ID: 1021674603

View in Genome Browser
Species Human (GRCh38)
Location 7:23067651-23067673
Sequence CAGGGGAAGGGAAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021674594_1021674603 7 Left 1021674594 7:23067621-23067643 CCAGGGAATGGCAAGAAGGAAAA No data
Right 1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG No data
1021674590_1021674603 22 Left 1021674590 7:23067606-23067628 CCTTCCTCTTGTTGTCCAGGGAA No data
Right 1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG No data
1021674592_1021674603 18 Left 1021674592 7:23067610-23067632 CCTCTTGTTGTCCAGGGAATGGC No data
Right 1021674603 7:23067651-23067673 CAGGGGAAGGGAAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021674603 Original CRISPR CAGGGGAAGGGAAAGGTGGA TGG Intergenic
No off target data available for this crispr