ID: 1021694033

View in Genome Browser
Species Human (GRCh38)
Location 7:23259034-23259056
Sequence GGAAGTAATTCCTCTCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 176}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021694033_1021694038 1 Left 1021694033 7:23259034-23259056 CCTGAAGGAGAGGAATTACTTCC 0: 1
1: 0
2: 2
3: 14
4: 176
Right 1021694038 7:23259058-23259080 CCTGTTAGCTAGCAGCAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 134
1021694033_1021694036 -2 Left 1021694033 7:23259034-23259056 CCTGAAGGAGAGGAATTACTTCC 0: 1
1: 0
2: 2
3: 14
4: 176
Right 1021694036 7:23259055-23259077 CCACCTGTTAGCTAGCAGCAGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1021694033_1021694040 6 Left 1021694033 7:23259034-23259056 CCTGAAGGAGAGGAATTACTTCC 0: 1
1: 0
2: 2
3: 14
4: 176
Right 1021694040 7:23259063-23259085 TAGCTAGCAGCAGGGAGGGTTGG No data
1021694033_1021694034 -3 Left 1021694033 7:23259034-23259056 CCTGAAGGAGAGGAATTACTTCC 0: 1
1: 0
2: 2
3: 14
4: 176
Right 1021694034 7:23259054-23259076 TCCACCTGTTAGCTAGCAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 76
1021694033_1021694039 2 Left 1021694033 7:23259034-23259056 CCTGAAGGAGAGGAATTACTTCC 0: 1
1: 0
2: 2
3: 14
4: 176
Right 1021694039 7:23259059-23259081 CTGTTAGCTAGCAGCAGGGAGGG 0: 1
1: 0
2: 2
3: 19
4: 182
1021694033_1021694041 18 Left 1021694033 7:23259034-23259056 CCTGAAGGAGAGGAATTACTTCC 0: 1
1: 0
2: 2
3: 14
4: 176
Right 1021694041 7:23259075-23259097 GGGAGGGTTGGACAAAGAAAAGG 0: 1
1: 0
2: 5
3: 60
4: 596
1021694033_1021694042 29 Left 1021694033 7:23259034-23259056 CCTGAAGGAGAGGAATTACTTCC 0: 1
1: 0
2: 2
3: 14
4: 176
Right 1021694042 7:23259086-23259108 ACAAAGAAAAGGAATGACTCAGG No data
1021694033_1021694043 30 Left 1021694033 7:23259034-23259056 CCTGAAGGAGAGGAATTACTTCC 0: 1
1: 0
2: 2
3: 14
4: 176
Right 1021694043 7:23259087-23259109 CAAAGAAAAGGAATGACTCAGGG 0: 1
1: 0
2: 2
3: 67
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021694033 Original CRISPR GGAAGTAATTCCTCTCCTTC AGG (reversed) Intronic
902967290 1:20015529-20015551 GGAAGTGTTTCCTCTTCTTCAGG + Intergenic
903099874 1:21019957-21019979 GAAAATAATTCCTCTACTACAGG + Intronic
903229080 1:21911139-21911161 GGCATGAATTCCTCTTCTTCAGG + Intronic
903464881 1:23545185-23545207 ATCAGTAATTCCTCTCCTGCTGG + Intergenic
904309666 1:29620693-29620715 AGAAGTAATTACCCTACTTCTGG - Intergenic
905423886 1:37867889-37867911 GGATGTCATCGCTCTCCTTCAGG - Intronic
907732990 1:57085962-57085984 GCAAGTCATTGCTATCCTTCTGG - Intronic
908867300 1:68563534-68563556 GGAAGTTATCCATTTCCTTCAGG + Intergenic
911177966 1:94836085-94836107 GGAAGTCATTTCTTTTCTTCAGG + Intronic
911318416 1:96382433-96382455 GGAATTTATTCATCTCCTCCAGG - Intergenic
912572257 1:110633288-110633310 GGCAGTACTTCCTCTCCTTGTGG + Intergenic
913034126 1:114945222-114945244 GGAAGTAATCACTCTTTTTCTGG + Intronic
914178596 1:145301192-145301214 AGAAGTTATTCAACTCCTTCAGG - Exonic
914181525 1:145326582-145326604 AGAAGTTATTCAACTCCTTCAGG - Exonic
914182070 1:145331349-145331371 AGAAGTTATTCAACTCCTTCAGG - Exonic
914182615 1:145336105-145336127 AGAAGTTATTCAACTCCTTCAGG - Exonic
914183160 1:145340859-145340881 AGAAGTTATTCAACTCCTTCAGG - Exonic
914185337 1:145359894-145359916 AGAAGTTATTCAACTCCTTCAGG - Exonic
914185882 1:145364648-145364670 AGAAGTTATTCAACTCCTTCAGG - Exonic
914186429 1:145369408-145369430 AGAAGTTATTCAACTCCTTCAGG - Exonic
914186973 1:145374156-145374178 AGAAGTTATTCAACTCCTTCAGG - Exonic
914188061 1:145383662-145383684 AGAAGTTATTCAACTCCTTCAGG - Exonic
917982086 1:180276063-180276085 GGAATTTATTCCTGTCCCTCTGG + Exonic
923617325 1:235548628-235548650 GGAAGTATTTCCTGTCTCTCAGG - Exonic
1064398451 10:15000636-15000658 GGAAGCAATTCCTCTCTTGAAGG - Intergenic
1066198581 10:33125295-33125317 GCAAGTACTTCCTATCCATCAGG - Intergenic
1066573821 10:36803098-36803120 GGAAGTCATTCCTCAGCTGCGGG - Intergenic
1066655903 10:37699845-37699867 GCAGGGAATTCCTCTCCTTGAGG + Intergenic
1067040350 10:42949766-42949788 GCAGGGAATTCCTCTCCTTGAGG + Intergenic
1068270649 10:54718540-54718562 GGATGGAATTTTTCTCCTTCAGG - Intronic
1070154980 10:73827750-73827772 GGAAGCAGGGCCTCTCCTTCTGG + Intronic
1071994082 10:91129894-91129916 GGGAAAAATTCCTCTCCATCAGG + Intergenic
1077227697 11:1445577-1445599 GGAAGTAAATCATCTTCTCCTGG - Exonic
1078668506 11:13345194-13345216 GGAAGGCCTGCCTCTCCTTCTGG - Intronic
1078728188 11:13951362-13951384 GTAAGTAATTCCTATATTTCAGG + Intergenic
1083420629 11:62550913-62550935 GGGAGCAATTCCTCTACTTGTGG + Intronic
1089809456 11:121119765-121119787 GGAACTAATTCCACTCTTTCTGG + Intronic
1091598521 12:1899742-1899764 GGAAGTAGTCCCTCTTTTTCTGG - Intronic
1096252850 12:50044500-50044522 GGAGGTAATTGCTCTCCATTTGG - Intergenic
1096765411 12:53884471-53884493 GAAAGTCATTCCTTGCCTTCTGG + Intergenic
1099224386 12:79951926-79951948 GGAAGGAAATCCTCTCATTTGGG - Intergenic
1099411302 12:82331619-82331641 GTAAGTAATTTCTGTTCTTCTGG - Intronic
1104057085 12:125238858-125238880 GGAATGAATGCATCTCCTTCAGG - Intronic
1109411365 13:61973462-61973484 TGAATAAATTCCACTCCTTCTGG + Intergenic
1111890384 13:94074459-94074481 CTAAGAAATTCCTCCCCTTCAGG + Intronic
1113550423 13:111188852-111188874 GGATGCATTTCCTCTCCTTCAGG + Intronic
1114263376 14:21055824-21055846 GGAAGTCATTTCTCTCTTGCAGG - Intronic
1116423157 14:44757183-44757205 GGAAATAGTCCCTGTCCTTCAGG + Intergenic
1118795185 14:69137015-69137037 AGAAGTAATTCCACTTATTCAGG - Intronic
1118910700 14:70059906-70059928 GGAACTATTTCCTTCCCTTCAGG + Intronic
1119322836 14:73741761-73741783 GGAGGAAATTACTCCCCTTCTGG - Intronic
1119803434 14:77465668-77465690 GTAAGTAAGTCTTGTCCTTCAGG + Intronic
1120829099 14:88982394-88982416 AGAATAAATTCCTCTTCTTCTGG - Intergenic
1121627425 14:95396420-95396442 GGAAGGAATTGCTCTCAATCTGG - Intergenic
1126337267 15:47599939-47599961 GGAAGCTTTTCCTCTCCTTAAGG - Intronic
1126566195 15:50102489-50102511 GGAATTTATTCATCTCCTTTAGG - Intronic
1126708022 15:51424990-51425012 GCAATTAAATCCTCACCTTCAGG - Intergenic
1126941852 15:53776151-53776173 GGAAGAAATTCCTTTCCTCTGGG + Intergenic
1127979180 15:64021764-64021786 GAAAATACTTCCTCTCCCTCTGG - Intronic
1130854625 15:87830437-87830459 GGAAGTAATACAACTCCTTGTGG + Intergenic
1130896119 15:88171649-88171671 GGAAATAATTCCTACCCTGCAGG - Intronic
1131111988 15:89770219-89770241 GGAAGTGATTCCTTGCTTTCTGG - Intronic
1133628082 16:7590962-7590984 AGAAGTACTTCCTGTCCTCCTGG + Intronic
1138345196 16:56316296-56316318 GGAAGCATTTTCTCTCCATCAGG + Intronic
1143920517 17:10327883-10327905 GGAGGTCATTCTTCTCCTGCAGG + Exonic
1145049919 17:19651570-19651592 GGAAGTCATTACTGTCCTTGGGG + Exonic
1153206388 18:2707591-2707613 GGCAATAATTCATCTCCTTCAGG - Exonic
1155186829 18:23394479-23394501 GGAAATATTTCCTCCCTTTCTGG + Intronic
1155707369 18:28833028-28833050 AGAAGTAATCCCTATCCTTATGG - Intergenic
1155902104 18:31404554-31404576 GGAAGTATTTCCTCTCACCCTGG - Intronic
1156621619 18:38858064-38858086 GGAAGTCCTTCCTCTCCACCAGG - Intergenic
1156841320 18:41613455-41613477 GGAAGGAATCACTCTCCTCCTGG - Intergenic
1157225864 18:45864010-45864032 TTAAGTATCTCCTCTCCTTCTGG + Intronic
1159406748 18:68012703-68012725 TCAAGTAATTCATCTGCTTCAGG + Intergenic
1161877957 19:6926467-6926489 TGAAGTAATTCACCACCTTCAGG - Exonic
1163949847 19:20573185-20573207 GGAATTTATTCATCTCCTTTAGG + Intronic
1167234831 19:48307965-48307987 GGGAGTACTTCCTCACTTTCTGG - Intronic
925125879 2:1455486-1455508 GGACAAAATTCCTCTCCATCTGG + Intronic
925728405 2:6897169-6897191 GGAACAAAATCCTCTCCTTGTGG + Exonic
927193729 2:20533955-20533977 GGAAGCCATTACTCACCTTCAGG + Intergenic
931428285 2:62190569-62190591 TGACCCAATTCCTCTCCTTCTGG + Intergenic
931624937 2:64248885-64248907 GGAGGTAATTCCTCCCATCCAGG + Intergenic
932619641 2:73258098-73258120 AGAAGTAGTTCCTGTCCTTAAGG - Exonic
932868813 2:75375537-75375559 GGATGTAATTCATCTGCTTATGG - Intergenic
934014212 2:87861513-87861535 GGAATTAATTCTTCTCCATTTGG + Intergenic
935503076 2:103866019-103866041 GCAAGTAGTTCCTCTCATCCAGG + Intergenic
935713276 2:105917846-105917868 GGAAGTACTTCCTCTCTGTGGGG + Intergenic
935938386 2:108211902-108211924 GGAAGTGCTTCCTCCACTTCAGG + Intergenic
937397520 2:121550636-121550658 GGAATTAATTCATCTCTTCCAGG - Intronic
937915405 2:127096521-127096543 GGAAGGAATTCATCCCCTTGGGG - Intronic
940620130 2:156102007-156102029 GGAAGTATTGCCTCTTCTTCTGG - Intergenic
941907405 2:170730246-170730268 GGAAGTAATGCGTCTCCTTCAGG - Intergenic
942698660 2:178677755-178677777 GGTAGAACTTCCTCTTCTTCAGG + Exonic
942844690 2:180409078-180409100 GGAAATAATTTCTCTCATTTCGG - Intergenic
943888377 2:193252638-193252660 GGAAGCAATTCTTCTGCCTCAGG - Intergenic
946005038 2:216517642-216517664 GAAAGGAATGCCTCTCCTCCTGG - Intronic
1171335428 20:24381216-24381238 TGCATTAATTCCTCTCCATCTGG + Intergenic
1171936961 20:31284086-31284108 GGAAGCACTTCCTCCTCTTCAGG - Intergenic
1173336927 20:42119781-42119803 GAAACTCATTCCTCTCCTCCAGG + Intronic
1173591014 20:44224918-44224940 TGAAGTAATTTCCATCCTTCTGG - Intergenic
1174090580 20:48043989-48044011 GGATGTAATTCCTGCCCTTGAGG - Intergenic
1178544835 21:33484318-33484340 AGAAGTATTTCCTCTTCTGCTGG - Intergenic
1178927036 21:36784979-36785001 GGAAGGAATTCGTTACCTTCAGG - Intronic
1182796386 22:32994343-32994365 GGACTTCATTCCTCTCCCTCTGG - Intronic
1183371374 22:37434360-37434382 GGAGGTGTTTACTCTCCTTCAGG + Intergenic
1185146766 22:49141413-49141435 GGCACTAATTTCTCTCCATCTGG + Intergenic
951153471 3:19320927-19320949 GGAATTTATTCATCTCCTCCAGG + Intronic
954587190 3:51746156-51746178 GGGAGTAATTCCTCTATATCCGG + Intergenic
954768454 3:52943337-52943359 GGAAGTATTTCATTACCTTCTGG + Exonic
960812687 3:121640297-121640319 GGAAATATTGCCTCTACTTCTGG - Intronic
961599057 3:128044917-128044939 GGAAGAATTTCTTCTCCTTCAGG - Intergenic
961618436 3:128203570-128203592 GGAAGTAAATCATCTGCTGCAGG + Intronic
962140721 3:132787887-132787909 GGAACTAATTCCACTCCTCAGGG - Intergenic
962983747 3:140515120-140515142 GGAATTTATTCCTCTCCTCTAGG + Intronic
965763506 3:172106415-172106437 GGAATCAATTCCTCTCATCCAGG + Intronic
966534849 3:181020251-181020273 GGAAGGAGTTCTTCTCTTTCTGG - Intergenic
967765319 3:193272583-193272605 TGTAGTAATTCCCCTGCTTCGGG - Intronic
969323995 4:6430426-6430448 GGAAGTCATTTCTCTCCTCTTGG - Intronic
969452163 4:7280533-7280555 GGAAGTACTGCCTGTCATTCTGG + Intronic
970432552 4:16001996-16002018 GGCAGGAATCCCTCTGCTTCTGG + Intronic
971355845 4:25894620-25894642 GGCAGAATTTCCTGTCCTTCTGG + Intronic
971463517 4:26928154-26928176 GGCATTAATTCCTCTCCTGAGGG + Intronic
975728903 4:77319011-77319033 AGAAGTAATTCCTCTCCTACTGG + Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
976780999 4:88758960-88758982 TGCAGCAATTCCACTCCTTCAGG + Intronic
978855417 4:113388684-113388706 GGAAAAAATTCTTCTTCTTCTGG + Intergenic
979339043 4:119498779-119498801 GGAAATAAGTCCTCTCCCACAGG + Intronic
979744886 4:124199987-124200009 AGAAGTACTTCCTTTCCTCCTGG - Intergenic
979783431 4:124684959-124684981 GGCAGTACTTCTTATCCTTCAGG + Intronic
980885804 4:138761119-138761141 TGAAGTGATATCTCTCCTTCTGG + Intergenic
982117982 4:152113599-152113621 GATACTATTTCCTCTCCTTCAGG + Intergenic
983253677 4:165375069-165375091 AGAACTAAGGCCTCTCCTTCAGG - Intronic
983885868 4:172979896-172979918 TGAAGTAATCCCTGTCCTTTTGG + Intronic
984998339 4:185459609-185459631 TGAAGAAATTACTCCCCTTCAGG - Exonic
986610544 5:9562508-9562530 GGAAGTAAATCCCCTTATTCTGG + Intergenic
986620012 5:9662452-9662474 GGAAGTATTTCATTTCCTGCAGG - Intronic
988867947 5:35355812-35355834 GGTAGTAATTCCTATTCTTTTGG - Intergenic
989534099 5:42543801-42543823 TGAATTAAATCCTCTCTTTCTGG + Intronic
991765599 5:69974633-69974655 GGAAGTCTTTCTTCTCCTGCTGG + Intergenic
991781723 5:70143528-70143550 GGAAGTCTTTCTTCTCCTGCTGG - Intergenic
992544628 5:77800111-77800133 GAAAGTAGTTCCTCACCTTCTGG - Intronic
993070666 5:83159263-83159285 GGCAGTAATTCCTTTCTTTAGGG + Intronic
994611692 5:102049042-102049064 AGAAGTAATTTCTGTCCCTCTGG - Intergenic
995609694 5:113896337-113896359 AGAACTAATTTCTCTCCTCCCGG - Intergenic
999085387 5:148883920-148883942 GCAAATAATTACTCTTCTTCAGG - Intergenic
999606358 5:153321110-153321132 AGAAGTGATTCCTCTCCCTATGG - Intergenic
1003171119 6:3722909-3722931 GGAAGAAATTCCTTTCCTTTGGG + Exonic
1004531560 6:16459517-16459539 GGAAGTAATTCCTCTATATCCGG + Intronic
1005563613 6:27066819-27066841 GCAAGCAATGCCTCTCCTTCAGG - Intergenic
1008556960 6:52681752-52681774 GGAATGAATTCCTTTCCTTTTGG + Intronic
1013368598 6:109452495-109452517 GGAAGTGATCACTCACCTTCAGG + Exonic
1016913713 6:149224960-149224982 GGAATTAATTGGTCTCTTTCTGG + Intronic
1017576668 6:155812998-155813020 AGGAGTAATTCACCTCCTTCAGG - Intergenic
1018167723 6:161115210-161115232 GAAAGGAAGTCCTTTCCTTCAGG - Exonic
1019158521 6:170054412-170054434 GAAAGTTGTTCCTGTCCTTCTGG - Intergenic
1019972671 7:4554085-4554107 GGAAGAAATTCCTCTTACTCAGG + Intergenic
1021694033 7:23259034-23259056 GGAAGTAATTCCTCTCCTTCAGG - Intronic
1024082858 7:45869641-45869663 TGGAGTAAATCCTATCCTTCAGG - Intergenic
1024367051 7:48532749-48532771 GGAATTTATTCATCTCCTTCAGG + Intronic
1027438553 7:78193701-78193723 GTATTTCATTCCTCTCCTTCTGG - Intronic
1028556195 7:92127863-92127885 GGAATGAATGCCTCTCCTTAAGG - Intronic
1028881834 7:95888782-95888804 CGAAGTAATTTTTCTACTTCTGG + Intronic
1036040218 8:5070361-5070383 GGAAGAAATACAACTCCTTCTGG + Intergenic
1038081891 8:24147104-24147126 GGAAGTGTTTTCTCTTCTTCAGG + Intergenic
1039420478 8:37433981-37434003 GGAACAAATTCATCTCCTACAGG - Intergenic
1039483164 8:37890548-37890570 GACAGAAATTCCTCTCCTGCAGG - Intronic
1042400506 8:68340762-68340784 GGAAGTATTTCCTCCTCTTCTGG - Intronic
1043281340 8:78470734-78470756 GGAAGGAATTCCACTCCTGAGGG + Intergenic
1046280597 8:112024486-112024508 TGAAGTATCTTCTCTCCTTCGGG - Intergenic
1047749700 8:127871025-127871047 TGAATTAATTCCTGTCCTCCTGG + Intergenic
1047781495 8:128115263-128115285 TGAAGTATTTCCCCTCCTCCTGG - Intergenic
1048780280 8:137991864-137991886 GGAAGTTTTCCCTCTCCTCCAGG - Intergenic
1052261674 9:26523770-26523792 GAAAGTCGTGCCTCTCCTTCGGG + Intergenic
1052996275 9:34553067-34553089 AGATGTCATTACTCTCCTTCAGG - Intronic
1055028478 9:71747615-71747637 GGAAGAAATTCCTTTCATTAAGG + Intronic
1055730964 9:79278996-79279018 GGCAGGAATTCCTCTTGTTCTGG - Intergenic
1056401426 9:86231184-86231206 GGAGGTAGTTCTTCTCCATCTGG - Intronic
1058872296 9:109213050-109213072 GAAAGTCATTTCTCTTCTTCTGG + Intronic
1185670254 X:1803823-1803845 GGAAGAATTTCCTATCCTTCAGG + Intergenic
1186074050 X:5856978-5857000 TGAAGGAATTTCTCTCCTGCAGG + Intronic
1186592724 X:10948253-10948275 TGAGTTAATACCTCTCCTTCTGG + Intergenic
1187724119 X:22184689-22184711 GAAAGTAATTTCTTTCCCTCAGG + Intronic
1188680991 X:33004275-33004297 GGAAGTACTTCCTTGCCTTATGG + Intronic
1190228149 X:48561289-48561311 TGAAGTATTTCCCCTCCATCAGG - Exonic
1190517498 X:51239531-51239553 GGAATTTATTCATTTCCTTCAGG - Intergenic
1193314602 X:80049506-80049528 GGAATTTATCCATCTCCTTCAGG + Intergenic
1193364383 X:80613732-80613754 GCAAATATTTCCTCTCATTCTGG - Intergenic
1193889232 X:87022816-87022838 GGAAGTAATTGTTCCTCTTCTGG - Intergenic
1197515275 X:127420098-127420120 GGAATTTATTCATCTCCTTTAGG + Intergenic
1198656010 X:138914000-138914022 TGAGATAATTCCTCCCCTTCCGG + Intronic
1198728448 X:139701491-139701513 GGCAGAATTTCTTCTCCTTCAGG - Intronic
1200865136 Y:8035486-8035508 TGAAATAATTACTCTCATTCAGG + Intergenic
1200902082 Y:8442995-8443017 TGAAATAATTACTCTCATTCAGG - Intergenic