ID: 1021687971

View in Genome Browser
Species Human (GRCh38)
Location 7:23206050-23206072
Sequence CCCCGTGTCTGCAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 310}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021687971_1021687978 -10 Left 1021687971 7:23206050-23206072 CCCTCTGCCCTGCAGACACGGGG 0: 1
1: 0
2: 3
3: 25
4: 310
Right 1021687978 7:23206063-23206085 AGACACGGGGGGCCCCGCTGTGG 0: 1
1: 0
2: 0
3: 5
4: 123
1021687971_1021687983 5 Left 1021687971 7:23206050-23206072 CCCTCTGCCCTGCAGACACGGGG 0: 1
1: 0
2: 3
3: 25
4: 310
Right 1021687983 7:23206078-23206100 CGCTGTGGCTGCCCACTGGCCGG 0: 1
1: 2
2: 2
3: 16
4: 223
1021687971_1021687984 6 Left 1021687971 7:23206050-23206072 CCCTCTGCCCTGCAGACACGGGG 0: 1
1: 0
2: 3
3: 25
4: 310
Right 1021687984 7:23206079-23206101 GCTGTGGCTGCCCACTGGCCGGG 0: 1
1: 1
2: 5
3: 37
4: 346
1021687971_1021687985 12 Left 1021687971 7:23206050-23206072 CCCTCTGCCCTGCAGACACGGGG 0: 1
1: 0
2: 3
3: 25
4: 310
Right 1021687985 7:23206085-23206107 GCTGCCCACTGGCCGGGCGCAGG 0: 1
1: 0
2: 3
3: 29
4: 223
1021687971_1021687989 26 Left 1021687971 7:23206050-23206072 CCCTCTGCCCTGCAGACACGGGG 0: 1
1: 0
2: 3
3: 25
4: 310
Right 1021687989 7:23206099-23206121 GGGCGCAGGCCTCGAAGCCGCGG 0: 1
1: 0
2: 0
3: 11
4: 134
1021687971_1021687979 1 Left 1021687971 7:23206050-23206072 CCCTCTGCCCTGCAGACACGGGG 0: 1
1: 0
2: 3
3: 25
4: 310
Right 1021687979 7:23206074-23206096 GCCCCGCTGTGGCTGCCCACTGG 0: 1
1: 0
2: 2
3: 27
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021687971 Original CRISPR CCCCGTGTCTGCAGGGCAGA GGG (reversed) Intergenic
900207446 1:1437668-1437690 CCCCGTCTCAGCAGGGTACACGG - Intronic
900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG + Intronic
900472317 1:2861010-2861032 CCCCAGGTCTTCAGGCCAGAGGG - Intergenic
900584292 1:3424992-3425014 CCCCGTGTCCCCTGGGCAGGCGG - Intronic
900596472 1:3482355-3482377 CCCGGAGGCTGCAGGGCAGCTGG - Intergenic
900760404 1:4466719-4466741 CACTGTGTCTGCAGGGCAGTAGG - Intergenic
900881160 1:5382334-5382356 CCTTGTGTCTGCAGAGTAGAGGG + Intergenic
901144679 1:7057002-7057024 CCTCCTGTCTGCATGGCATAGGG + Intronic
901679376 1:10904273-10904295 CCCAGTGTCTGGAGGCCAAACGG + Intergenic
902436771 1:16403146-16403168 CCACGTGTCTCCAGGGCAGGTGG - Intronic
902445286 1:16459338-16459360 CCCCTCCTCTGGAGGGCAGATGG - Exonic
902545370 1:17186436-17186458 CCCCGTGCTCCCAGGGCAGAGGG + Intergenic
903297729 1:22355839-22355861 CCCAGTTTCAGCAGGGAAGATGG + Intergenic
904396467 1:30225531-30225553 CCCAGTGTCTGACGGCCAGATGG - Intergenic
904799720 1:33083794-33083816 CCCCAAGCCTACAGGGCAGAAGG - Intronic
905202679 1:36324441-36324463 CCCCGTGGAGACAGGGCAGAAGG - Intronic
906948468 1:50315650-50315672 CTCCTTGTCTGCAGAGCAGGTGG - Intergenic
907459941 1:54599507-54599529 GACCCTGTCTGCAGGGCAAAGGG - Intronic
907581593 1:55577220-55577242 CCCCGTGTCTGGAGAGAAGGGGG - Intergenic
910083060 1:83364732-83364754 CCATGTGTCTGCAGGTCAGAGGG - Intergenic
910820196 1:91337663-91337685 CCCAGTATCTGCAGGTCACAGGG - Intronic
915744845 1:158147919-158147941 TACCTTTTCTGCAGGGCAGATGG + Intergenic
916674514 1:167054459-167054481 CCCGGTTCCTGCAGGGCAGCAGG + Exonic
917852667 1:179078737-179078759 CCCAGTGTTTCCAAGGCAGATGG + Intergenic
918103929 1:181400438-181400460 GGCCGTGGCTGCAGGGAAGAGGG + Intergenic
919069798 1:192739565-192739587 CACCTTTTCTGCGGGGCAGATGG + Intergenic
923410842 1:233707636-233707658 CCCTGTGTCAGCAAGGCTGATGG + Intergenic
923559499 1:235027966-235027988 CACGGAGGCTGCAGGGCAGAAGG - Intergenic
1063382455 10:5594348-5594370 TTCCCTGTCTGCAAGGCAGAGGG - Intergenic
1064074390 10:12257302-12257324 CCCAGTGTCATCAGGACAGAAGG - Intergenic
1064691261 10:17920712-17920734 CCCTGTGTCTGCAGCACAAATGG + Intergenic
1067242517 10:44508584-44508606 GCCTGTGTCTGCTGGGGAGAAGG + Intergenic
1067376596 10:45733016-45733038 CCCCGTAGCAGCAGGGCATATGG - Intronic
1067582842 10:47456327-47456349 CCCCGGGTGTGCTGGGCAGGGGG + Intergenic
1067884290 10:50073707-50073729 CCCCGTAGCAGCAGGGCATATGG - Intronic
1069457359 10:68563162-68563184 CTTCCTCTCTGCAGGGCAGAGGG + Intronic
1069903000 10:71716585-71716607 CCTCTTGTCTGCATGGCAGATGG - Intronic
1070720937 10:78756703-78756725 CCCTGTGGCAGCAGGCCAGATGG + Intergenic
1072629413 10:97135135-97135157 CCCCGTGCCTGCAGAGTCGAAGG + Intronic
1072780132 10:98244760-98244782 CCCCCTGGCTGCAGTGCAGCTGG - Exonic
1074159074 10:110822271-110822293 CCTCGTGCCTGCACAGCAGAGGG + Intronic
1074808152 10:117074823-117074845 TCCCGTGTCTGTAGGGAGGATGG + Intronic
1075941508 10:126394267-126394289 TGCCGTGTCTTCAGGGCAGGAGG + Intergenic
1076358134 10:129867591-129867613 CCCCAGGGCTGCAGGGCAGGGGG + Intronic
1077802692 11:5556969-5556991 CATCGTGTCTGCAGCGCAGTGGG + Intronic
1078475066 11:11622537-11622559 GCCGGTGGCTGAAGGGCAGAGGG - Intergenic
1078555274 11:12320297-12320319 CCCCGTGCCAGCTGGGGAGATGG + Intronic
1081017434 11:37900315-37900337 GCCAGAGTCTGCAGGACAGATGG + Intergenic
1081566039 11:44261949-44261971 CCCCTGCTCTGCAGTGCAGAAGG + Exonic
1083856647 11:65396367-65396389 CCCCGGGTCAGACGGGCAGAGGG + Intronic
1084229653 11:67742411-67742433 CCAAGTGCCTGCAGGGAAGATGG - Intergenic
1084891218 11:72238043-72238065 CTCCGTGCCTGCAGGGCGGGCGG + Exonic
1089411509 11:118246954-118246976 CCCCAGGTCTGAAGGGCAAAGGG + Intronic
1090780220 11:130001665-130001687 TCGCGTGGCTGGAGGGCAGACGG + Intronic
1090807472 11:130211353-130211375 GCCAGTGTCAGGAGGGCAGAAGG + Intergenic
1091065075 11:132502157-132502179 GCCCGTGTCAGCAGAGCAGAGGG - Intronic
1092051069 12:5470585-5470607 TCCCATGGCTGCAGGGCAGGGGG + Intronic
1096714332 12:53482362-53482384 CCACGTTTCTGCAGGAGAGATGG + Exonic
1097141879 12:56908890-56908912 CCCCGAGCCTGCAGGGCTAAGGG - Intergenic
1097533747 12:60839101-60839123 TACTGTGTCTGCATGGCAGAAGG + Intergenic
1100823624 12:98454986-98455008 CCACGAGTCTGGAGGGCAGCTGG - Intergenic
1101803224 12:108040824-108040846 CCCGGTGGCTGCAGGAAAGACGG + Intergenic
1102819852 12:115898760-115898782 CCCCGTGTCAGTTGGCCAGAAGG + Intergenic
1103565353 12:121812530-121812552 CCCCGAGACTGCTGGGCAGAGGG + Intronic
1105356448 13:19663906-19663928 CCCTGGGTCTGCAGGGCACCTGG + Intronic
1106549785 13:30761157-30761179 TCCCTTGTCTGCAGGGCTCAGGG - Intronic
1113878291 13:113608145-113608167 CCCCATGCCTGCAGGGCATGTGG - Intronic
1114036754 14:18636505-18636527 CACCGGGACTGCAGGGCAGCAGG - Intergenic
1114121882 14:19678532-19678554 CACCGGGACTGCAGGGCAGCAGG + Intergenic
1118747399 14:68784357-68784379 CCACTTGCCTGCTGGGCAGAAGG - Intergenic
1119265058 14:73259527-73259549 CCCCCTGTCAGCAGAGCAGGTGG + Exonic
1119800771 14:77443204-77443226 CCCCGTGTCTGTAGTGCTCAGGG - Intronic
1119806228 14:77484282-77484304 CCGGGTGTCTGCAGGGCTGCTGG + Intronic
1121118058 14:91357547-91357569 TCCACTGTCTCCAGGGCAGACGG + Intronic
1121712987 14:96053007-96053029 CCCGGTTTCTGCAGGGCTGAGGG + Intronic
1122236636 14:100334119-100334141 CCCTGACTCTGCAGGACAGAGGG + Exonic
1122267335 14:100552835-100552857 CCTGGTGACTGCTGGGCAGACGG + Intronic
1122862795 14:104590032-104590054 CACCCTGACTGCAGGGCAAAGGG - Intronic
1123700538 15:22911611-22911633 GGCCCTGTCTGCTGGGCAGATGG - Intronic
1124218858 15:27832240-27832262 GCCAGTGTGTGCAGGGCAGGTGG - Intronic
1125505510 15:40265605-40265627 CCCAGCGTCAGCAGAGCAGATGG - Intronic
1125731154 15:41893494-41893516 CCCAAAGTCTGCAGGGCTGATGG - Exonic
1126186445 15:45835166-45835188 CCAAGATTCTGCAGGGCAGATGG - Intergenic
1126792581 15:52234642-52234664 CCCTGTCTCTGTAGGGCTGATGG - Intronic
1128866687 15:71119762-71119784 CACCGTGCCTGCAGGGAGGAAGG - Intronic
1129200691 15:73997166-73997188 CCCATTTCCTGCAGGGCAGATGG - Intronic
1130213418 15:81946667-81946689 CACCTTTTCTGCAGGGCAGATGG + Intergenic
1130224082 15:82044932-82044954 CCCCGTGTCTTCAGAGCTGACGG - Intronic
1130691578 15:86085975-86085997 ACCCACCTCTGCAGGGCAGAGGG + Intergenic
1131274945 15:90973078-90973100 TCCCATCTCTGCAGGACAGAGGG + Intronic
1131550172 15:93350504-93350526 CACCTCCTCTGCAGGGCAGAGGG - Intergenic
1131717621 15:95130517-95130539 CACTGTCTCTGCAGGGCTGATGG - Intergenic
1132830279 16:1924624-1924646 AGCCTTGTCTGCAGGGAAGACGG - Intergenic
1132880178 16:2158668-2158690 CCCTGCTGCTGCAGGGCAGAAGG + Intronic
1134882746 16:17759941-17759963 GCCCGTCTCTGGAGGGCTGAGGG + Intergenic
1136459268 16:30399612-30399634 CCCCATCTCTGCAGCTCAGAAGG - Exonic
1137456649 16:48622885-48622907 CCCCATTTCTGCAAGGCGGAGGG + Intergenic
1137570272 16:49560918-49560940 CACCGTGTTTCCAGGGCAGGAGG + Intronic
1139643640 16:68311276-68311298 CCCCGGCTCTGCAGTGCAGCCGG + Exonic
1140475266 16:75236785-75236807 ACCAGTGTCTGCAGGGCTGGGGG - Intronic
1140847392 16:78903518-78903540 TACCTTTTCTGCAGGGCAGATGG - Intronic
1140868649 16:79086967-79086989 CCCCGTGTCTGAATGGGATATGG + Intronic
1141506471 16:84481600-84481622 CCCTGTTTCTGCAGAGCTGAGGG - Intronic
1141643976 16:85357590-85357612 CACAGTGTCTGCAGAGCAGCCGG + Exonic
1141861353 16:86718584-86718606 CCCGGGGTCTGCAGGGAAGCAGG - Intergenic
1141887987 16:86905961-86905983 GCCAGTGTCTGCTAGGCAGAAGG + Intergenic
1142035073 16:87857617-87857639 CCCAGTCTCTGCAGAGCACAAGG + Intronic
1143393578 17:6575104-6575126 CACTGGGGCTGCAGGGCAGATGG + Intergenic
1144306430 17:13972973-13972995 GCCCTTTTCTGCAGGGCAGATGG + Intergenic
1144447032 17:15341099-15341121 CCCCGTGGCTGCAGATCTGAAGG + Intronic
1145247065 17:21276202-21276224 GCCCGGGTCTGCAGGGCTCAAGG + Intergenic
1146521021 17:33525599-33525621 CTCCATGTCTGCAAGGCAGGAGG - Intronic
1147459294 17:40558083-40558105 CCCCAGGTCTGGAGGCCAGAGGG - Intronic
1147685873 17:42286674-42286696 ACCCAGGTCTGGAGGGCAGAGGG - Intergenic
1148132468 17:45270443-45270465 CCGCGTGTCTGCAGCGGAGCTGG - Exonic
1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG + Intronic
1152340714 17:79722581-79722603 ACCAGTGTCTGTAGGGGAGAGGG - Intergenic
1152845531 17:82597389-82597411 CCCCGGGGCTGCAGGGCTGATGG + Intronic
1153800662 18:8665560-8665582 CACCTTTTCTGCAAGGCAGATGG - Intergenic
1153893288 18:9537739-9537761 CCCCGTGTCTGCAGAGGTGAGGG - Exonic
1154199638 18:12290299-12290321 GCTCCAGTCTGCAGGGCAGAGGG - Intergenic
1154499448 18:14987968-14987990 GCAAGTGCCTGCAGGGCAGAGGG + Intergenic
1155160231 18:23189617-23189639 CCCGGGGACTGCAGGGCAGGCGG + Intronic
1156290718 18:35747132-35747154 CCCTGTGTCAGCAGGGCTGGTGG + Intergenic
1157305426 18:46513647-46513669 CCCAGAGCCTGCAGGGCACATGG + Intronic
1158155075 18:54416696-54416718 CCCAGTGTCTGGAATGCAGAAGG - Intergenic
1158597874 18:58832261-58832283 CCCCTTTCCTGCTGGGCAGATGG - Intergenic
1158608764 18:58919646-58919668 CCCAGTGTCTGCTGTGAAGACGG + Exonic
1158996501 18:62925894-62925916 CCCAGTGACTCCAGTGCAGATGG + Intronic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1161107873 19:2453555-2453577 AGCCGTGTCTGCAGGGCATGTGG - Intronic
1161237066 19:3203587-3203609 CCCAGTGTCCACAGGGCCGAGGG + Intronic
1161801913 19:6421080-6421102 CCCCTTGTCTGAAGGGCTGTGGG - Intronic
1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG + Intergenic
1163400920 19:17091918-17091940 CCCCTGGTGTGCGGGGCAGAAGG - Intronic
1163555241 19:17988396-17988418 CTCCCTGTGTGCAGGGCAGAGGG - Exonic
1164070942 19:21767472-21767494 CCCAATATCTGCAGGTCAGAGGG + Exonic
1164188797 19:22896773-22896795 CCCCCTGGCTGCAGTGCAGTGGG + Intergenic
1165246351 19:34500510-34500532 CCCTGAGGCTGCAGGGCACAGGG - Exonic
1166168592 19:41010175-41010197 CCCCATTTCTGCAGCTCAGAAGG - Intronic
1166315091 19:41985179-41985201 AGCCGTGCCTGCAGGCCAGAGGG + Exonic
1166531781 19:43547151-43547173 ACCCAGGTCTGCAGGGCAGGTGG - Intronic
1167220758 19:48196722-48196744 AGAGGTGTCTGCAGGGCAGACGG - Intronic
1168282270 19:55312056-55312078 CCCCGTGGGGTCAGGGCAGAGGG - Exonic
925009532 2:471611-471633 CCTGGTGTCTACAAGGCAGAAGG + Intergenic
925489321 2:4374825-4374847 TCCCGTGTCTGGAGGGGAGGTGG - Intergenic
926883719 2:17577661-17577683 CCCCTGGTCCCCAGGGCAGATGG - Intronic
927510688 2:23642323-23642345 CCCTGTGCCTGCAAGGGAGATGG - Exonic
928425957 2:31177890-31177912 CCCCTTGTCAGCACCGCAGAGGG + Intronic
929397560 2:41540738-41540760 CCCAGTGTGTACAGAGCAGAAGG + Intergenic
930612270 2:53555640-53555662 CCGGGTGTCTGCAGGGCAGAGGG + Intronic
931653156 2:64486916-64486938 CCCAGTGCCTGCAGAGCATAAGG - Intergenic
932331632 2:70901287-70901309 CCCCGGCTCTGCAGGGCGGCCGG + Intronic
933374979 2:81467459-81467481 CGGGGCGTCTGCAGGGCAGAGGG + Intergenic
933647343 2:84823460-84823482 GCCTGAGTCTGCAGGGCACAAGG - Intronic
934127778 2:88915322-88915344 GGCCGTGTCTCCAGGACAGAGGG - Intergenic
937019610 2:118638502-118638524 CACCTTTTCTGCATGGCAGATGG + Intergenic
937287716 2:120763629-120763651 CCCTCTGTCTGCAGGGGAGTGGG - Intronic
938135731 2:128755067-128755089 CCCAGAGTCTCCAGGGCCGAGGG - Intergenic
938379578 2:130829083-130829105 GCCCGAGGCTGCAGGGCAGGTGG - Intergenic
938498652 2:131818336-131818358 GCAAGTGCCTGCAGGGCAGAGGG + Intergenic
942021959 2:171874959-171874981 CCCCTTTTCTCCACGGCAGATGG + Intronic
942218611 2:173747144-173747166 TCCCGTGTCTGAAATGCAGACGG + Intergenic
945314639 2:208359325-208359347 TCCCTTTTCTGCATGGCAGACGG - Intergenic
947150763 2:227112729-227112751 GCCAGTGGCTGCAGGGAAGAGGG - Intronic
948068095 2:235097160-235097182 CTGCTTGGCTGCAGGGCAGAGGG + Intergenic
948095989 2:235334415-235334437 CCTTGTGTCTGCAGGGCTGTGGG - Intergenic
948415051 2:237797054-237797076 CCCCTGGGCTGCTGGGCAGATGG - Intronic
948458212 2:238117051-238117073 CCCCATGCCTCCAGGGCAGCTGG - Intronic
948466664 2:238155471-238155493 CCCACTGTTTTCAGGGCAGAGGG + Intergenic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
948937620 2:241177880-241177902 CCCTGTGCCAGCAGGGCAGTGGG - Intronic
1171360829 20:24585257-24585279 GCCGGTGTCTGCTGGGTAGAAGG + Intronic
1172581303 20:36050820-36050842 TCCGTTATCTGCAGGGCAGAGGG + Intergenic
1172609537 20:36239865-36239887 CCCCATGGCTGCCGTGCAGATGG + Exonic
1173485607 20:43438746-43438768 CACCTTTTCTGCGGGGCAGATGG + Intergenic
1175698948 20:61123569-61123591 CTCCCTGGCTCCAGGGCAGAGGG + Intergenic
1175974627 20:62704356-62704378 CCTGGTGGCTGCAGGGCAGCTGG - Intergenic
1176061327 20:63174177-63174199 CCCCGTGCCTGGTGGGGAGAGGG - Intergenic
1176239808 20:64070666-64070688 CCCGGTGTCTTCAGGGCATCTGG + Intronic
1176347639 21:5764781-5764803 CCCCATCTCTGCAGGGATGAGGG + Intergenic
1176354453 21:5885365-5885387 CCCCATCTCTGCAGGGATGAGGG + Intergenic
1176497188 21:7559674-7559696 CCCCATCTCTGCAGGGATGAGGG - Intergenic
1176541960 21:8162851-8162873 CCCCATCTCTGCAGGGATGAGGG + Intergenic
1176560911 21:8345896-8345918 CCCCATCTCTGCAGGGATGAGGG + Intergenic
1178430016 21:32510630-32510652 CCAGGTGCCTGCAGGGAAGATGG + Intronic
1179473323 21:41626747-41626769 CCCCATGTATGCAGTGCAGCAGG + Intergenic
1180460878 22:15563553-15563575 CACCGGGACTGCAGGGCAGCAGG - Intergenic
1180959492 22:19756163-19756185 CCACGTGTGTGCAGGGGAGGCGG + Intergenic
1181036780 22:20173534-20173556 CCCCGGGTCTGCGGAGCCGAGGG + Intergenic
1181869565 22:25887082-25887104 CCTGCTGTCTGCAGGTCAGATGG + Intronic
1182648462 22:31829783-31829805 CCCTGTCTCTGCTGGGCAGCAGG - Intronic
1183732582 22:39627134-39627156 CCCAGTGTCTGCAGGACATCAGG + Intronic
1183954583 22:41371811-41371833 CCCATTGGGTGCAGGGCAGATGG - Intronic
1183966750 22:41446874-41446896 CCCCGCCCCTGCAGGGCGGAGGG - Exonic
1184089584 22:42285157-42285179 CCCCGTGGCACCAGGGAAGAGGG - Intronic
1184217806 22:43079104-43079126 CCCCGTGTCTGCGGGTGTGAGGG - Intronic
1184217863 22:43079296-43079318 CCCCGTGTCTGCAGATGTGAGGG - Intronic
1184217896 22:43079423-43079445 CCCCGTGTCTGCGGGTGTGAGGG - Intronic
1184291673 22:43500749-43500771 CCCCCAGGCTGCAGGGTAGAGGG + Intronic
1185082612 22:48718239-48718261 CCCAGTGTCTGCTGTGCAGGGGG - Intronic
1185086668 22:48744536-48744558 CCCCAAGGCTGCAGGGCTGAGGG - Intronic
1203246902 22_KI270733v1_random:79270-79292 CCCCATCTCTGCAGGGATGAGGG + Intergenic
949584933 3:5428162-5428184 CTCTGTGTCTGCGGGGCAGAAGG - Intergenic
950111051 3:10418925-10418947 CGCCTTGTCTGCAGGGCCGGGGG + Intronic
950386353 3:12663689-12663711 CCCCGCGGCTGCCGGGCAGAGGG - Intronic
950483492 3:13259182-13259204 CCCAGGGCCTGCATGGCAGAGGG - Intergenic
950649046 3:14395940-14395962 CCAGGTCTCTGCAGGGGAGATGG + Intergenic
953557696 3:43959892-43959914 GAACGTGTCTACAGGGCAGAGGG - Intergenic
953855922 3:46499031-46499053 CCCAGAGTCAGCAGTGCAGAGGG - Intronic
954147470 3:48641443-48641465 CCCCAAGTCTGCAGAGCACAGGG + Exonic
954576977 3:51681727-51681749 CTGAGTGTCTGCATGGCAGAGGG - Intronic
955090320 3:55744026-55744048 CACCTTTTCTGCATGGCAGATGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957046224 3:75377250-75377272 CCAAGTGCCTGCAGGGAAGATGG - Intergenic
958587850 3:96114492-96114514 CCCAGTGTCTGCTGGGCTGCTGG + Intergenic
960574119 3:119212924-119212946 CCCCCAGTCTACAGGACAGAAGG + Intronic
961626711 3:128269227-128269249 TCCCGTGACAGCAGGGCACATGG - Intronic
961828786 3:129612679-129612701 CCCCGTGGCAGGAGGGCTGAGGG + Intergenic
961878290 3:130041533-130041555 CCAAGTGCCTGCAGGGAAGATGG - Intergenic
963479571 3:145853933-145853955 CCCGCTGTCTGCAGTGCATATGG - Intergenic
964627809 3:158776255-158776277 CACCTTTTCTACAGGGCAGATGG - Intronic
965470612 3:169085727-169085749 TCCAGTGTCTGCTGAGCAGAAGG + Intronic
967887993 3:194346223-194346245 CCCGGGCTCTGCAGGGAAGATGG + Intronic
968990510 4:3908368-3908390 CCAAGTGCCTGCAGGGAAGATGG - Intergenic
969268068 4:6078875-6078897 TCACGGATCTGCAGGGCAGATGG - Intronic
969330099 4:6469900-6469922 GCCAGTGTGTGCAGGGCATAGGG - Intronic
969570707 4:8006608-8006630 ACACGTGAGTGCAGGGCAGATGG + Intronic
969681559 4:8646024-8646046 CACCTTGTCTGCAGGGAAGGAGG + Intergenic
969824815 4:9748974-9748996 CCAAGTGCCTGCAGGGAAGATGG + Intergenic
970360982 4:15308557-15308579 TCCCGAGGCTGCAGGGAAGAGGG + Intergenic
970584020 4:17497967-17497989 CCACATGCCTGCGGGGCAGAGGG - Intronic
970600622 4:17638763-17638785 CCCCTTTTCTGCAGGGCAGTGGG - Intronic
972745677 4:41930245-41930267 CCCCTTTTCTGCGTGGCAGATGG + Intergenic
972905985 4:43747549-43747571 CCCCCAGTCTCCAGGGAAGAGGG - Intergenic
976402080 4:84618778-84618800 ACCAGTGTGTGCAGGGCAGTGGG + Intronic
985659990 5:1152229-1152251 GGCCGGGTGTGCAGGGCAGAGGG - Intergenic
986199635 5:5569510-5569532 CCCCCAGCCTGGAGGGCAGATGG + Intergenic
987989402 5:25190878-25190900 TCCGGTGTCTGCAGGGCAGAGGG + Intergenic
990716604 5:58644424-58644446 CCCCGTGCCTGCATGGTAGGTGG + Intronic
991042314 5:62188610-62188632 CCCAGTGTCTGCTCTGCAGATGG + Intergenic
992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG + Intronic
995599213 5:113777519-113777541 CCCCTTTTCTGCACTGCAGATGG - Intergenic
997428384 5:133820091-133820113 CCTCGTGTCAGCAGGCCTGAGGG + Intergenic
997962770 5:138335210-138335232 GCCAGCCTCTGCAGGGCAGAGGG + Intronic
999362624 5:150998650-150998672 CACCTTTTCTGCATGGCAGATGG - Intergenic
999398400 5:151245692-151245714 CACCTTGTCTGCACAGCAGATGG - Intronic
1000345720 5:160312142-160312164 CCCCGTGTCCGGCGAGCAGAGGG - Intronic
1001647678 5:173294497-173294519 CCTCGGGGCTGCAGGGCAGATGG + Intergenic
1002478311 5:179482654-179482676 CCCCCTGGCTGCACGGCAGAGGG - Intergenic
1002963660 6:1941465-1941487 CACCATGACTGCAGGTCAGAAGG + Intronic
1004965674 6:20848204-20848226 CATCTTTTCTGCAGGGCAGATGG - Intronic
1005512308 6:26521835-26521857 TCCGGTATCTGCAGGGCAGAGGG - Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006475192 6:34248686-34248708 CCCCGTGTCCGTAGGGCACGGGG + Intronic
1006514261 6:34537329-34537351 CCCCGTGTGTGATGGGAAGAGGG - Intergenic
1007275793 6:40672695-40672717 CCCCAAGTCTGCAGGGCTCATGG - Intergenic
1007507984 6:42351812-42351834 CCCTGTGTCTGTTTGGCAGATGG - Intronic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1009036009 6:58117800-58117822 CACCTTTTCTGCAGGGCAGATGG - Intergenic
1009211827 6:60871401-60871423 CACCTTTTCTGCAGGGCAGATGG - Intergenic
1010750256 6:79609452-79609474 TCCCCTGTCAGCAGGGGAGAGGG - Intergenic
1016010894 6:139135966-139135988 CGCCGTGTGTGCCGGGCCGAAGG + Intronic
1016317421 6:142805929-142805951 CACAATTTCTGCAGGGCAGACGG - Intronic
1016841919 6:148533509-148533531 CCCTGGTTCTGCAGGGCAGGAGG + Intronic
1018326982 6:162681503-162681525 CACCTTGTCTGCATGGTAGATGG + Intronic
1019183662 6:170208577-170208599 CCCCTTTTCAGCAGGGCTGATGG - Intergenic
1019537998 7:1538821-1538843 GCCCAGGTCTGCAGGGCAGCAGG + Intronic
1019621166 7:1992767-1992789 CCCAGTGTCTCCAGGACAGGTGG + Intronic
1019992749 7:4703420-4703442 ACCCGCGTCTGCAGGGCTGGTGG + Intronic
1020370493 7:7427035-7427057 CCATGTGTCTCCAGGGCTGAAGG + Intronic
1020660183 7:10972958-10972980 CACTTTTTCTGCAGGGCAGATGG + Intergenic
1021687971 7:23206050-23206072 CCCCGTGTCTGCAGGGCAGAGGG - Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1023368668 7:39490428-39490450 CCAGGTGGCTGCAGGCCAGAAGG + Intronic
1023480388 7:40627668-40627690 CACCTTTTCTGCAAGGCAGATGG - Intronic
1023982156 7:45076544-45076566 CCCAGGTGCTGCAGGGCAGATGG - Intergenic
1024124787 7:46282341-46282363 TCACTTGTCTGCAGTGCAGAGGG + Intergenic
1024229738 7:47354943-47354965 CCCAGTGTCTGGAGGGAAGGAGG - Intronic
1026184753 7:68074000-68074022 CACCTTTTCTGCATGGCAGATGG - Intergenic
1026353862 7:69540574-69540596 CCCCTTTTCTGCAAGGTAGATGG - Intergenic
1027263349 7:76480446-76480468 CCCCGGGACTCCAGGCCAGAGGG + Exonic
1027299893 7:76820932-76820954 CCATGTGTCTGCAGGTCAGAGGG - Intergenic
1027314727 7:76978553-76978575 CCCCGGGACTCCAGGCCAGAGGG + Intergenic
1028033648 7:85950639-85950661 CCCCATGTTTCCAGGGTAGATGG + Intergenic
1029457923 7:100680253-100680275 CCCCATGTCCCCAGGGCAGGAGG + Exonic
1029495560 7:100894227-100894249 CCTCATGGCTGCAGGGCAGGCGG + Exonic
1031317578 7:120275121-120275143 CACCATGACTGCAAGGCAGAGGG + Exonic
1032253536 7:130278569-130278591 CACAGTGTCTGCAACGCAGAAGG + Intronic
1032700999 7:134379042-134379064 CACCTTTTCTGCATGGCAGATGG - Intergenic
1032789478 7:135231962-135231984 CCCCATAGCTGCAAGGCAGAAGG - Exonic
1035029360 7:155847411-155847433 AGCCGTGACTGCAGGGCCGAGGG + Intergenic
1035211540 7:157332319-157332341 CACAGAGGCTGCAGGGCAGAGGG - Intergenic
1035459408 7:159029916-159029938 CCCCTCATCTGCAGGACAGAGGG - Exonic
1035691125 8:1560643-1560665 CTCCGTGTCTTCAGGCCAGGTGG - Intronic
1036145861 8:6254051-6254073 CCCAGTGTCTGCAGAGCACTTGG + Intergenic
1037682730 8:21110896-21110918 CACCTTTTCTGCATGGCAGATGG + Intergenic
1037771850 8:21805912-21805934 CCCAGTGGCTGCAGGGCAGAAGG + Intronic
1038336610 8:26650719-26650741 ACCCCTGTCTGCACAGCAGATGG - Intronic
1039123028 8:34170037-34170059 CCCAGTGTCTCCAAGGCAGCTGG - Intergenic
1040834677 8:51719121-51719143 CCGGGTGGCGGCAGGGCAGAGGG - Intronic
1041753609 8:61288455-61288477 CCCGAGGTCCGCAGGGCAGAGGG + Intronic
1043454846 8:80402863-80402885 ACCTGTGGCTGCAGGGCAGTAGG - Intergenic
1045065108 8:98437419-98437441 CCCAGGGACTGCTGGGCAGATGG - Intronic
1045406144 8:101868512-101868534 CCCCATTTCTGCCTGGCAGATGG + Intronic
1047390778 8:124449263-124449285 CTGCTTTTCTGCAGGGCAGAAGG - Intergenic
1048338787 8:133523140-133523162 TCCCCTCTCAGCAGGGCAGAAGG - Intronic
1048356126 8:133655219-133655241 CACAGTCTGTGCAGGGCAGAGGG + Intergenic
1048455033 8:134570009-134570031 CACAGTGGCTGCAGGGCACAGGG + Intronic
1049301552 8:141873217-141873239 GCCCCTGTGTGCAGGGGAGAGGG + Intergenic
1049594213 8:143475996-143476018 CCCTGGGGCTGCAGGGCAGAGGG + Intronic
1049780982 8:144428743-144428765 CCCCGTGGCTGCCTGGCAGGCGG - Intergenic
1053265971 9:36713914-36713936 CTGCGTGTCTGCAGGACGGATGG + Intergenic
1055397607 9:75891398-75891420 CCCAGTGGCTTCAGGGCCGAGGG - Intronic
1058348991 9:103999397-103999419 TCAGGTGTCTGCAGGACAGAGGG - Intergenic
1061252674 9:129435956-129435978 CCCCGTGTTTGCAGAGCTGGCGG + Intergenic
1061595642 9:131627467-131627489 CTCCGAGTCTGCTGGGCAGGGGG - Intronic
1061825556 9:133256349-133256371 CCACGTATCTGCAAGGCAGGCGG + Exonic
1061872470 9:133528209-133528231 CCCAGAGTCTGGAGGGCATATGG - Intronic
1203463235 Un_GL000220v1:62332-62354 CCCCATCTCTGCAGGGATGAGGG + Intergenic
1186415579 X:9380544-9380566 CCCAGTGTCTGCAGTGCCAAGGG - Intergenic
1187479350 X:19640756-19640778 CTCCTTTTCTGCGGGGCAGATGG + Intronic
1188106672 X:26155588-26155610 CCCCATGTGTGGAGGGCAGGAGG - Intergenic
1189069537 X:37848990-37849012 CACCTTTTCTGCAGGGCAGATGG - Intronic
1189268362 X:39733462-39733484 ACCCATGTCTACATGGCAGATGG - Intergenic
1189433384 X:40969514-40969536 CCACTTTTCTGCATGGCAGATGG - Intergenic
1189992321 X:46607063-46607085 CCACGAGTCTGGAGGGCAGCCGG - Exonic
1190505989 X:51126112-51126134 CCCCTTGTCTGCAGGTCTGCTGG - Intergenic
1192177200 X:68893471-68893493 CCTCAGGCCTGCAGGGCAGAAGG - Intergenic
1192188792 X:68978263-68978285 GGCAGTGTCTGCAGGGAAGAGGG - Intergenic
1192201620 X:69069919-69069941 GCCAGCCTCTGCAGGGCAGAGGG - Intergenic
1192214691 X:69150255-69150277 CTCCGGGTCTCCAGGTCAGAGGG - Intergenic
1192566586 X:72169294-72169316 CCCCTTTTCTGCGCGGCAGATGG - Intergenic
1193397655 X:81004076-81004098 TCCGGTATCTGCAGGGCAGAGGG + Intergenic
1193789541 X:85801132-85801154 CCCAGTGTCACAAGGGCAGAGGG + Intergenic
1196858098 X:120002058-120002080 CACCTTATCTGCTGGGCAGACGG - Intergenic
1199786793 X:151113041-151113063 CCCAGTATCTGCAGGTCACAGGG + Intergenic
1200049854 X:153422983-153423005 CCCTGTTTCTGCAGGGCTAAGGG - Intergenic
1201530147 Y:14982973-14982995 CCAGGTGTCTGCAGGACTGAGGG + Intergenic