ID: 1021674594

View in Genome Browser
Species Human (GRCh38)
Location 7:23067621-23067643
Sequence TTTTCCTTCTTGCCATTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021674594_1021674603 7 Left 1021674594 7:23067621-23067643 CCAGGGAATGGCAAGAAGGAAAA No data
Right 1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG No data
1021674594_1021674604 28 Left 1021674594 7:23067621-23067643 CCAGGGAATGGCAAGAAGGAAAA No data
Right 1021674604 7:23067672-23067694 GGTGAGAAACTTGTGCTCCAAGG No data
1021674594_1021674599 -6 Left 1021674594 7:23067621-23067643 CCAGGGAATGGCAAGAAGGAAAA No data
Right 1021674599 7:23067638-23067660 GGAAAACAGGAAACAGGGGAAGG No data
1021674594_1021674602 3 Left 1021674594 7:23067621-23067643 CCAGGGAATGGCAAGAAGGAAAA No data
Right 1021674602 7:23067647-23067669 GAAACAGGGGAAGGGAAAGGTGG No data
1021674594_1021674601 0 Left 1021674594 7:23067621-23067643 CCAGGGAATGGCAAGAAGGAAAA No data
Right 1021674601 7:23067644-23067666 CAGGAAACAGGGGAAGGGAAAGG No data
1021674594_1021674598 -10 Left 1021674594 7:23067621-23067643 CCAGGGAATGGCAAGAAGGAAAA No data
Right 1021674598 7:23067634-23067656 AGAAGGAAAACAGGAAACAGGGG No data
1021674594_1021674600 -5 Left 1021674594 7:23067621-23067643 CCAGGGAATGGCAAGAAGGAAAA No data
Right 1021674600 7:23067639-23067661 GAAAACAGGAAACAGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021674594 Original CRISPR TTTTCCTTCTTGCCATTCCC TGG (reversed) Intergenic
No off target data available for this crispr