ID: 1021675492

View in Genome Browser
Species Human (GRCh38)
Location 7:23076532-23076554
Sequence TAGGGGAAGGACAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021675484_1021675492 19 Left 1021675484 7:23076490-23076512 CCACTGACTTTTCAGGGCCACTC No data
Right 1021675492 7:23076532-23076554 TAGGGGAAGGACAATGAGGAAGG No data
1021675485_1021675492 2 Left 1021675485 7:23076507-23076529 CCACTCTCATGTGTGTGTTTGCA No data
Right 1021675492 7:23076532-23076554 TAGGGGAAGGACAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021675492 Original CRISPR TAGGGGAAGGACAATGAGGA AGG Intergenic
No off target data available for this crispr