ID: 1021673603

View in Genome Browser
Species Human (GRCh38)
Location 7:23058177-23058199
Sequence CACCTTGGGCACGTGTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021673594_1021673603 11 Left 1021673594 7:23058143-23058165 CCCTAAAATATATAAAACCAAGC 0: 101
1: 849
2: 1361
3: 1147
4: 1212
Right 1021673603 7:23058177-23058199 CACCTTGGGCACGTGTACTCAGG No data
1021673596_1021673603 -6 Left 1021673596 7:23058160-23058182 CCAAGCTGTACCCCGACCACCTT 0: 38
1: 239
2: 660
3: 866
4: 923
Right 1021673603 7:23058177-23058199 CACCTTGGGCACGTGTACTCAGG No data
1021673595_1021673603 10 Left 1021673595 7:23058144-23058166 CCTAAAATATATAAAACCAAGCT 0: 108
1: 876
2: 1412
3: 1153
4: 1257
Right 1021673603 7:23058177-23058199 CACCTTGGGCACGTGTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021673603 Original CRISPR CACCTTGGGCACGTGTACTC AGG Intergenic
No off target data available for this crispr