ID: 1021674590

View in Genome Browser
Species Human (GRCh38)
Location 7:23067606-23067628
Sequence TTCCCTGGACAACAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021674590_1021674600 10 Left 1021674590 7:23067606-23067628 CCTTCCTCTTGTTGTCCAGGGAA No data
Right 1021674600 7:23067639-23067661 GAAAACAGGAAACAGGGGAAGGG No data
1021674590_1021674596 3 Left 1021674590 7:23067606-23067628 CCTTCCTCTTGTTGTCCAGGGAA No data
Right 1021674596 7:23067632-23067654 CAAGAAGGAAAACAGGAAACAGG No data
1021674590_1021674601 15 Left 1021674590 7:23067606-23067628 CCTTCCTCTTGTTGTCCAGGGAA No data
Right 1021674601 7:23067644-23067666 CAGGAAACAGGGGAAGGGAAAGG No data
1021674590_1021674598 5 Left 1021674590 7:23067606-23067628 CCTTCCTCTTGTTGTCCAGGGAA No data
Right 1021674598 7:23067634-23067656 AGAAGGAAAACAGGAAACAGGGG No data
1021674590_1021674595 -4 Left 1021674590 7:23067606-23067628 CCTTCCTCTTGTTGTCCAGGGAA No data
Right 1021674595 7:23067625-23067647 GGAATGGCAAGAAGGAAAACAGG No data
1021674590_1021674603 22 Left 1021674590 7:23067606-23067628 CCTTCCTCTTGTTGTCCAGGGAA No data
Right 1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG No data
1021674590_1021674597 4 Left 1021674590 7:23067606-23067628 CCTTCCTCTTGTTGTCCAGGGAA No data
Right 1021674597 7:23067633-23067655 AAGAAGGAAAACAGGAAACAGGG No data
1021674590_1021674602 18 Left 1021674590 7:23067606-23067628 CCTTCCTCTTGTTGTCCAGGGAA No data
Right 1021674602 7:23067647-23067669 GAAACAGGGGAAGGGAAAGGTGG No data
1021674590_1021674599 9 Left 1021674590 7:23067606-23067628 CCTTCCTCTTGTTGTCCAGGGAA No data
Right 1021674599 7:23067638-23067660 GGAAAACAGGAAACAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021674590 Original CRISPR TTCCCTGGACAACAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr