ID: 1021693995

View in Genome Browser
Species Human (GRCh38)
Location 7:23258759-23258781
Sequence TAGTTCCATCAGAAGTTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021693995_1021694001 24 Left 1021693995 7:23258759-23258781 CCTTATAACTTCTGATGGAACTA 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1021694001 7:23258806-23258828 GATTCCAAACCACACATCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 146
1021693995_1021693996 -1 Left 1021693995 7:23258759-23258781 CCTTATAACTTCTGATGGAACTA 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1021693996 7:23258781-23258803 ACCCCTGCATCTCAACGTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 430
1021693995_1021694000 2 Left 1021693995 7:23258759-23258781 CCTTATAACTTCTGATGGAACTA 0: 1
1: 0
2: 1
3: 15
4: 155
Right 1021694000 7:23258784-23258806 CCTGCATCTCAACGTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021693995 Original CRISPR TAGTTCCATCAGAAGTTATA AGG (reversed) Intronic
901365715 1:8746437-8746459 TGGTTCTAGCAGAAGTTATGGGG - Intronic
903428029 1:23269219-23269241 TAGTTCAAACAAAAATTATATGG - Intergenic
906190426 1:43895514-43895536 TAGTTCCGTCAGCAGTTAAATGG + Intronic
906828254 1:49004983-49005005 TATTACCATAAGAAGTTATTTGG - Intronic
909907451 1:81215965-81215987 TAGTTCCTTCCAAAGTTAAAAGG - Intergenic
910367100 1:86477502-86477524 TAGTGCAAACAGAAGTGATAGGG + Intronic
910528801 1:88211897-88211919 TACTTCCATGAGAAGTTCTCTGG - Intergenic
910766402 1:90786941-90786963 TAGTTCCATCAAAAGGGAGATGG - Intergenic
910784264 1:90977673-90977695 TTATTACATCAGAAGTTAAAGGG + Intronic
912260501 1:108107534-108107556 GTGTTCCATCAGAATATATAAGG + Intergenic
913067162 1:115266709-115266731 TTTTTCCCTCAGATGTTATAAGG + Intergenic
913613040 1:120527216-120527238 TAGGTCCATCAGTAGATAAAAGG + Intergenic
914578146 1:148995033-148995055 TAGGTCCATCAGTAGATAAATGG - Intronic
916064976 1:161128987-161129009 TAGTTCAATCTGGAGTTCTATGG + Intronic
916282165 1:163063713-163063735 TAGTTCTACCAGATGTTAAATGG - Intergenic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918929173 1:190832011-190832033 TAGTTCCATCTGAAATGATTTGG - Intergenic
1068821721 10:61384650-61384672 TAGTTCCATCAAAATTAAGAAGG - Intergenic
1069875675 10:71561625-71561647 CAGGTCCATCAGAAGTGATATGG + Intronic
1071365351 10:84893796-84893818 TAGTTGCAGCAGAGATTATATGG - Intergenic
1071842795 10:89490435-89490457 CTGGTCCATCAGAAGTTAGAAGG - Intronic
1071922311 10:90364636-90364658 TAGTTGCAACAGAGATTATATGG - Intergenic
1076171728 10:128325562-128325584 TAGTTCCATGATAAGTAACATGG - Intergenic
1080333628 11:31171276-31171298 TAGTTGCAACAGAAATTGTATGG - Intronic
1082142084 11:48620672-48620694 AAGTTCCTTTAGAAGTTAGAAGG - Intergenic
1082246121 11:49924916-49924938 TGGTTCCTACAGAAGATATAAGG + Intergenic
1086344492 11:85882366-85882388 TACTTCCATCAGACATTATGAGG - Intronic
1086763828 11:90669449-90669471 TTGTTCCTTCAGAAAGTATAAGG + Intergenic
1089814083 11:121156989-121157011 TACTTCCATCAGAAGTAAATTGG + Intronic
1089895353 11:121925223-121925245 TAGTTTCATAAGGAGTTTTAAGG - Intergenic
1093104560 12:15070394-15070416 TTGTTCCCTCAGTATTTATAAGG - Intergenic
1094420570 12:30266525-30266547 TATTTACATCAGAATATATAAGG + Intergenic
1099752178 12:86789943-86789965 GGGTTCCATCAGAAATTATCTGG + Intronic
1101328578 12:103738775-103738797 TAGTTCCATTTTAAGTTAAATGG - Intronic
1106972533 13:35159801-35159823 TCATTCCATCTGAAGTTGTATGG - Exonic
1107074104 13:36302393-36302415 TAGTTGCATCAGAGAGTATATGG - Exonic
1107567659 13:41622527-41622549 GGGTTGCATCAAAAGTTATAAGG - Intronic
1107985384 13:45771464-45771486 TAGTTCAATCAGAAAATATTCGG - Intergenic
1110369625 13:74725419-74725441 TAGTTCCATCTACAGTAATAGGG + Intergenic
1111855379 13:93631018-93631040 TAGTCCCATGTGAAGTTACACGG + Intronic
1112902881 13:104380235-104380257 TAATTCCAGCAGAAGGCATAAGG - Intergenic
1113363131 13:109650004-109650026 TAGTTGCAACAGAGATTATATGG + Intergenic
1113541699 13:111114818-111114840 TGGTTCCATCTGAAGCCATATGG - Intronic
1116310491 14:43319394-43319416 TAGTTTCATCTGAAGGTATGGGG - Intergenic
1116779622 14:49222239-49222261 TATTTCCATCTGGAGTAATATGG - Intergenic
1118260222 14:64239341-64239363 TAGTTCCCTCTGAGTTTATAGGG - Intronic
1118703368 14:68457395-68457417 TAGTTAAAGCAGTAGTTATAGGG + Intronic
1126713744 15:51490614-51490636 TAGTTCCATCATATGTAAAATGG + Intronic
1127951924 15:63816132-63816154 TAGTTCCTCAAGATGTTATAAGG + Intronic
1130041215 15:80406247-80406269 CAGTTCCATCAGCAGAAATAGGG + Intronic
1131778664 15:95830038-95830060 TAGTTCCATCAGAATGTTTCAGG + Intergenic
1131972878 15:97909754-97909776 TTTTTCCATCAAAAATTATAAGG + Intergenic
1133888787 16:9858132-9858154 TAGTTCCATCAAAAGTCCCAGGG - Intronic
1137838557 16:51618710-51618732 TATTTCTATCAGAAGTGATTAGG - Intergenic
1139533974 16:67560434-67560456 GAAATCCATCAGAAGATATAAGG - Intergenic
1140853960 16:78961191-78961213 TGGTGACATCAGAAGTTAAAAGG + Intronic
1141305881 16:82863665-82863687 TAGTAACAGCAGAAATTATAAGG - Intronic
1143866898 17:9930451-9930473 GCGTTCCATCAGAAGATTTAGGG - Intronic
1144271531 17:13621941-13621963 GAGTTCCAGCAGAAGTTTTAGGG - Intergenic
1146831086 17:36070126-36070148 GAGTTCCATCTGAATTCATAAGG - Intronic
1148234293 17:45957489-45957511 TGGTTCCATCAGAGGTTTTCAGG - Intronic
1148518842 17:48249220-48249242 TAGTCCCATTAGAATTTAAAAGG + Intronic
1149485576 17:57040206-57040228 TAGGGCCATCAAAAGCTATAAGG + Intergenic
1153829815 18:8912347-8912369 TAGGTCCTTCAGAAGTTGTTAGG - Intergenic
1156505964 18:37593159-37593181 TAACTCCATCACAAGTTGTAAGG - Intergenic
1159766064 18:72489834-72489856 TAGTTCCCCTAGAAGTTATGAGG - Intergenic
1160851002 19:1192562-1192584 TAGCTCCACAAGAAGTTAAACGG + Intronic
1160899034 19:1417720-1417742 TATTTCCATCCCAAGTTACAGGG + Intronic
928861578 2:35863644-35863666 CAGTTCCGACAGAAGTTCTATGG - Intergenic
935895496 2:107733357-107733379 TAGGTCCAGAAGAGGTTATAAGG + Intergenic
936816594 2:116468456-116468478 TAATTTCATCAGAAATTATTTGG + Intergenic
937745727 2:125411519-125411541 TACTTCCACCAGAAGTTCTTGGG - Intergenic
939429029 2:142078984-142079006 TAGATCAATCAGTAGCTATAAGG - Intronic
940656277 2:156491301-156491323 TAGTTGCATCAGAGACTATATGG - Intronic
941646269 2:168045011-168045033 TACTTTCAACAGAAGTTACAAGG - Intronic
941673198 2:168317104-168317126 TAATAGCATCAGAAGTTAGAAGG - Intergenic
941882377 2:170494423-170494445 GAGGGCCATCAGAAGTTATGTGG + Intronic
942649553 2:178152270-178152292 TAGTTGCAACAGAAGTTGTACGG + Intergenic
942710751 2:178832551-178832573 TAGTTCTATCAAAATTTAGAAGG + Exonic
947129840 2:226909964-226909986 TAGTTCCAGCAGAGATTATATGG - Intronic
947181451 2:227415034-227415056 TAGTTACAACAGAAGCTGTATGG + Intergenic
1171363956 20:24611081-24611103 TAGTTCCAGCAGCAGAAATAAGG - Intronic
1172710537 20:36919465-36919487 TAATTCCATTAGAATTAATAAGG + Exonic
1173082642 20:39883938-39883960 TAATTCCATCAGAAGTTATCGGG - Intergenic
1174310957 20:49653991-49654013 CAGTTCTCTCAGAAGTTAGAGGG - Intronic
1177339072 21:19775483-19775505 GAGTTCCATCAGTAGGTATATGG - Intergenic
1178488259 21:33032322-33032344 TAGTACCAGCAGGGGTTATAGGG + Intergenic
949398183 3:3637368-3637390 CAATTCCATCTGAATTTATATGG + Intergenic
951811197 3:26701864-26701886 TAATTCCAAAAAAAGTTATATGG + Intronic
952272042 3:31842799-31842821 TAATTCCATCAAAACTGATACGG + Intronic
953443856 3:42945347-42945369 TACTTGCAACAGAAATTATATGG + Intronic
953558977 3:43970225-43970247 TAGTTGCAACAGAAGCGATATGG + Intergenic
954963979 3:54594225-54594247 TAGTTACAGCAGAAATTGTATGG - Intronic
955863326 3:63355613-63355635 CCGGTGCATCAGAAGTTATAGGG - Intronic
958265330 3:91431467-91431489 TAGTTACATAAGAATTTAAAAGG - Intergenic
961034633 3:123634045-123634067 TAGTTCCATCAGCAGATGTGTGG - Intronic
961414500 3:126747596-126747618 AAGTGCCATCAGAAGTAAAATGG - Intronic
962415570 3:135178590-135178612 TAGAGCCATCAGAAGTTTTTTGG + Intronic
965052825 3:163671980-163672002 TACTTCCTTCAGAAGTTCTATGG + Intergenic
967082031 3:186058628-186058650 TAATTCCATGAGCAATTATAAGG + Intronic
970025640 4:11621446-11621468 TCCTTCCATCTGAAATTATATGG + Intergenic
972204543 4:36756328-36756350 TAGTTTTATCTGAAGTTGTATGG - Intergenic
975345139 4:73284596-73284618 TACTTCCAGCAGTAGTTATAGGG + Intergenic
976603777 4:86963625-86963647 TAGTTCCATTTGAAGTTTAAAGG + Intronic
979799232 4:124887191-124887213 TAGTTCCAGCCCAAGTTCTAAGG + Intergenic
980778969 4:137472144-137472166 TAGTTCCAACAGAGATTATATGG + Intergenic
980965911 4:139521043-139521065 TAGTTGCAACAGATATTATATGG + Intronic
982100579 4:151963637-151963659 TAGTTCTACCAGAGGTTTTAGGG + Intergenic
983198290 4:164832668-164832690 TAGTTGCAACAGAAACTATATGG - Intergenic
984187338 4:176562048-176562070 TAGATGCATCAGAAACTATAAGG + Intergenic
985219546 4:187689463-187689485 GAGTTCCATCAGCTGTTAAATGG + Intergenic
985374294 4:189317383-189317405 TAACTCCATCATAAGTCATAAGG + Intergenic
987522640 5:19006561-19006583 TGGTTCTATCAAAAGTTAAAAGG + Intergenic
987672248 5:21025036-21025058 TAGTCCAATTGGAAGTTATAAGG - Intergenic
988835833 5:35031514-35031536 TATTTCCTTCAGAAGTACTAAGG + Intronic
988839496 5:35069787-35069809 TAGTTCTTCCAGAATTTATAAGG - Intronic
989561111 5:42852423-42852445 TATTTGCAACAGAAATTATATGG - Intronic
994057399 5:95433708-95433730 AAGTTCAATCAGTACTTATAGGG + Intronic
994331982 5:98517129-98517151 TAATTCCTTCAGGAGTTTTAAGG + Intergenic
994888210 5:105594171-105594193 TAGTTATATAAGAAGTTACAAGG - Intergenic
995894454 5:116996157-116996179 CAGTTGCATCAGAAATTCTATGG + Intergenic
1002318773 5:178362666-178362688 TAGTTCCAACAGAAGTCCCATGG - Intronic
1002668741 5:180847463-180847485 TGGTTTCACCAGAAGTTAGAAGG - Intergenic
1003532788 6:6952015-6952037 GATTTCCATCAGAGGTTAAATGG - Intergenic
1006275597 6:33002863-33002885 CATTTCCATCAGAATTTTTAAGG - Intergenic
1007998526 6:46334577-46334599 GAGGTCCATGAGAAGTCATAGGG + Intronic
1008990043 6:57591190-57591212 TAGTTACATAAGAATTTAAAAGG + Intronic
1009178623 6:60489730-60489752 TAGTTACATAAGAATTTAAAAGG + Intergenic
1009863064 6:69360555-69360577 TATTTCCCTGAAAAGTTATATGG + Intronic
1010843439 6:80676270-80676292 TAGTTCCAACAGAAACCATATGG - Intergenic
1012705849 6:102528940-102528962 TATTTCCAGCAGAATTCATAAGG - Intergenic
1012812716 6:103981404-103981426 TATTTTCAACAGAAGCTATATGG + Intergenic
1015310159 6:131757959-131757981 TAGTGTCATCAGAAGTTCTGAGG - Intergenic
1015782910 6:136889543-136889565 TAGTTCCAACAGAACATTTATGG + Intronic
1020466631 7:8487196-8487218 TAGATCCATCATTAGTGATATGG + Intronic
1020550392 7:9596744-9596766 TAGTTCCAGCAGTGGTTAGAAGG + Intergenic
1021693995 7:23258759-23258781 TAGTTCCATCAGAAGTTATAAGG - Intronic
1022235195 7:28454278-28454300 GACTTCCAACAGAAGTTATGAGG - Intronic
1023683719 7:42714548-42714570 TATTGCCATCAGCTGTTATACGG + Intergenic
1024394119 7:48846715-48846737 TATTTTCGTCAGAAGTTAAAGGG - Intergenic
1026022449 7:66719839-66719861 TAGTTATAGCAGAAGTTATATGG + Intronic
1027882618 7:83860707-83860729 TAGTTCAATCAGAAATTTAATGG - Intergenic
1028818313 7:95175815-95175837 TATGACCATCAGAAGTTATATGG - Intronic
1029245614 7:99198346-99198368 TTTTTGCATCAGTAGTTATAAGG - Intronic
1030326327 7:108222561-108222583 TAATTCTAGCAGAAGATATAGGG + Intronic
1032951589 7:136920938-136920960 AAGTAACATCAGAAGTTAGAAGG - Intronic
1033634279 7:143195099-143195121 TATTGCTTTCAGAAGTTATAAGG - Intergenic
1036174204 8:6520917-6520939 TAGTTCCATCATTAATTAGAAGG - Intronic
1039859348 8:41443538-41443560 TAGTTCCAACAAAAGTTTTCTGG + Intergenic
1041164821 8:55080839-55080861 CAGGTCCTTCAGAAGTCATATGG - Intergenic
1041585331 8:59510774-59510796 AAGTTCCAGCAGAGGTTACATGG - Intergenic
1041983396 8:63890613-63890635 TTGTTCCTTCAGAAGTTCTCTGG - Intergenic
1042331929 8:67589559-67589581 GAGCTCCTTCAGAAGTTATAGGG + Intronic
1045787872 8:105944154-105944176 TAGTTCCTTTAGAATTGATAAGG - Intergenic
1047243439 8:123116270-123116292 TAGTTCAAGCAGAATTTATATGG - Intronic
1047860755 8:128964192-128964214 TAATTCATCCAGAAGTTATAGGG + Intergenic
1051797262 9:20886543-20886565 CAGTGGCATCAGAAGTTATGAGG + Intronic
1052433319 9:28394636-28394658 TAAATCCATCAGAAGATGTATGG + Intronic
1053362327 9:37497625-37497647 TAGTTGCAACAGAGGTTGTATGG + Intronic
1055201560 9:73668811-73668833 TAGTTCCAGAAGAAATTCTAGGG + Intergenic
1055914158 9:81383054-81383076 TAGTTCCAACCCAAGTGATATGG - Intergenic
1057608921 9:96523367-96523389 TATTTTCGTCAGAAGTTAAAGGG - Exonic
1060687972 9:125629536-125629558 TAGATCCCTCATAAGATATATGG - Intronic
1186253091 X:7690296-7690318 TAGTTGCTGCAGAAGTCATATGG + Intergenic
1188349451 X:29109936-29109958 TAGTTCCATGAAACGTTAAAAGG - Intronic
1188796515 X:34472957-34472979 TGGTTCCATCATAATTTATGGGG + Intergenic
1189046364 X:37596105-37596127 TAATTACATCAGAAGTTGGAAGG + Intronic
1193805891 X:85993815-85993837 TAGTTCCATCATTAGTTTTATGG - Intronic
1196159773 X:112470106-112470128 TATTTCCATCATATGTTATATGG - Intergenic
1199191617 X:144978215-144978237 TAGTACCTTCAGTCGTTATAAGG + Intergenic
1201508474 Y:14731341-14731363 TAGTTCTATCTTAAGTTATTTGG + Intronic
1201699201 Y:16861323-16861345 TACTTCCATCAAAAGTAAAAAGG + Intergenic