ID: 1021694356

View in Genome Browser
Species Human (GRCh38)
Location 7:23261881-23261903
Sequence AGTCCTTAAGAGTCCACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021694350_1021694356 11 Left 1021694350 7:23261847-23261869 CCACCCTATATTAATAGTCTGGG No data
Right 1021694356 7:23261881-23261903 AGTCCTTAAGAGTCCACTTTGGG No data
1021694354_1021694356 7 Left 1021694354 7:23261851-23261873 CCTATATTAATAGTCTGGGGACA 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1021694356 7:23261881-23261903 AGTCCTTAAGAGTCCACTTTGGG No data
1021694353_1021694356 8 Left 1021694353 7:23261850-23261872 CCCTATATTAATAGTCTGGGGAC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1021694356 7:23261881-23261903 AGTCCTTAAGAGTCCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021694356 Original CRISPR AGTCCTTAAGAGTCCACTTT GGG Intronic