:176908165-176908187 GAGAGAGAGAAGGGGGGAGAGGG + Intronic
1002135512 5:177105396-177105418 CAGTGAGAGCAGGGGGTGGGGGG - Intergenic
1002327631 5:178420384-178420406 CAGGGAGGGGAGGGGGAAAGGGG - Intronic
1002327748 5:178420686-178420708 CAGGGAGGGGAGGGGGAAAGTGG - Intronic
1002461510 5:179376047-179376069 CAGCCAGAGGAGGGGAAAAAGGG + Intergenic
1002795674 6:469435-469457 CAGGGAGAGGAGGGGGAGAGAGG - Intergenic
1002795709 6:469697-469719 CAGAGAGAGGAGGGGGAGAGAGG - Intergenic
1002980214 6:2128630-2128652 CAGGTAGAGGAGTGGGAGGAAGG - Intronic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003285667 6:4731889-4731911 CTGTGGAAGGAGGGGGAAGATGG + Intronic
1003516297 6:6821600-6821622 ACGGGGGAGGAGGGGGAAGAGGG + Intergenic
1003880735 6:10477382-10477404 CAATGGGAGGATGGAGAAGAGGG + Intergenic
1004923484 6:20398392-20398414 CAGTCAGAGCAAGGGAAAGAGGG + Intergenic
1005000917 6:21240742-21240764 AACTGAGGGGAGTGGGAAGAAGG + Intergenic
1005089178 6:22038443-22038465 CAGTGAGAGGAAGGGGAAGGAGG - Intergenic
1006176746 6:32127152-32127174 GAGGAAGAGCAGGGGGAAGATGG + Exonic
1006729066 6:36222082-36222104 CAGAGAGGGGAGAGGGGAGAAGG + Intronic
1006840632 6:37026061-37026083 CAGAGAGAGGAAGAGGGAGAGGG - Intronic
1007070720 6:39036244-39036266 CTCTGAGAGGTGGGGAAAGAGGG + Intergenic
1007258532 6:40545586-40545608 CAGGCAGAGGAAGAGGAAGAGGG + Intronic
1007518107 6:42429445-42429467 AAGTGAGAGGAGGCGGTAGCAGG - Intronic
1007692103 6:43709120-43709142 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1007692117 6:43709147-43709169 CAGGAAGGAGAGGGGGAAGAGGG - Intergenic
1007927635 6:45663201-45663223 CAGGAAGAGGAGGAGGGAGATGG - Intronic
1008174242 6:48247092-48247114 TAGTGGGAGGTGGGGGGAGAAGG + Intergenic
1008693255 6:54004776-54004798 CAGTGAGAGGGAGGGAAGGAGGG + Intronic
1009893412 6:69717280-69717302 CATGGAGAGGAGGGGGAAAAAGG - Intronic
1010089315 6:71961348-71961370 TAGGGTGAGGAAGGGGAAGACGG - Intronic
1010196878 6:73248426-73248448 GAGAGGAAGGAGGGGGAAGAAGG - Intronic
1010386366 6:75284862-75284884 GAGAGGGAGGAGGGAGAAGAAGG + Exonic
1010738954 6:79476707-79476729 CAGAGAGAGGAGAATGAAGAAGG + Intergenic
1010800379 6:80168317-80168339 GAGAGAGGGGAGAGGGAAGAAGG + Intronic
1010971776 6:82270546-82270568 AAGTGAGAAGAGTTGGAAGAGGG + Intergenic
1011125703 6:84005288-84005310 CTGAGAGAGGAGGGGAAACAGGG - Intergenic
1011261252 6:85472118-85472140 CAGTGCAAGGTGGGGGAAGTGGG - Intronic
1011379741 6:86730313-86730335 CTGTGAAAGGAAGGAGAAGAGGG + Intergenic
1011407051 6:87026502-87026524 AAGTGAGGGGAGGGGGAAGGTGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012472887 6:99590776-99590798 CAGTGGGAGGAAGGCGACGAGGG - Intergenic
1012858763 6:104533843-104533865 GAGAGAGAGGAGAGAGAAGAGGG - Intergenic
1013080595 6:106808631-106808653 AAGAGAGAGCAGGGGGAAAAGGG - Intergenic
1013272626 6:108558341-108558363 GAGAGAGAGGAGAGGGAAAAAGG - Intergenic
1013272824 6:108559487-108559509 CCGGGAGAGGAGGGAGAAGGGGG - Intergenic
1013356532 6:109350257-109350279 CAGGGAGAGGAGGGGTTTGAGGG + Intergenic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013735436 6:113221903-113221925 CAGGAAGAGGTGGGGGAAGTGGG + Intergenic
1014072231 6:117196062-117196084 CAGTAATAGGAAGGAGAAGAAGG - Intergenic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1014242409 6:119032508-119032530 GAGGGAGAGGAAGAGGAAGAGGG + Intronic
1014471995 6:121827537-121827559 GAGTGAGGAGAGGGGGTAGATGG + Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1015626163 6:135182293-135182315 GAGGGAGAGGAGGAGGAGGAGGG + Intronic
1016121553 6:140348363-140348385 CAGGGACAGGATGTGGAAGAGGG + Intergenic
1016432733 6:144004595-144004617 CATTGATAGGAAGGGGCAGAAGG + Intronic
1016433492 6:144011687-144011709 CAAGGAGAGGTGGGGGAAAAGGG + Intronic
1016798975 6:148149387-148149409 TGCTGAGAGGAGGGGGAAGGTGG - Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017010164 6:150058003-150058025 CAGAGAGAGGATGGGAAAAAGGG + Intergenic
1017036282 6:150270065-150270087 CAGTGAGGGGGAGGGGAAGCTGG + Intergenic
1017320989 6:153092895-153092917 CAGTGAAAGGTGGGGGGAAATGG + Intronic
1017485765 6:154900714-154900736 CAAGGAAAGGAGGGGGAAGATGG + Intronic
1017764021 6:157592680-157592702 CAGGGAGGGGAGGGGGAAGGAGG + Intronic
1018038092 6:159898710-159898732 AAGAGGGAGGAGGAGGAAGAGGG - Intergenic
1018089493 6:160333443-160333465 GAGTGAGAGGAGTGGACAGAGGG + Intergenic
1018371308 6:163170661-163170683 CAGTGCAAGGTGGGGGAAGCTGG - Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018747440 6:166773250-166773272 GGGTGAGGAGAGGGGGAAGAGGG + Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1018931609 6:168243721-168243743 CAGAGAGAGGATGGAGAGGAAGG - Intergenic
1019066833 6:169309373-169309395 CACTGGGAGGAGGGGGGACATGG + Intergenic
1019419071 7:942360-942382 AAGAGAGAGGAGGAGGAGGAAGG + Intronic
1019494920 7:1333357-1333379 AGGAGAGAGGAGGGGGAGGAGGG - Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019517426 7:1446191-1446213 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517435 7:1446210-1446232 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517444 7:1446229-1446251 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517453 7:1446248-1446270 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517483 7:1446335-1446357 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517492 7:1446354-1446376 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517522 7:1446441-1446463 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019564962 7:1674591-1674613 CAGTGAGGGGGGTGGGGAGAGGG + Intergenic
1019597200 7:1863673-1863695 CAGGGAGCGGAGGGGCAAGATGG - Intronic
1019903400 7:4042241-4042263 CTGGGAGTGGATGGGGAAGAAGG - Intronic
1020011490 7:4808002-4808024 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
1020137287 7:5594314-5594336 CAGCGGGAGGAGGTGGAGGAAGG - Intronic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1021697127 7:23286348-23286370 GAGTGGAAGGAGGGGGGAGAGGG - Intergenic
1021958226 7:25847753-25847775 CAGGGAGAAGAAGGGGTAGAGGG - Intergenic
1021962341 7:25885383-25885405 GAGGGAGTGGTGGGGGAAGAAGG - Intergenic
1022124886 7:27346737-27346759 CAGTGAGAGGCAGCCGAAGAAGG + Intergenic
1022228379 7:28387630-28387652 CAGAGGGTGGAGGGGGAGGAGGG + Intronic
1022473389 7:30695046-30695068 AACGGGGAGGAGGGGGAAGAGGG + Intronic
1022508803 7:30922485-30922507 GAGTGAGAGGAGGGAGAGGTTGG - Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022761884 7:33364615-33364637 AGGGGAGAGGAGGGGGAAGGGGG - Intronic
1023018195 7:35986388-35986410 AAGTGAGAGGAGGGAGAAGAAGG + Intergenic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023465201 7:40447105-40447127 CAGTGGAAGCTGGGGGAAGATGG - Intronic
1023507969 7:40920074-40920096 CAAGTAGAGGAGGTGGAAGAAGG - Intergenic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1024119523 7:46222714-46222736 AAGTGAGTTGAGGGGAAAGATGG + Intergenic
1024270138 7:47635767-47635789 GAGAGAGAGGAGAGGGAAGCAGG + Intergenic
1024342933 7:48285363-48285385 CAATGAGAGGTGGAGAAAGAGGG + Intronic
1024394882 7:48854767-48854789 TAATGAGAGGTGGGGGAAGAAGG + Intergenic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1024772516 7:52740816-52740838 CAGTGATCGAAGGGGCAAGAGGG - Intergenic
1024921170 7:54556423-54556445 CATTGGGAGGAGGGAGATGAGGG + Intronic
1024944935 7:54799038-54799060 AAGTGAGATGAGGAGGAAGGAGG + Intergenic
1026020944 7:66705479-66705501 GAGAGAGAGGAGGGGGGAGGGGG + Intronic
1026052507 7:66959155-66959177 CAGGGAGAGGTGGAGGCAGAAGG - Intergenic
1026066992 7:67083451-67083473 CACTGAGTGGCGGTGGAAGATGG + Exonic
1026197142 7:68183054-68183076 CAGGTAGGGGATGGGGAAGAGGG - Intergenic
1026456257 7:70575166-70575188 CAGTGAACAGATGGGGAAGATGG - Intronic
1026638625 7:72105750-72105772 CAGGGAGAAGAGGAAGAAGAAGG + Intronic
1026804075 7:73418604-73418626 GAGAGAGAGGAAGAGGAAGAAGG - Intergenic
1026868018 7:73835149-73835171 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1026868021 7:73835158-73835180 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1026868024 7:73835167-73835189 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1026868027 7:73835176-73835198 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1027199622 7:76055243-76055265 TAGTATGAGGATGGGGAAGAGGG + Intronic
1027252509 7:76408180-76408202 CAGAGAGAGGAGGGGGTTGGAGG - Intronic
1027529481 7:79312887-79312909 CGGTGGGTGGAGGGGGAGGAGGG - Intronic
1027824313 7:83091105-83091127 CAGTGAGTGGAAGTGGGAGAAGG - Intronic
1028002214 7:85513703-85513725 CAGGAAGAGGATGGGGAATAAGG - Intergenic
1028428754 7:90722107-90722129 AAGGGAGAAGAGGGGTAAGAGGG - Intronic
1029271525 7:99379939-99379961 CAGAGAGAGGAGGGGATAGCCGG - Intronic
1029293979 7:99524812-99524834 CAGGAAGAGGAAGGTGAAGATGG + Intronic
1029506885 7:100968186-100968208 CAGGAAGAGAAGGGGGAGGAGGG - Exonic
1029584780 7:101463519-101463541 AAGGGGGAAGAGGGGGAAGAGGG - Intronic
1030105536 7:105983903-105983925 CTGTTTGAGGTGGGGGAAGAAGG - Intronic
1030162023 7:106518640-106518662 GAAGGAGAGGAGAGGGAAGAAGG - Intergenic
1030347328 7:108449358-108449380 CAGTGAAGGGAGGGGGGAGCTGG - Intronic
1030384067 7:108847420-108847442 GAGTGAGGGGAGGGGGAAGTGGG - Intergenic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1030741011 7:113110054-113110076 CAGTGAGAGGAGGAAGGAGAAGG + Intergenic
1030920329 7:115376576-115376598 CAGGAAGAGGAAGAGGAAGAAGG + Intergenic
1031121539 7:117727980-117728002 CAGTGACAGGAGGTGGCACAAGG + Intronic
1031285981 7:119868675-119868697 GAATGAGAGGAGGGGGAAATTGG - Intergenic
1031560891 7:123236759-123236781 TAGGGAGAGGTGGGGGAGGAAGG - Intergenic
1031854634 7:126907312-126907334 AAGAGGAAGGAGGGGGAAGAAGG + Intronic
1032090492 7:128909297-128909319 CAGAGAGAGGAGGAGGGAGAGGG + Intronic
1032284141 7:130528180-130528202 CCGTGGGATGTGGGGGAAGAGGG + Intronic
1032326563 7:130934621-130934643 GAGGGAGAGGAAGAGGAAGAGGG + Intergenic
1032471644 7:132183313-132183335 GATTGAGAGGACAGGGAAGATGG - Intronic
1032634697 7:133693782-133693804 CTGTAAGAGGAAGGGGAAGCAGG + Intronic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1033610831 7:142961876-142961898 AAGTGAGTGGAGGGAGAAGGAGG + Intronic
1033742209 7:144284145-144284167 CAGGGAGTGGTAGGGGAAGAGGG + Intergenic
1033751693 7:144365469-144365491 CAGGGAGTGGTAGGGGAAGAGGG - Exonic
1033899368 7:146116583-146116605 AAGGCAAAGGAGGGGGAAGAGGG - Exonic
1033955360 7:146841334-146841356 CAGAGAGAGAGAGGGGAAGACGG + Intronic
1033969801 7:147025386-147025408 GAGGAAGGGGAGGGGGAAGAAGG + Intronic
1034200096 7:149278800-149278822 GAGTGAGGGGAGGGGGTAGATGG + Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034615357 7:152411523-152411545 GAGAAAGAGGAGGGGGAAGAAGG + Intronic
1034692425 7:153024435-153024457 GAGAGAGAGGAGAGGGAAAAGGG - Intergenic
1034801981 7:154060597-154060619 CAGAGCCAGGGGGGGGAAGAGGG - Intronic
1034946585 7:155266434-155266456 CAGTGACAGGAGGGGAAGGCAGG - Intergenic
1034955739 7:155333336-155333358 GAGTGAGAACACGGGGAAGAAGG + Intergenic
1035100222 7:156389977-156389999 GAGGGAGAGAAGGGGGAGGAAGG - Intergenic
1035368563 7:158363822-158363844 CAGGGAGAGGAGGTGGCCGATGG + Intronic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035402236 7:158574486-158574508 CACTGAGAGGAGGGGCCACAAGG + Intronic
1035418715 7:158709683-158709705 CAGTGAGGGGAGGGGAATGGTGG + Intergenic
1035440205 7:158890980-158891002 CAGTGAGAGGAGTGGATAAAAGG - Intronic
1035736821 8:1894434-1894456 GAGTGAGAGGAAGCTGAAGACGG + Exonic
1036065473 8:5376373-5376395 CAGTGATAGAATGCGGAAGAAGG - Intergenic
1036448745 8:8846333-8846355 GAGGGGGAGGAGGGGGAGGAGGG + Intronic
1036472844 8:9066148-9066170 GAGGAAGAGGAGGAGGAAGAAGG - Intronic
1036737668 8:11332093-11332115 CTGTGAGAGGACAGGGAAGGTGG + Exonic
1037041671 8:14244141-14244163 AAGGAAGAGGAGGAGGAAGAAGG - Intronic
1037041675 8:14244160-14244182 AAGGAAGAGGAGGAGGAAGAAGG - Intronic
1037041679 8:14244179-14244201 AAGGAAGAGGAGGAGGAAGAAGG - Intronic
1037475321 8:19251465-19251487 CAGAGAGTGGAGAGGGAAGTGGG + Intergenic
1037703491 8:21295988-21296010 GAGTGAGAGCTGGGGGGAGAGGG - Intergenic
1037703498 8:21296012-21296034 GAGTGAGAGCTGGGGGGAGAGGG - Intergenic
1037772414 8:21810349-21810371 CAGTGAGGGGGGTGGGCAGAGGG - Intronic
1037877060 8:22553524-22553546 CAGGGAATGGAGGGGCAAGAGGG - Intronic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1038284955 8:26198475-26198497 GAGGGGGAGGAGGGGGAGGAGGG - Intergenic
1038288945 8:26231213-26231235 GAAAGAGAGGAGGAGGAAGAGGG + Intergenic
1038336361 8:26648915-26648937 CAGTGAGTGGTGGTGGGAGAGGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039475095 8:37835466-37835488 CAGTGAGAGGAGGTGGGAGGAGG + Intronic
1039487907 8:37926372-37926394 GAGGGAGAGAGGGGGGAAGAAGG - Intergenic
1039963800 8:42269652-42269674 AAGAGAAAGGAGAGGGAAGAGGG + Intergenic
1040079756 8:43274862-43274884 GAGTGAGAGGAAGAGGAGGAGGG - Intergenic
1040460676 8:47644813-47644835 CAGTGAGGGGAAGCTGAAGAGGG + Intronic
1041100929 8:54396007-54396029 CAGTGATATGGTGGGGAAGAAGG + Intergenic
1041107825 8:54459030-54459052 CAGTGGAAGGAAGGGGGAGAGGG - Intronic
1041223192 8:55671877-55671899 CAGTGAGGGGAGGGCTAAGGAGG + Intergenic
1041609910 8:59833498-59833520 GAGGGAGAGGAGGAGGCAGAGGG + Intergenic
1041698566 8:60763002-60763024 CAGGGGGAGGTGGGAGAAGATGG + Intronic
1041796891 8:61754336-61754358 AAGAGGGAGGAGGGGAAAGAAGG - Intergenic
1042101551 8:65280321-65280343 GAGTGAGAGGAGGGAGATGGAGG + Intergenic
1042703992 8:71647405-71647427 AAGTGGGAGGAGGGTGAGGATGG + Intergenic
1042827488 8:72993440-72993462 CAATGAGAGGTAGGGGAAGTTGG + Intergenic
1043548040 8:81337245-81337267 GAGGAAGAGGAGGCGGAAGAAGG + Intergenic
1043626868 8:82272963-82272985 CAGAGAGAGGTGGAGCAAGATGG + Intergenic
1043778193 8:84297189-84297211 CAGTGGGAGGAGGGAGAGGAAGG - Intronic
1044014199 8:87030930-87030952 GAGGGGGAGGAGGGGGAAGGGGG - Intronic
1045046040 8:98279517-98279539 CAGTGAAAGGACAGGGAAGTGGG - Intronic
1045151006 8:99408044-99408066 CAGAGAGAGCACTGGGAAGAGGG + Intronic
1045226321 8:100249593-100249615 GACTGAGAGGAAGGGGAAGTGGG + Intronic
1045355232 8:101381607-101381629 CACAGAAAGGAGGGGGAAAATGG - Intergenic
1045357930 8:101405766-101405788 GAGGGAGATGAGAGGGAAGAGGG - Intergenic
1045383301 8:101647873-101647895 GATTGGGAGGAGGGGGAGGAGGG + Intronic
1045458166 8:102402584-102402606 AAGTGAGAAGTGGAGGAAGATGG - Intronic
1045549965 8:103162913-103162935 CAGTGAGACTTGGGGGAACAGGG - Intronic
1045679275 8:104641943-104641965 GAGGGAGGGAAGGGGGAAGAAGG - Intronic
1046146122 8:110160820-110160842 GAGGGAGAGGAGGGAGAAGAAGG + Intergenic
1046543106 8:115612166-115612188 CAAAGAGAGGAGGAAGAAGAAGG + Intronic
1046687861 8:117247169-117247191 CAATGAGAGGAAGGGAAAGCTGG - Intergenic
1046709915 8:117499296-117499318 CAGAGAGAGGAGGTGGAAAGGGG - Intergenic
1047157536 8:122337594-122337616 CGGTGGGTGGTGGGGGAAGATGG + Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047750433 8:127876521-127876543 AAGGGAGAGAAGGGGAAAGAAGG - Intergenic
1048007613 8:130431953-130431975 AAGGAGGAGGAGGGGGAAGAAGG + Intronic
1048012112 8:130466219-130466241 GAGGAAGAGAAGGGGGAAGAAGG - Intergenic
1048014567 8:130485902-130485924 GAGACAGAGGTGGGGGAAGAAGG + Intergenic
1048102422 8:131368224-131368246 GAGTATGAGGAAGGGGAAGATGG + Intergenic
1048293435 8:133197559-133197581 CATAGAGAGGAGGAGGAGGAGGG - Intronic
1048357780 8:133667581-133667603 GAGTGGGAGGAGGAGGAAGAGGG - Intergenic
1048451074 8:134534558-134534580 GAAGGAGAGGAGGAGGAAGAGGG + Intronic
1048605338 8:135962624-135962646 CTGTGGGAGGAGGGGGAGGCTGG - Intergenic
1049060497 8:140272724-140272746 CAGTGAGGGGAGAGGGGAGGAGG + Intronic
1049122022 8:140747649-140747671 GAGGAAGAGGAGGGGGAGGAAGG + Intronic
1049122057 8:140747735-140747757 AAGTAGGAGGAGGGGGAGGAAGG + Intronic
1049170481 8:141157621-141157643 CATTGGGAGGAGTGGGAAGGAGG + Intronic
1049205689 8:141362468-141362490 CATTCAGACAAGGGGGAAGACGG - Intronic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049414041 8:142487380-142487402 CAGTGAGCGGAGGGGCAGGAGGG - Intronic
1049426995 8:142542133-142542155 CAGTGAGTGGTTGGGGAAGTCGG - Exonic
1049454610 8:142680640-142680662 CACGGAGAGGAGGGGAAGGAAGG + Intronic
1049575845 8:143389241-143389263 CCCTGTGAGGAGGGGGAAGCCGG - Intergenic
1049695975 8:143984496-143984518 CAGTAGGAGGAGGGGGCTGAAGG + Intronic
1049706213 8:144044051-144044073 GAGTGAGTGCAGGGGGAAGGTGG - Intronic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1050651044 9:7777075-7777097 GAGGGAGAGGAGGAGGAAAAAGG + Intergenic
1050742617 9:8839766-8839788 CAGTGGGAGAAATGGGAAGAAGG + Intronic
1051345183 9:16144971-16144993 CAGTGAAAGGAGGAGGCTGATGG - Intergenic
1051427682 9:16950289-16950311 CAGGGAGAGGATGGGGCTGAAGG + Intergenic
1051783959 9:20721884-20721906 AAGGGAGGGGAGGGGGAGGAAGG - Intronic
1052049735 9:23831318-23831340 GAGTGAGAGGGGGAGGAGGAGGG - Intergenic
1052051156 9:23850873-23850895 CATAGGGAGGTGGGGGAAGAGGG - Intergenic
1052523998 9:29589020-29589042 GAGAGAGAGAAGGGGGAGGAAGG - Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1052955439 9:34250192-34250214 CAGAGAAAGGAGGGGGTAGTTGG - Intronic
1053138152 9:35664735-35664757 CAGTGAGTGGAAGGGGCACAGGG - Exonic
1053180056 9:35961004-35961026 TAGGGAGAGCAAGGGGAAGAGGG + Intergenic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054155875 9:61639788-61639810 AAGGCAGAGGAGGAGGAAGAAGG + Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054359523 9:64100260-64100282 GAGGGAGAGGAGGAGGGAGAGGG - Intergenic
1054374268 9:64437703-64437725 CAGAGAGAGGAGGGGCACCAAGG - Intergenic
1054408031 9:64778908-64778930 AAGTAGGAGGAGGAGGAAGAGGG + Intergenic
1054850638 9:69843434-69843456 GGGGGAGGGGAGGGGGAAGAAGG - Intronic
1054973738 9:71118801-71118823 AAGAGAGAGAAGGGGGAGGAAGG + Intronic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1055542348 9:77324844-77324866 CAATGAGAGGCGGAGCAAGATGG - Intronic
1055544818 9:77358864-77358886 AAGAGAAAGTAGGGGGAAGAGGG - Intronic
1055758752 9:79583561-79583583 AAGTGAGAGGTTGGGGAAGGAGG + Intronic
1055805680 9:80090251-80090273 GAATAAGAGGATGGGGAAGAGGG + Intergenic
1056137751 9:83646590-83646612 GAGGGAGGGAAGGGGGAAGAAGG + Intergenic
1056226668 9:84502290-84502312 GAGGGTGAGGAGGGGGAAGTGGG + Intergenic
1056513363 9:87327130-87327152 GAGGGGGAGGAGGAGGAAGAAGG + Intergenic
1056544249 9:87600830-87600852 GGGTGTGAGGAGGGGGCAGAAGG + Intronic
1056546798 9:87620344-87620366 TAGTCTGAGGAGGGGGAAGAAGG - Intronic
1057164003 9:92912469-92912491 CAGTGGGATGAGGGGCAAGGAGG + Intergenic
1057186045 9:93058222-93058244 CAGTGAGAGACAGGGAAAGAAGG + Intergenic
1057575538 9:96239250-96239272 TAGTGAGAGGGGCAGGAAGAAGG + Intronic
1057911556 9:99023786-99023808 GGGTGAGAGGAGGGGGAGGGAGG - Intronic
1058075459 9:100646028-100646050 CTGTGAGGGGTGGGGGGAGAGGG - Intergenic
1058560710 9:106226100-106226122 GAGAGAGAGGAAGGGGGAGATGG - Intergenic
1058679879 9:107431521-107431543 CAGTGACAAGAGGGAGAGGAGGG - Intergenic
1058740666 9:107939237-107939259 CAGTGATAGAGGGGAGAAGAGGG + Intergenic
1059386920 9:113971789-113971811 CAGTCAGAGGAGGGGTAGGGTGG + Intronic
1059409731 9:114124374-114124396 GAGGCAGAGGAGGGGGAGGAGGG + Intergenic
1059670443 9:116485917-116485939 CAGGGAGAGGAAGGGGAAAATGG + Intronic
1059751932 9:117255778-117255800 CAGGGAGGGGAGGAGGAAGAAGG + Intronic
1060010534 9:120039685-120039707 GAAGAAGAGGAGGGGGAAGAGGG + Intergenic
1060152650 9:121298788-121298810 CAGTGCTAGGAGGGAGGAGAGGG + Intronic
1060417367 9:123441372-123441394 CAGAAAGATGAGGGGTAAGAAGG - Intronic
1060730156 9:126031779-126031801 CAGAAAGAGGAGGGGGAAGAGGG + Intergenic
1060799424 9:126534318-126534340 CAGTGACAGAAGTAGGAAGAAGG + Intergenic
1060917094 9:127397838-127397860 GAGTGGGTGGAGGGGGAGGATGG + Intronic
1060988692 9:127836132-127836154 CCGGGAGAGAAGGGGGAAGTCGG - Intronic
1060999307 9:127893996-127894018 CAGTGAGGGAAGGAAGAAGATGG - Intronic
1061370727 9:130196001-130196023 CTCTGGGAGGAGGGGGAAAATGG + Intronic
1061670559 9:132185872-132185894 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1061716238 9:132520131-132520153 GAGTGAGAGGAGAGGGGAGGGGG - Intronic
1061869878 9:133515000-133515022 GAGAGAGGGGATGGGGAAGAAGG - Intronic
1061933549 9:133845532-133845554 AAGTGCAGGGAGGGGGAAGAGGG - Intronic
1062059496 9:134487367-134487389 CAGGGAGAAGGGGGGCAAGAGGG - Intergenic
1062066571 9:134530860-134530882 GAAAGAGAGAAGGGGGAAGATGG + Intergenic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1185562526 X:1070674-1070696 GAGAGAGAGGAGGGAGAAGGAGG + Intergenic
1185618153 X:1435759-1435781 CTGTGAGAGGAAGGGACAGAGGG + Intronic
1185647993 X:1628707-1628729 GGGAGAGAGGAGGGGGAAGATGG - Intronic
1185662074 X:1735735-1735757 GAGGAAGAGGAGGAGGAAGAGGG - Intergenic
1185769237 X:2752485-2752507 CTGAGAGGGGAGGGAGAAGACGG + Intronic
1185966824 X:4614916-4614938 CAGAGAGAGGAGGGGGGAGAGGG + Intergenic
1186173633 X:6902894-6902916 AAGTAGGAGGAGGGGGAAAAAGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186434957 X:9534770-9534792 CACTCAGAGAGGGGGGAAGAGGG - Intronic
1186967332 X:14802206-14802228 CAGTCAGACAAGGGGGAGGAAGG + Intergenic
1187007614 X:15247870-15247892 CAGTGAGAGTAGGAGGAAGAAGG + Intronic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1187245332 X:17548804-17548826 CAGAGAGAGGAAAAGGAAGAGGG + Intronic
1187356192 X:18574079-18574101 CAGTGTGAGAAGGAGGAAAATGG - Intronic
1187417083 X:19102745-19102767 CAGAGAGAGGTGGGGGAAGCGGG - Intronic
1187778969 X:22795579-22795601 CAATTAGAGGAGTAGGAAGAGGG + Intergenic
1188491509 X:30742937-30742959 GAGGGAGAGGAGGGGGAACAGGG + Intergenic
1188596804 X:31911041-31911063 GAGTGAAAGGATGGGGAAAAGGG + Intronic
1188846542 X:35078722-35078744 CACTGACCTGAGGGGGAAGAAGG - Intergenic
1188979738 X:36716306-36716328 GAGTCAGAGGAGGGAGCAGAGGG + Intergenic
1189261360 X:39681051-39681073 CAGAGCATGGAGGGGGAAGAAGG - Intergenic
1189285050 X:39846225-39846247 GAGTGACTGGAGGGGGCAGAAGG - Intergenic
1189322728 X:40096381-40096403 GAGGGAGAGGAGGGGGAAAGCGG + Intronic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1189680368 X:43509716-43509738 CAGACAGAGGATGTGGAAGAGGG + Intergenic
1190298021 X:49039956-49039978 AGGGGAGGGGAGGGGGAAGAGGG - Intronic
1190397149 X:49996830-49996852 CAGAGAGAAGAGGGTGAATAAGG - Intronic
1190591432 X:52006535-52006557 GAGGGAAAGGAGGGGGAAAATGG - Intergenic
1190778778 X:53577485-53577507 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1191214167 X:57918829-57918851 CACTGAGCAGAAGGGGAAGAAGG - Intergenic
1191929845 X:66359241-66359263 CAGTGTGAGGTGGGGGGAGTAGG + Intergenic
1192363824 X:70455129-70455151 AGGAGAGAGGAGGGGGAAGGAGG - Intronic
1192463431 X:71337535-71337557 CAGTGAAAGCAGTGGGAACAGGG - Intergenic
1193524632 X:82573853-82573875 CAGGGAGAGGTAGGGGAAGATGG - Intergenic
1193804884 X:85983381-85983403 CAGTGAAAGGAAGGAGAAGGTGG + Intronic
1194053526 X:89101670-89101692 CATGCAGAGGTGGGGGAAGACGG - Intergenic
1194318474 X:92411949-92411971 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1194605745 X:95975848-95975870 CTGTGAGAGGTGGAGCAAGATGG + Intergenic
1194739360 X:97554292-97554314 CACTGAGAGGAGAGGTAGGAGGG - Intronic
1194879099 X:99227667-99227689 CAGAGAGAAAAGGGAGAAGAAGG + Intergenic
1195085380 X:101408439-101408461 CACTGAGATGGGGGGGAGGAGGG - Intronic
1195255053 X:103082121-103082143 CAGAGAGAGGAGTGGGGCGAGGG + Intronic
1195557220 X:106240876-106240898 AAGGGAGAGTAGGGGGAGGAGGG + Intergenic
1195652909 X:107304340-107304362 CAGTGAGATGAGGAAGAAGCAGG + Intergenic
1195668374 X:107449984-107450006 GAGGAAGAGGAGGGGGAGGAAGG + Intergenic
1195888791 X:109670611-109670633 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1196017343 X:110954047-110954069 CAGTGAGATCAAGGGGAAGTGGG - Intronic
1196415750 X:115469210-115469232 GAATGAGAGGAGGGGAAAGCTGG + Intergenic
1196577374 X:117335176-117335198 CAGAGGGAGGAGGGAGAAGGGGG - Intergenic
1196749980 X:119107342-119107364 CTTAGAGAGGAGGGGAAAGAAGG + Intronic
1196951790 X:120931747-120931769 GAGGAAGAGGAGGAGGAAGAGGG - Exonic
1196952474 X:120936608-120936630 GAGGAAGAGGAGGAGGAAGAGGG - Exonic
1196953159 X:120941469-120941491 GAGGAAGAGGAGGAGGAAGAGGG - Exonic
1196953844 X:120946329-120946351 GAGGAAGAGGAGGAGGAAGAGGG - Exonic
1196954529 X:120951190-120951212 GAGGAAGAGGAGGAGGAAGAGGG - Exonic
1196955212 X:120956050-120956072 GAGGAAGAGGAGGAGGAAGAGGG - Exonic
1196955899 X:120960933-120960955 GAGGAAGAGGAGGAGGAAGAGGG - Exonic
1196956581 X:120965794-120965816 GAGGAAGAGGAGGAGGAAGAGGG - Exonic
1196957263 X:120970654-120970676 GAGGAAGAGGAGGAGGAAGAGGG - Exonic
1196957945 X:120975514-120975536 GAGGAAGAGGAGGAGGAAGAGGG - Exonic
1196958627 X:120980374-120980396 GAGGAAGAGGAGGAGGAAGAGGG - Exonic
1196959308 X:120985234-120985256 GAGGAAGAGGAGGAGGAAGAGGG - Exonic
1197230556 X:123999432-123999454 CAGGGAGAGAAGGGGGAGGGAGG - Intronic
1197299324 X:124758870-124758892 AGTTGAGAGGAGGGGGAAGAGGG + Intronic
1197436509 X:126434841-126434863 GAGATAGAGGAGGGGGAAGGAGG + Intergenic
1197527291 X:127578264-127578286 CAGTGAGTGGTGGTGGGAGAGGG - Intergenic
1197822746 X:130557966-130557988 CAGTGCCAGGATGGAGAAGAAGG - Intergenic
1198166785 X:134065419-134065441 CAGTGTGGGGAGGGGTAGGATGG - Intergenic
1198376085 X:136041490-136041512 AAGGGAGAGGAGGGGCAACATGG - Intronic
1198480354 X:137034582-137034604 CAGAGAGAGGGGGAGAAAGAGGG - Intergenic
1198806346 X:140499251-140499273 CAGTGAGAACAGGTAGAAGAAGG + Intergenic
1199106260 X:143872872-143872894 CAGAGAGGGGTGGGGGAAGATGG + Intergenic
1199123955 X:144091762-144091784 TAGTGAGAGGAGGGGCCAGCTGG - Intergenic
1199190424 X:144963665-144963687 CTGTCAGAGGAGGAAGAAGAAGG - Intergenic
1199408722 X:147494179-147494201 AAGTTAGAGGTGGGGGATGAGGG + Intergenic
1199571557 X:149271803-149271825 AAGTGAAAGGAGGTGAAAGAAGG - Intergenic
1199671987 X:150155344-150155366 CAGGTGGAGAAGGGGGAAGATGG - Intergenic
1200366055 X:155665752-155665774 CAGTGAGAAGTGGGGGATGAAGG + Intronic
1201146066 Y:11066392-11066414 GAGGGAGAGGAGGGGAGAGAGGG + Intergenic
1201301269 Y:12507137-12507159 CTGAGAGGGGAGGGAGAAGACGG - Intergenic
1201461734 Y:14233013-14233035 GAGAGGGAGGAGGGGGGAGAAGG - Intergenic
1201751494 Y:17436639-17436661 CAGTGAGATGAATGGGGAGATGG + Intergenic